ID: 950168143

View in Genome Browser
Species Human (GRCh38)
Location 3:10816688-10816710
Sequence GTGCGCGTGCGCACTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950168143_950168151 18 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168151 3:10816729-10816751 GGGTTCCACCTGCCAGCGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 80
950168143_950168145 -3 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168145 3:10816708-10816730 CACGTGCCAATTCGCACCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 39
950168143_950168150 17 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168150 3:10816728-10816750 AGGGTTCCACCTGCCAGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 136
950168143_950168146 -2 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168146 3:10816709-10816731 ACGTGCCAATTCGCACCTGAGGG 0: 1
1: 0
2: 0
3: 0
4: 32
950168143_950168149 16 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168149 3:10816727-10816749 GAGGGTTCCACCTGCCAGCGCGG 0: 1
1: 0
2: 0
3: 19
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950168143 Original CRISPR GTGCGCGTGCGCACTGGCAC AGG (reversed) Intronic
900177498 1:1297375-1297397 GTGTGTGTGTGCACAGGCACGGG + Intronic
900177564 1:1297601-1297623 GTGTGTGTGTGCACAGGCACGGG + Intronic
901209497 1:7516440-7516462 GGGCGTGTGTGCACTGGCTCTGG - Intronic
903845974 1:26280208-26280230 GTGCGCGCCCGGACTGGCGCTGG + Intronic
903968320 1:27103102-27103124 GAGCCCCTGGGCACTGGCACAGG + Intronic
907296757 1:53460511-53460533 GTGCGCAGGCGCACTGGGCCAGG - Intronic
924488734 1:244513738-244513760 GTGTGCATGGGCACTGGCAGTGG + Intronic
1064981819 10:21173637-21173659 GTGTGCGTGTGCCTTGGCACGGG - Intronic
1065917347 10:30364897-30364919 GTGAGCGTGGGCAGGGGCACTGG - Intronic
1075871655 10:125775576-125775598 GCGCACGCGCGCACAGGCACAGG - Intronic
1077124339 11:925819-925841 GTGCGCGTGCGTGCTGGTGCGGG + Intronic
1079135142 11:17772221-17772243 GTGCGTGTGCTCACTGGCGCTGG - Exonic
1084087013 11:66859453-66859475 ATGGGTGTGTGCACTGGCACAGG - Intronic
1089816667 11:121182603-121182625 GTGCATGTGAGCACTGGCAGTGG + Intronic
1091804094 12:3343590-3343612 GTGCTCCTGGGCACTGGCCCCGG - Intergenic
1092840414 12:12535146-12535168 GAGCGGCTGAGCACTGGCACAGG - Intronic
1095971622 12:47905444-47905466 GGGCGCCTGCCGACTGGCACCGG + Intronic
1097248908 12:57621639-57621661 GGGCGCATGAGCCCTGGCACGGG + Intronic
1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG + Exonic
1099281221 12:80649518-80649540 GTTCGCGTTAGCATTGGCACTGG - Intronic
1103910371 12:124348887-124348909 GCACGCATGTGCACTGGCACGGG + Intronic
1104035883 12:125096877-125096899 CAGCGCCTGGGCACTGGCACTGG - Intronic
1105968018 13:25402492-25402514 GTGCTGGTGTGCCCTGGCACTGG + Intronic
1108176378 13:47796966-47796988 GTGCACGTGGCCACTTGCACGGG - Intergenic
1112508762 13:99990821-99990843 GTGCGCGCGCGCAAAGGCAAGGG - Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1119866769 14:77980989-77981011 GAGCGCGTGCGCGCGGACACAGG - Intergenic
1121902677 14:97708248-97708270 GTGCGCATGCACACCTGCACAGG + Intergenic
1129476305 15:75786472-75786494 GTGGGCGTGGGCACTGGAGCCGG + Intergenic
1130276069 15:82476968-82476990 GTGAACGTGCGTGCTGGCACCGG - Intergenic
1141990213 16:87604991-87605013 GTGCGCGCGCGTGCAGGCACAGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1147995139 17:44356050-44356072 CTGTGGGTGCGCAATGGCACTGG - Exonic
1150931251 17:69587984-69588006 GTGCACGTGAGCACCTGCACTGG + Intergenic
1155368547 18:25074076-25074098 GTGCGTGTGTGCACGCGCACGGG + Intronic
1159574347 18:70157112-70157134 GGGCAAGTGCGCACTGGCAGGGG - Intronic
1160992953 19:1867958-1867980 GTGTGCGTGCGCGCATGCACTGG + Intergenic
1161065727 19:2236355-2236377 GTGCGCAGGCGCACTAGCCCTGG - Exonic
1161839585 19:6671265-6671287 GTGTGTGTGCGCACTTGCACGGG + Intergenic
1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG + Exonic
1165327836 19:35124617-35124639 TTGCGCGTGCGCCGGGGCACAGG - Exonic
1167019133 19:46861214-46861236 GTGCGCGAGCTCACGGGCCCCGG + Intergenic
1167473110 19:49686276-49686298 GTGCGCCTCCGCCCTGGCTCGGG - Intronic
1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG + Intronic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
1168065216 19:53915361-53915383 GTGGCCGTGCGCACTGTCTCTGG - Exonic
1168174034 19:54609718-54609740 GTTCGTGTGCGCATTTGCACCGG - Intronic
1168337621 19:55605485-55605507 ATGCGCTTGCGCACTGACTCGGG - Intronic
928158054 2:28894640-28894662 GTGCGCAGGCGCACCGGCGCGGG - Exonic
929772015 2:44900380-44900402 GTGAGAGTGTGAACTGGCACAGG + Intergenic
935011624 2:99141405-99141427 GTACGCGTGCGCACCGGGCCTGG - Intronic
943488086 2:188514075-188514097 GTGTGTGTGCGCCCTGCCACTGG + Intronic
945525984 2:210888294-210888316 GTGCAGGTGTGCACTGGCAGAGG - Intergenic
1169115098 20:3059431-3059453 GTGTGCATGGGCACTGGCAGTGG - Intergenic
1169473022 20:5904558-5904580 GTGCGCGTGCACACACACACAGG - Intergenic
1175958876 20:62625060-62625082 GTGAGCGTGTGCCCAGGCACGGG + Intergenic
1177078339 21:16606911-16606933 GTGCGTGTGCGCATGTGCACAGG + Intergenic
1179775377 21:43658763-43658785 CTGCGCGGGCGCCCTTGCACTGG + Intronic
1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG + Exonic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1184791204 22:46701261-46701283 CTGCCCGTGCCCACTGCCACAGG + Intronic
950096274 3:10332628-10332650 GTGGGCGTGGGCACTGGTTCCGG + Intronic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
958970890 3:100609214-100609236 GTGAGTGTGCATACTGGCACAGG - Intergenic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
967283329 3:187843752-187843774 GTGAGCGTGGGCACTGGTGCTGG - Intergenic
985986162 5:3518336-3518358 GTGCGCGTGCACACCGCCACGGG + Intergenic
1005580383 6:27228520-27228542 GTGAGCGTGAGCCATGGCACCGG - Intergenic
1012986350 6:105880408-105880430 GGGCGCGTGTGCTCCGGCACAGG - Intergenic
1019595537 7:1856732-1856754 GTGCGCGTGGGCCCTGCCGCTGG - Intronic
1019631936 7:2054055-2054077 GTGCTCGTGGGCTCTGGCCCTGG - Intronic
1032080214 7:128854913-128854935 GTGGGCGTCCACACTGGCAGTGG + Intronic
1033993907 7:147321628-147321650 GTGCTCTTGCGCACTGGCACTGG - Intronic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1036561496 8:9903583-9903605 GTGTGCGTGCGCACTGACAGCGG + Intergenic
1037588921 8:20296733-20296755 GTGTGCATGTGCTCTGGCACTGG + Intronic
1037971624 8:23176163-23176185 GTGCGCGCGCGCACCTGTACGGG + Intergenic
1047516336 8:125557580-125557602 GTGCGCGTGCGTTCAGGCATGGG - Intergenic
1059828113 9:118056668-118056690 GTGCACATGTGCACAGGCACAGG - Intergenic
1060814183 9:126626185-126626207 GTCCCCGTGCGCCCTGGCAGAGG + Intronic
1061575346 9:131502887-131502909 GCGCGCGTGCGCACTGGGAGAGG - Intronic
1185505778 X:631415-631437 GCGCGCGTGGGCACCGACACGGG + Intronic