ID: 950161959

View in Genome Browser
Species Human (GRCh38)
Location 3:10766946-10766968
Sequence GCAAAAGTCTTGAGATTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950161958_950161959 -2 Left 950161958 3:10766925-10766947 CCTGTACAACAGACATGGGAAGC No data
Right 950161959 3:10766946-10766968 GCAAAAGTCTTGAGATTGTTAGG No data
950161954_950161959 21 Left 950161954 3:10766902-10766924 CCTGTGGTTTATCTGAATTGAAC No data
Right 950161959 3:10766946-10766968 GCAAAAGTCTTGAGATTGTTAGG No data
950161953_950161959 22 Left 950161953 3:10766901-10766923 CCCTGTGGTTTATCTGAATTGAA No data
Right 950161959 3:10766946-10766968 GCAAAAGTCTTGAGATTGTTAGG No data
950161957_950161959 -1 Left 950161957 3:10766924-10766946 CCCTGTACAACAGACATGGGAAG No data
Right 950161959 3:10766946-10766968 GCAAAAGTCTTGAGATTGTTAGG No data
950161952_950161959 29 Left 950161952 3:10766894-10766916 CCTGCTTCCCTGTGGTTTATCTG No data
Right 950161959 3:10766946-10766968 GCAAAAGTCTTGAGATTGTTAGG No data
950161951_950161959 30 Left 950161951 3:10766893-10766915 CCCTGCTTCCCTGTGGTTTATCT No data
Right 950161959 3:10766946-10766968 GCAAAAGTCTTGAGATTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950161959 Original CRISPR GCAAAAGTCTTGAGATTGTT AGG Intergenic
No off target data available for this crispr