ID: 950163145

View in Genome Browser
Species Human (GRCh38)
Location 3:10774826-10774848
Sequence TCCTCCTGAGGCAGGAACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950163142_950163145 8 Left 950163142 3:10774795-10774817 CCATGAATGGGAAAGAAGGGAAG No data
Right 950163145 3:10774826-10774848 TCCTCCTGAGGCAGGAACGAAGG No data
950163141_950163145 9 Left 950163141 3:10774794-10774816 CCCATGAATGGGAAAGAAGGGAA No data
Right 950163145 3:10774826-10774848 TCCTCCTGAGGCAGGAACGAAGG No data
950163138_950163145 19 Left 950163138 3:10774784-10774806 CCGGGTATGACCCATGAATGGGA No data
Right 950163145 3:10774826-10774848 TCCTCCTGAGGCAGGAACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950163145 Original CRISPR TCCTCCTGAGGCAGGAACGA AGG Intergenic