ID: 950168143

View in Genome Browser
Species Human (GRCh38)
Location 3:10816688-10816710
Sequence GTGCGCGTGCGCACTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950168143_950168145 -3 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168145 3:10816708-10816730 CACGTGCCAATTCGCACCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 39
950168143_950168146 -2 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168146 3:10816709-10816731 ACGTGCCAATTCGCACCTGAGGG 0: 1
1: 0
2: 0
3: 0
4: 32
950168143_950168151 18 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168151 3:10816729-10816751 GGGTTCCACCTGCCAGCGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 80
950168143_950168149 16 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168149 3:10816727-10816749 GAGGGTTCCACCTGCCAGCGCGG 0: 1
1: 0
2: 0
3: 19
4: 103
950168143_950168150 17 Left 950168143 3:10816688-10816710 CCTGTGCCAGTGCGCACGCGCAC 0: 1
1: 0
2: 2
3: 6
4: 73
Right 950168150 3:10816728-10816750 AGGGTTCCACCTGCCAGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950168143 Original CRISPR GTGCGCGTGCGCACTGGCAC AGG (reversed) Intronic