ID: 950168026

View in Genome Browser
Species Human (GRCh38)
Location 3:10816206-10816228
Sequence CGCCGCCGCCCCGGGCGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 324}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950168026_950168037 24 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168037 3:10816253-10816275 AGCCAGCGCGGCCATGACGGCGG 0: 1
1: 0
2: 0
3: 5
4: 64
950168026_950168036 21 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168036 3:10816250-10816272 GGCAGCCAGCGCGGCCATGACGG 0: 1
1: 0
2: 0
3: 11
4: 201
950168026_950168032 0 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168032 3:10816229-10816251 CAGAGCCGGGCCGGCGCACGAGG 0: 1
1: 0
2: 0
3: 7
4: 134
950168026_950168039 30 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168039 3:10816259-10816281 CGCGGCCATGACGGCGGAGAAGG 0: 1
1: 0
2: 2
3: 3
4: 52
950168026_950168035 12 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168035 3:10816241-10816263 GGCGCACGAGGCAGCCAGCGCGG 0: 1
1: 0
2: 1
3: 11
4: 140
950168026_950168031 -9 Left 950168026 3:10816206-10816228 CCAGCTCGCCCGGGGCGGCGGCG 0: 1
1: 0
2: 1
3: 47
4: 324
Right 950168031 3:10816220-10816242 GCGGCGGCGCAGAGCCGGGCCGG 0: 1
1: 0
2: 6
3: 70
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950168026 Original CRISPR CGCCGCCGCCCCGGGCGAGC TGG (reversed) Exonic