ID: 950168026

View in Genome Browser
Species Human (GRCh38)
Location 3:10816206-10816228
Sequence CGCCGCCGCCCCGGGCGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 324}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950168026_950168031 -9 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168031 3:10816220-10816242 GCGGCGGCGCAGAGCCGGGCCGG 0: 1
1: 0
2: 6
3: 70
4: 592
950168026_950168032 0 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168032 3:10816229-10816251 CAGAGCCGGGCCGGCGCACGAGG 0: 1
1: 0
2: 0
3: 7
4: 134
950168026_950168035 12 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168035 3:10816241-10816263 GGCGCACGAGGCAGCCAGCGCGG 0: 1
1: 0
2: 1
3: 11
4: 140
950168026_950168037 24 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168037 3:10816253-10816275 AGCCAGCGCGGCCATGACGGCGG 0: 1
1: 0
2: 0
3: 5
4: 64
950168026_950168039 30 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168039 3:10816259-10816281 CGCGGCCATGACGGCGGAGAAGG 0: 1
1: 0
2: 2
3: 3
4: 52
950168026_950168036 21 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168036 3:10816250-10816272 GGCAGCCAGCGCGGCCATGACGG 0: 1
1: 0
2: 0
3: 11
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950168026 Original CRISPR CGCCGCCGCCCCGGGCGAGC TGG (reversed) Exonic
900310058 1:2029278-2029300 CGCCGCTGCTCCGAGGGAGCTGG + Intronic
900349743 1:2228685-2228707 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
900654244 1:3747194-3747216 CGCCGCCTGCCCAGGCGGGCCGG - Intergenic
901057404 1:6455108-6455130 CGCCGCCGCCCACGGCCCGCTGG + Intronic
901489453 1:9589174-9589196 CGCCGCCGCCCCCCGAGACCGGG + Intronic
901628922 1:10638870-10638892 CGGCGCCGCCCCGCGCGAAGCGG - Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902476955 1:16693371-16693393 CGCCGCCGCCCACGGCCCGCTGG - Intergenic
903389458 1:22953759-22953781 CGCCGCCGACCTGGCCAAGCTGG - Exonic
903829123 1:26164416-26164438 CGCCGCCGCCGCCTGCGAGGGGG + Intergenic
903855744 1:26336795-26336817 CGGGGCGGGCCCGGGCGAGCCGG - Intronic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904769017 1:32870761-32870783 CTGCGCCGCCCCGGGCCTGCCGG - Exonic
905449193 1:38046297-38046319 CGCCCTCGCCCGGGGCCAGCGGG - Exonic
905648304 1:39639756-39639778 CGCCGCAGCTCCGGGCGCCCAGG + Exonic
905734602 1:40316750-40316772 CGCCGCCTCCCAGGGGGCGCCGG - Intronic
906411760 1:45584437-45584459 CGCCGCTGCCCCCGGCAAGATGG - Intronic
906481632 1:46203303-46203325 CGCCCCCGCGCCGCGCGGGCGGG + Intronic
906961424 1:50421492-50421514 CGTCGCCGCGCCGGGCACGCTGG + Exonic
907012658 1:50978019-50978041 CGCGGCCGGCCGGGGCGAGCAGG + Intergenic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908360860 1:63367546-63367568 CGCTCCCGCACCGGGCGCGCGGG + Intergenic
909012903 1:70354409-70354431 CGCCGCCGCCAGGGGCAAGGGGG + Exonic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
911497781 1:98651368-98651390 CCCCGCCTCCCTGGGCAAGCTGG - Intergenic
912576365 1:110675326-110675348 CGCCGCGGCCCCGCGGGCGCCGG + Intergenic
912682666 1:111739101-111739123 CGCCCCGGCCCCCGGGGAGCCGG - Intronic
913109070 1:115641898-115641920 CGCGGCCGCGCCGGGCTCGCAGG + Intergenic
913186357 1:116373532-116373554 AGCCCCCTCCCCGGGCGCGCCGG - Intronic
913528036 1:119712546-119712568 CGCCTCCGCGCGGGGCGATCGGG + Intronic
915213328 1:154325565-154325587 GGCCGAGGCCCCGGGGGAGCGGG + Intronic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
916107008 1:161440295-161440317 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
916108569 1:161447709-161447731 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
916110157 1:161455090-161455112 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
916111742 1:161462500-161462522 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
916113329 1:161469881-161469903 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
917540408 1:175907231-175907253 AGCCGCCGCACCGGGCCAGAAGG + Intergenic
918487530 1:185045457-185045479 CCCCGCAGCGCCGGCCGAGCCGG + Exonic
920878470 1:209858905-209858927 CGCCGCCGCCCCGGGCAGTGAGG - Intergenic
921060022 1:211578066-211578088 CAACGTGGCCCCGGGCGAGCAGG - Exonic
922119093 1:222644508-222644530 CGCCGCTACCCCGGGGGACCCGG + Intronic
922817110 1:228457661-228457683 CGCCGGCGCCCCGGTCTATCTGG - Exonic
923119634 1:230978515-230978537 CCCCGCCGCCCCGGCCGACTCGG + Intronic
924482595 1:244451174-244451196 CTCCGCCGCCCTGGGCGGGGCGG + Intronic
1062774802 10:135806-135828 CGCGGCCGCCCAAGGCGAGTGGG - Intronic
1063407695 10:5813028-5813050 CCCCGCGTCCCGGGGCGAGCGGG - Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064167792 10:13001582-13001604 CGCCGCCGCCCCGTGCGCCCCGG - Exonic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1065883829 10:30059516-30059538 CGCCGCCGCTCCGGCCGGCCGGG + Exonic
1070570706 10:77637913-77637935 CAGCGCAGCCCGGGGCGAGCGGG - Intronic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1071086873 10:81875388-81875410 AGCCGCCGCCTCGGCCGAGGAGG + Exonic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1074814500 10:117134301-117134323 CGCCGCCGCCCCGGGCCCAGCGG - Exonic
1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG + Exonic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1075801741 10:125159076-125159098 CCCCAGCGCCCCGGGCGAGTTGG - Intronic
1075801884 10:125159482-125159504 CGCCGCCGCCACTGCCGCGCGGG - Intronic
1076156875 10:128211196-128211218 CGAGGTAGCCCCGGGCGAGCAGG - Intergenic
1076402568 10:130193559-130193581 ACCCGCCGACCCGGGAGAGCTGG - Intergenic
1076986012 11:236437-236459 CGCCCCCGCCCCCGGCGCCCCGG + Intronic
1076998459 11:310747-310769 CGCCCCCACCACGGGGGAGCAGG - Intronic
1077000284 11:319012-319034 CGCCCCCACCACGGGGGAGCAGG + Intergenic
1077081287 11:725826-725848 CGCCGGCGCCCCGTTCGAGCAGG + Exonic
1079126237 11:17720328-17720350 CGCCGCGGCCCGGGGGCAGCGGG - Exonic
1080012436 11:27472368-27472390 CCCCGCCGCCCCCGGGCAGCCGG + Exonic
1083669594 11:64292477-64292499 CACAGCCGCAGCGGGCGAGCAGG + Intronic
1083992974 11:66258011-66258033 CGCCCCCGCCCCGGGCCACCCGG - Intronic
1084021344 11:66420068-66420090 CGCCCCCGCCCCCGGCCCGCGGG + Intergenic
1089499904 11:118925773-118925795 CGCCGCCGCCCGGAGCCAGCCGG - Intronic
1089543664 11:119206281-119206303 CGCCGCCGCCGCCGGCTATCCGG - Exonic
1090344995 11:126062654-126062676 AGCCGCCGCCGCGCGCGCGCGGG - Intronic
1091226165 11:133957417-133957439 AGCCGGCGGCCCGGGAGAGCCGG + Intergenic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1091616183 12:2052883-2052905 CTCCGGCGCGCCGGGCGGGCGGG + Intronic
1091689027 12:2583265-2583287 CGCCGCGGCCCCAGGGCAGCCGG - Intronic
1091718416 12:2795540-2795562 CTCCGCCGCCCCGCGCGCGCCGG - Intronic
1092226705 12:6752806-6752828 CGCCTCCCCGCCAGGCGAGCAGG + Intronic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1096749842 12:53751725-53751747 AGCCGCGGCCCCGGGCGGGCGGG - Intergenic
1097046290 12:56189614-56189636 CGCCGCCGCGCCCGGCCTGCCGG - Intergenic
1097262292 12:57726557-57726579 CGCCGACGCCCCGGTTGCGCTGG - Exonic
1098426086 12:70366615-70366637 CGCCGCCGCCGCGCGACAGCAGG - Exonic
1102518474 12:113465296-113465318 GGCCGCGGCCCGCGGCGAGCCGG + Intronic
1102679981 12:114684730-114684752 TCTCCCCGCCCCGGGCGAGCCGG + Intergenic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1105799246 13:23889249-23889271 TGCCGCCCCGCCGGGCGGGCCGG - Exonic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112589101 13:100747707-100747729 CGCAGCAGCCCCGGCAGAGCAGG - Intergenic
1113201225 13:107868339-107868361 CTCCGCAGCCGCGGGCGAGCTGG + Intergenic
1113656040 13:112068236-112068258 CGCCGCCGCCGCCACCGAGCCGG - Exonic
1114485170 14:23057655-23057677 CGCCCCCGCCCCCGCCGCGCGGG - Intergenic
1115610661 14:35046235-35046257 CCGCCCCGCCCCGCGCGAGCCGG + Intronic
1117353483 14:54902562-54902584 CGCCGCGGCCCGGGCCCAGCAGG - Exonic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1117920292 14:60721695-60721717 CGCCGCCTCCGCTCGCGAGCCGG - Intronic
1119296497 14:73537580-73537602 CGCCGACACCCTTGGCGAGCTGG + Exonic
1119303959 14:73592118-73592140 CGCCGACGCCCGCGGCGAGCTGG + Exonic
1119786918 14:77320907-77320929 CCCCCCCGCCCCGGGCCGGCCGG - Exonic
1122075081 14:99230683-99230705 CACCGCCCGCCCGGGAGAGCAGG + Intronic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122546311 14:102524632-102524654 CGCCTCCGCCCCGGACCACCAGG + Intergenic
1122558137 14:102592451-102592473 CCCCGCCGCCCCGGACGGACGGG + Intergenic
1122629774 14:103102344-103102366 CGCGGCCGCGCTGGCCGAGCTGG + Exonic
1123480685 15:20628737-20628759 CGCCGCCGCCCGAGGAGAACGGG - Intergenic
1123637324 15:22371630-22371652 CGCCGCCGCCCGAGGAGAACGGG + Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1125516540 15:40324067-40324089 CGACGCGGCCCCGGCCGAGCGGG + Intergenic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1131272407 15:90955240-90955262 CGTCGCCGCCCGGGGCGCGGCGG - Intronic
1131367704 15:91853845-91853867 CCCCGACACCCGGGGCGAGCGGG + Exonic
1131827011 15:96330395-96330417 CGCCGCCGCCGCCGCCGAGAGGG - Intronic
1132111521 15:99105329-99105351 CGCGGCCGGCGCGGGCGAGAGGG + Exonic
1132482263 16:172628-172650 CGCCCTGCCCCCGGGCGAGCGGG + Intergenic
1132483111 16:176432-176454 CGCCCTGCCCCCGGGCGAGCGGG + Intergenic
1132484171 16:181574-181596 CGCCCCCTCCCGGCGCGAGCCGG + Intergenic
1134143606 16:11742762-11742784 CGCCGCCGCCTCGGGCCCGAAGG + Exonic
1135158475 16:20073677-20073699 CGCCGCCGCCACCACCGAGCCGG - Exonic
1135415725 16:22266783-22266805 CGCAGCCAACCTGGGCGAGCTGG + Exonic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1138105902 16:54287004-54287026 CTCCCCCGCCCGGCGCGAGCAGG - Intergenic
1138360687 16:56425189-56425211 CGAGGCCGGCCCCGGCGAGCCGG - Exonic
1139761414 16:69187322-69187344 CGACGCCGCCGCGGCCGAGCTGG + Exonic
1140209531 16:72959680-72959702 CGCCCCCGCCCTGGGTCAGCTGG + Exonic
1140354881 16:74297057-74297079 CGCGGCGGCCGCGGACGAGCTGG + Intronic
1141079206 16:81035960-81035982 CGCCGCCGCCTCGGGCCCGTGGG + Exonic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1142120357 16:88383710-88383732 GGCCGCCCGCCCGGGCGTGCTGG + Intergenic
1142764669 17:2058489-2058511 CGCCAGCGCCCCGGCCGCGCCGG - Exonic
1142863405 17:2776812-2776834 CCCCGCCGCCCCGGAGGAGGAGG + Intergenic
1143446829 17:7014804-7014826 CGCCGCCGCTACACGCGAGCCGG - Exonic
1145941163 17:28744082-28744104 AGCGGCCGGCACGGGCGAGCGGG - Exonic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146271438 17:31488188-31488210 CGCCGCCGACCCGCGCCCGCTGG + Intronic
1146393638 17:32444628-32444650 CGCCGCCTCCCCGGCCCCGCCGG + Intronic
1146492666 17:33293284-33293306 CCCCGCGGCTCCGGGCGGGCGGG + Intronic
1147258933 17:39197515-39197537 CGCCGCCGGCCCGGCCCAGCCGG + Exonic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148852412 17:50561428-50561450 AGCCGGGGCCCCGGGCGATCCGG - Intronic
1149658880 17:58324379-58324401 CACCGCCGCCCCCGGGTAGCTGG + Intronic
1150003133 17:61454511-61454533 GACGGCCGCCCCGGGCCAGCCGG + Intronic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150124377 17:62627253-62627275 CGCCCCCGCCCCGGGCTGGCCGG + Intergenic
1150212072 17:63446860-63446882 CGCCGCCGCTCCGGGAGCCCTGG + Intergenic
1151370868 17:73645318-73645340 CGCCGCCCCTCCCGGCGCGCAGG - Intergenic
1151856623 17:76726542-76726564 CGCCGCCGCCCAGGCCGGGGAGG - Exonic
1153265250 18:3262612-3262634 CGCCGCGGCGCCGGGAGGGCAGG - Exonic
1154125636 18:11689716-11689738 CTTCGCCGCCCCGAGGGAGCAGG - Exonic
1155570334 18:27185328-27185350 CGCCGCAGCCCCAGCCGGGCCGG - Intergenic
1157464207 18:47930538-47930560 GGCCGGCGGCCCGGGCGCGCGGG + Exonic
1157464311 18:47930839-47930861 CTCCGCCGCCGCGGCCGCGCGGG + Intronic
1157496777 18:48162007-48162029 CGGCGCCTGCCCGGGCGGGCGGG + Intronic
1157614005 18:48976171-48976193 CGCCGCCGCCCCGCTCCCGCGGG - Intergenic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1160454759 18:78992723-78992745 CGCGGCCGCCCCGAGCGCACCGG + Exonic
1160494994 18:79368073-79368095 CGCCATGGCCCCGGGTGAGCTGG + Intronic
1160495003 18:79368100-79368122 CGCCGTGGCCCCGGGTGAGCTGG + Intronic
1160724975 19:613859-613881 TGCGGCGGCCCCGGGTGAGCAGG - Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1160992354 19:1864866-1864888 CCCCGCCGCCCCGCCGGAGCTGG - Intergenic
1161248998 19:3270594-3270616 CCCGGCCGCCCCGGGCGCACAGG - Intronic
1162832977 19:13298662-13298684 CCTCGCCGCCCCGGGCCGGCCGG + Exonic
1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG + Exonic
1162959491 19:14117616-14117638 CGCCGCCGCCCAGCGCGCTCCGG - Exonic
1163118132 19:15200352-15200374 CCCCGACACCCCGGGCGGGCTGG - Intronic
1163509503 19:17726641-17726663 CCCCGCCGGCCCCGGCGAGAAGG + Exonic
1163606961 19:18280938-18280960 CTCCGCGCCCCCCGGCGAGCTGG - Exonic
1163714646 19:18866691-18866713 CCTCGCCGCCGCGGGCCAGCAGG - Exonic
1164594923 19:29526393-29526415 CGGAGCCGCACCGGGCAAGCCGG + Intergenic
1165533258 19:36421685-36421707 CGCCGACGCCCGCGGCGAGCTGG + Intergenic
1166547036 19:43639878-43639900 CGCCCCGCCCCCGGGCGGGCAGG - Intergenic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1167110414 19:47457384-47457406 CGCCGAGGCCCCAGGTGAGCTGG - Exonic
1167792189 19:51689523-51689545 CTCCGCCGCCCCGGGCCCGCAGG - Intergenic
1168076217 19:53982114-53982136 CTCCGCCAACGCGGGCGAGCCGG + Exonic
1202710971 1_KI270714v1_random:19197-19219 CGCCGCCGCCCACGGCCCGCTGG - Intergenic
925730627 2:6917650-6917672 CGCGGCCGGCCCGGGCGATGCGG - Intronic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
928093767 2:28392157-28392179 AGCGGGCGCCCCGGGCGCGCAGG - Intergenic
931602550 2:64019072-64019094 CGCCCCCGCCCCGCGCCCGCTGG + Exonic
932073485 2:68643519-68643541 CGCTCCCGCCCAGGGCGATCCGG + Intergenic
932599189 2:73112453-73112475 CTCCGCCGCCGCCTGCGAGCTGG - Exonic
932612459 2:73210005-73210027 TGCAGCGGCCCCGGGAGAGCTGG - Intronic
932771401 2:74502738-74502760 CGCCACCCTCCCGGGCGTGCGGG + Intronic
933684709 2:85133690-85133712 CGCCGCCCCCGCCGCCGAGCTGG - Exonic
933772647 2:85754049-85754071 CGCAGCTGCCCGGGGCGAGGGGG + Exonic
934031903 2:88055744-88055766 CGCCGCCTCCGCCGCCGAGCAGG + Intergenic
934296795 2:91748939-91748961 CGCCGCCGCCTCCAGCGCGCGGG + Intergenic
934678564 2:96266437-96266459 CGCCGCCGCACGAGGCCAGCAGG - Exonic
934978333 2:98821911-98821933 CGACGCCGGCCCGGGAGAGCGGG - Exonic
935349627 2:102142486-102142508 CGCCGCAGCCCTGGAGGAGCCGG + Intronic
937909487 2:127068620-127068642 CGCCGCCCTGCCTGGCGAGCCGG - Intronic
940883303 2:158968484-158968506 CGCCGCAGCCCGGGGCGGGGAGG + Intergenic
940918871 2:159286494-159286516 CTCAGACGCCCCGCGCGAGCAGG + Exonic
941020847 2:160407265-160407287 CGCCGCCGCCCGGGCCGGGCAGG - Intronic
942178396 2:173355894-173355916 AGTCGCCGCCCCGGTGGAGCTGG + Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942346079 2:175004798-175004820 CGCCCCCTCCCCGGGCGCCCAGG + Intronic
942454802 2:176130332-176130354 GGCGGCGGCCCCGGGCGGGCGGG - Exonic
945032955 2:205682311-205682333 CGTCGCCGCCCCGCCCGAGCTGG + Intronic
947353632 2:229271304-229271326 CGCCGCCGCCGCGCGCTCGCCGG - Intergenic
947729350 2:232419549-232419571 CGCCGCCGCCCGCCGCGACCGGG + Intergenic
948047007 2:234952371-234952393 CGCCGCTCCCCCGGGCGCTCGGG + Intronic
948116007 2:235494581-235494603 CGCCGCAGCCCCCGGGGAGCCGG - Exonic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1169065684 20:2693164-2693186 CGCTGGCGCCGCGGGCGGGCGGG + Intronic
1169214736 20:3786519-3786541 CGCCGCCGCCCCGGGGCGGGGGG + Exonic
1170596098 20:17806950-17806972 CCCAGCCGCCCCGGGGGGGCAGG + Intergenic
1171201307 20:23244648-23244670 CGCCGGCGCCCTGGGCCACCTGG + Intergenic
1172028950 20:31968255-31968277 CGCCGCCTCCCCGCGCCCGCCGG - Exonic
1173007382 20:39150703-39150725 TGGCGCCTCCCCGGGCCAGCAGG - Intergenic
1174607038 20:51768459-51768481 CCGCGCCGCCCCGGGGGAGGAGG + Exonic
1175215806 20:57391305-57391327 CCGCCCCGCCCCGGGCGCGCGGG - Intergenic
1176159425 20:63640941-63640963 AGCCGGCGCCCCTGGCCAGCAGG - Exonic
1177157358 21:17513026-17513048 CGCCGCCGCCGCGAGCCAGTCGG + Exonic
1178707360 21:34886926-34886948 GGCCGACCACCCGGGCGAGCTGG - Exonic
1178922503 21:36747843-36747865 CCCCGAGGCCCCGGGCGCGCCGG + Exonic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1178948415 21:36966722-36966744 CGCCGCCCCCCCGGGCCAGGCGG + Intronic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1179810153 21:43865098-43865120 CTCGGCCGCCCCGCGCGCGCCGG + Intergenic
1180871700 22:19150286-19150308 CGGCGGCGCCCCGGCCGGGCCGG - Intergenic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181068784 22:20319999-20320021 CGCCGCCGCCGGCGGCTAGCGGG - Exonic
1181165786 22:20982306-20982328 GGCCACCGCCCCGGGCCGGCTGG - Exonic
1181283448 22:21735922-21735944 CGCCCCCGCCCCGCGCGCTCCGG + Intergenic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1181478234 22:23181352-23181374 CGCGGCTGCCCCGGGCCTGCGGG - Exonic
1181778933 22:25178912-25178934 AGCCGGCGCCCCTGGCCAGCAGG - Intronic
1182296995 22:29315706-29315728 AGCCGCCGGCGCGAGCGAGCGGG + Exonic
1182692855 22:32175964-32175986 CTCCCCCTCCCCGGGCGCGCAGG - Intergenic
1183341652 22:37284929-37284951 CCCCACCGCCCCAGCCGAGCTGG - Intronic
1183452890 22:37906359-37906381 GGCCGCCGTCCCGGCCAAGCCGG + Exonic
1183872801 22:40753287-40753309 CGCAGCCTGCCAGGGCGAGCTGG - Intergenic
1184228242 22:43143054-43143076 CGCCGCCGCCCGCCGCGTGCTGG - Exonic
1184472258 22:44702543-44702565 GGCCGCCGCCGCGGACGAGCGGG + Exonic
1185055135 22:48575473-48575495 CGCCGCCTCCCCCGAGGAGCCGG + Intronic
949260514 3:2098902-2098924 CGCCGCCGCCCCGGGCCCCTCGG + Intronic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950650220 3:14402552-14402574 CGCCCCCGGCCCGGCCGAGCTGG + Intergenic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
952889041 3:38029165-38029187 CGCCGCCCCTCCGTGCGAGCGGG + Intronic
953439613 3:42906419-42906441 CCGCGCTGCCCCGGGCGCGCCGG + Exonic
954247013 3:49340028-49340050 CTCCGCGGCCCCGGCCCAGCCGG + Exonic
954912784 3:54122679-54122701 CGCCGCCGCAGCGGGCGCGTCGG + Exonic
955977041 3:64489509-64489531 CGGAGCGGCCCAGGGCGAGCCGG + Intergenic
956678249 3:71754580-71754602 CGACGGCGCCCCCGGCGCGCTGG + Exonic
963213952 3:142724290-142724312 CGCCGGCGCCCCGGCCGAGCCGG - Exonic
966096802 3:176213673-176213695 CCCCGCCGCCCCGGGCAATGAGG - Intergenic
966362931 3:179148914-179148936 GGCCGCCGCCCCGGCCGCGGTGG + Intronic
966449045 3:180037016-180037038 CGCCGCCGCAGCTGCCGAGCGGG + Intronic
966911271 3:184561748-184561770 CGCGGCCGCTCTGGGCGAGAGGG - Intronic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968514308 4:1009885-1009907 CGTCGCGGCCCCTGGCGGGCGGG - Intergenic
968545897 4:1198183-1198205 AGCAGCTGCCCCGGCCGAGCGGG - Intronic
968625074 4:1623343-1623365 CACCGCAGCCCCGGGAGAGGAGG + Intronic
968659635 4:1793702-1793724 CGCCGCCGCCCAGGGCTCCCGGG - Intronic
968964372 4:3762098-3762120 AGCCGCAGCCCCGGAAGAGCTGG + Intergenic
970636901 4:18020960-18020982 CGCCGCCGCCGAGCGCGAGAGGG + Intronic
972960652 4:44448434-44448456 GGCCGACGCGCCGGGCGAGCTGG + Exonic
975473277 4:74794298-74794320 CGCCGCTGCACCGGGCGGCCCGG + Exonic
979349274 4:119627330-119627352 CGGCGCAGCGCGGGGCGAGCGGG - Intronic
979674809 4:123398784-123398806 CGCCGCCGCTCCGGGTAATCGGG - Intronic
979683226 4:123483905-123483927 AGCCGCCGCCCCCGGCCATCTGG + Intergenic
981782628 4:148444765-148444787 CGCCGCCGCTGGGGGCGGGCGGG - Intergenic
984934466 4:184878242-184878264 AGCCACCGCCCCTGGCCAGCAGG + Intergenic
985444576 4:190015051-190015073 CACCGCCACCCCGGGGCAGCGGG - Intergenic
990210784 5:53480230-53480252 ACCCGCCACCCCGGGCGCGCCGG + Intergenic
991371632 5:65925758-65925780 CGCCACCGCCCCGGCCGCGACGG - Intergenic
992067457 5:73120711-73120733 CGCCGCCGGCGCAGGCGCGCGGG - Intronic
992104419 5:73437671-73437693 TGCCGGGGCCCCGGGCGAGCGGG + Intergenic
995787160 5:115842120-115842142 CGCCGCTGATCCGGGCGAGGGGG + Intronic
996329411 5:122312262-122312284 CGCCGGCGCGCCGGGCGCCCCGG + Exonic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997654357 5:135544454-135544476 TGCCGCCGCTCCGGAAGAGCTGG + Intergenic
997980617 5:138465598-138465620 CGCCCGCGCCCAGGGCGAGTCGG + Exonic
1000220462 5:159209312-159209334 CGCCGCCGCCCGAGGAGAACGGG - Intronic
1001470220 5:172006617-172006639 TGCCGGCGGCCCGGGCGGGCTGG - Exonic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1003097997 6:3157309-3157331 CGCGGCGGCCCCGGGCTGGCCGG - Intronic
1003290740 6:4776488-4776510 CGCCGCGGGGCCGGGCGGGCTGG - Exonic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004228864 6:13813827-13813849 CCCCGCCACCGCGGCCGAGCAGG + Intronic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1007630255 6:43269525-43269547 CGCCGGCGTCCCGGGCAAGTGGG - Intronic
1007701770 6:43770112-43770134 CCCCGCCCCCCGGGGCGGGCCGG + Intergenic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1013225560 6:108117762-108117784 CGCCGCTGCCCCGCGCGGCCGGG - Intronic
1013793557 6:113859927-113859949 CTCCGCGGCCGTGGGCGAGCCGG - Exonic
1014019531 6:116571498-116571520 AGCTGCCGCGCCGGGAGAGCGGG - Exonic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017662439 6:156687486-156687508 CGCCGCCGCGCTCGCCGAGCCGG - Intergenic
1017672277 6:156778835-156778857 CGCCGCCGCCCGCGCCGGGCCGG - Exonic
1017672443 6:156779386-156779408 CGCGGCCGCCCAGGCCGGGCTGG - Exonic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019323282 7:425166-425188 AGCGGCCGCCCCTGGGGAGCGGG - Intergenic
1019486064 7:1289750-1289772 CCCCGCCGCCCCCCTCGAGCCGG - Intergenic
1020275538 7:6622402-6622424 CGCCGCCGCCGCTGCCGTGCAGG - Exonic
1020418283 7:7969689-7969711 GGCCGCAGCCCCGGCCGAGCAGG + Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021313236 7:19117406-19117428 CGGCGCCGGCCCGGGCGATGCGG + Exonic
1021998521 7:26202230-26202252 CGCCGCAGCCTCGGGACAGCCGG - Intronic
1022097095 7:27147916-27147938 CGCCGCGGTCCCCGGGGAGCGGG - Intronic
1022100253 7:27165155-27165177 CGCCGCCGCCACGGGCGCCTGGG + Exonic
1022375375 7:29806898-29806920 CCACGCCGCCCCGGCCGGGCCGG + Intronic
1023722789 7:43113113-43113135 CGCCGCCGCCCGGTCCGGGCCGG + Intronic
1023773693 7:43583344-43583366 CGCCGCCGCCCCAGGCCCGCGGG + Exonic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1026909470 7:74083900-74083922 CGCCGCCGGCCCGGGGAGGCGGG - Intronic
1027267496 7:76502462-76502484 CGCCTCCGCCCTGGGCCAGTGGG - Intronic
1027319312 7:77002327-77002349 CGCCTCCGCCCCGGGCCAGTGGG - Intergenic
1029639821 7:101814103-101814125 CGCCGCCTCCCCGAGTGTGCAGG + Intergenic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1036432169 8:8701862-8701884 CGCCGCCCCGCCGGGCCAGGCGG - Intergenic
1036802523 8:11802946-11802968 CTTCCCCGCCCCGGGCAAGCAGG - Intronic
1038828467 8:31032901-31032923 CGCTGCGGCGCCGGGGGAGCCGG - Exonic
1038883712 8:31640436-31640458 CGCCTCCTCCCCGGGCTCGCCGG - Intronic
1043463894 8:80486696-80486718 CGCCCCCGCCCCCGGCGTTCCGG - Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045663936 8:104466550-104466572 CGGCGCCGCGCCGCGCGAGGCGG + Intronic
1047382148 8:124373131-124373153 CACCGCCGCTTCGGCCGAGCAGG + Intergenic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1055308205 9:74952245-74952267 CGCCACCGCCCCCCGGGAGCCGG + Exonic
1055454420 9:76459401-76459423 CCCCGTGGCCCCGGGCGGGCTGG + Intronic
1056643377 9:88388895-88388917 CGCCGCCGCCCCCTGCCCGCCGG - Intronic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1057463774 9:95292427-95292449 CGCCGCCGCCTCGGGCCCGTGGG + Intronic
1057921734 9:99104236-99104258 CCCCTCCGCCCCGCGGGAGCTGG + Intronic
1058851214 9:109013502-109013524 CGCCGCCGCCTCGGGCGGGTGGG - Exonic
1058861221 9:109119490-109119512 CGTCGAGGCCCTGGGCGAGCAGG - Exonic
1059145550 9:111896681-111896703 CGGCGCCGCAGCGGGCGCGCGGG + Intergenic
1060700630 9:125747000-125747022 CGCCGCCGCCTCGGCCAGGCGGG - Intergenic
1060700725 9:125747309-125747331 CGCCCCCTCCCCGCGCGGGCGGG + Intergenic
1060897270 9:127225638-127225660 CGCCGAAGCCGCGGGCGTGCGGG - Intronic
1061059795 9:128244698-128244720 CACCGCCGCCACTGGAGAGCTGG - Intronic
1061828441 9:133275546-133275568 CCCCGCCTCCCCGGGGGAGCAGG - Intergenic
1062162466 9:135087822-135087844 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
1062162583 9:135088239-135088261 CGCCGCCTCCCTGGGCGACTCGG - Intronic
1062517736 9:136944618-136944640 CGCCCCCGCCCTGCGCGACCCGG + Exonic
1062653531 9:137590429-137590451 CGCCGCCGCCTCGCGCCCGCCGG + Exonic
1062659198 9:137619365-137619387 CGCCGCCGCCGCCCGCAAGCCGG + Intronic
1203773676 EBV:61499-61521 CGCCGCCGCCCCCGCCGCGACGG - Intergenic
1187670036 X:21658140-21658162 CACCGCCGCCCCTGGCGTGCAGG - Exonic
1187826286 X:23335261-23335283 CGCCGCGGCCGCGGTCGGGCTGG + Intronic
1187904661 X:24054671-24054693 CCCCGCCGGCCCGTGCGAGGCGG - Intergenic
1187915727 X:24150365-24150387 CGCCGCCGCGCCGGGCCTCCGGG - Intronic
1188003523 X:25002639-25002661 CGCCGCCGCCGCCGGCCAGTCGG - Intergenic
1190008041 X:46758886-46758908 CGCCGCCGCCCCAGAGGAGGAGG + Exonic
1192847869 X:74924812-74924834 GGCCGCCACCCCGAGCCAGCCGG + Intronic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1195625222 X:106999927-106999949 CCCCGCCGGCCCTGGCGCGCCGG - Exonic
1196735188 X:118976251-118976273 CGCCCCTCCCCCGCGCGAGCGGG + Intronic
1198534744 X:137574676-137574698 TGCCGCGGCCTCGGTCGAGCTGG + Intronic
1198807166 X:140504058-140504080 CGCCGCCGCCTCGGGCTACGGGG - Exonic
1200224442 X:154409384-154409406 CCCCGCCTTCCCGGGCCAGCGGG + Intronic
1200224926 X:154412027-154412049 CGCCGCGGCCCCGACCTAGCGGG + Exonic
1200292483 X:154886325-154886347 CGCCGCCGCAGCTGGCGGGCGGG - Intronic
1200292610 X:154886818-154886840 GGCCGCCGCCCTGCGCGACCTGG + Exonic
1200339327 X:155382065-155382087 CGCCGCCGCAGCTGGCGGGCGGG - Intergenic
1200339454 X:155382558-155382580 GGCCGCCGCCCTGCGCGACCTGG + Exonic
1200347016 X:155458135-155458157 GGCCGCCGCCCTGCGCGACCTGG - Exonic
1200347143 X:155458628-155458650 CGCCGCCGCAGCTGGCGGGCGGG + Exonic