ID: 950161960

View in Genome Browser
Species Human (GRCh38)
Location 3:10766947-10766969
Sequence CAAAAGTCTTGAGATTGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950161953_950161960 23 Left 950161953 3:10766901-10766923 CCCTGTGGTTTATCTGAATTGAA No data
Right 950161960 3:10766947-10766969 CAAAAGTCTTGAGATTGTTAGGG No data
950161954_950161960 22 Left 950161954 3:10766902-10766924 CCTGTGGTTTATCTGAATTGAAC No data
Right 950161960 3:10766947-10766969 CAAAAGTCTTGAGATTGTTAGGG No data
950161957_950161960 0 Left 950161957 3:10766924-10766946 CCCTGTACAACAGACATGGGAAG No data
Right 950161960 3:10766947-10766969 CAAAAGTCTTGAGATTGTTAGGG No data
950161958_950161960 -1 Left 950161958 3:10766925-10766947 CCTGTACAACAGACATGGGAAGC No data
Right 950161960 3:10766947-10766969 CAAAAGTCTTGAGATTGTTAGGG No data
950161952_950161960 30 Left 950161952 3:10766894-10766916 CCTGCTTCCCTGTGGTTTATCTG No data
Right 950161960 3:10766947-10766969 CAAAAGTCTTGAGATTGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950161960 Original CRISPR CAAAAGTCTTGAGATTGTTA GGG Intergenic
No off target data available for this crispr