ID: 950164524

View in Genome Browser
Species Human (GRCh38)
Location 3:10784113-10784135
Sequence CTCTAACAGGAAATGCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950164512_950164524 23 Left 950164512 3:10784067-10784089 CCCCATTTCAGTCTGGTGTCCTG No data
Right 950164524 3:10784113-10784135 CTCTAACAGGAAATGCAGTAGGG No data
950164521_950164524 -10 Left 950164521 3:10784100-10784122 CCAGGGTTCTACTCTCTAACAGG No data
Right 950164524 3:10784113-10784135 CTCTAACAGGAAATGCAGTAGGG No data
950164513_950164524 22 Left 950164513 3:10784068-10784090 CCCATTTCAGTCTGGTGTCCTGG No data
Right 950164524 3:10784113-10784135 CTCTAACAGGAAATGCAGTAGGG No data
950164519_950164524 -4 Left 950164519 3:10784094-10784116 CCACCTCCAGGGTTCTACTCTCT No data
Right 950164524 3:10784113-10784135 CTCTAACAGGAAATGCAGTAGGG No data
950164518_950164524 4 Left 950164518 3:10784086-10784108 CCTGGCAACCACCTCCAGGGTTC No data
Right 950164524 3:10784113-10784135 CTCTAACAGGAAATGCAGTAGGG No data
950164520_950164524 -7 Left 950164520 3:10784097-10784119 CCTCCAGGGTTCTACTCTCTAAC No data
Right 950164524 3:10784113-10784135 CTCTAACAGGAAATGCAGTAGGG No data
950164515_950164524 21 Left 950164515 3:10784069-10784091 CCATTTCAGTCTGGTGTCCTGGC No data
Right 950164524 3:10784113-10784135 CTCTAACAGGAAATGCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950164524 Original CRISPR CTCTAACAGGAAATGCAGTA GGG Intergenic
No off target data available for this crispr