ID: 950174488

View in Genome Browser
Species Human (GRCh38)
Location 3:10863238-10863260
Sequence AGGGCTAAGTAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950174482_950174488 22 Left 950174482 3:10863193-10863215 CCAGGTCTGTGAACAGCTGACTG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG 0: 1
1: 1
2: 1
3: 36
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950174488 Original CRISPR AGGGCTAAGTAGAAGGAGGA AGG Intronic
901169543 1:7246628-7246650 AGGGATCAGAGGAAGGAGGAGGG - Intronic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
902343185 1:15797951-15797973 AGTGCCAAGTAGGAAGAGGATGG + Intergenic
903019995 1:20387044-20387066 AGGGCTGAGGGGGAGGAGGAAGG + Intergenic
903679790 1:25089223-25089245 AGGGCTGAGTGGGAGCAGGATGG + Intergenic
903827814 1:26158141-26158163 AGGGCTAGAAAGGAGGAGGAGGG + Intergenic
905019784 1:34801071-34801093 AAGGCTCTGAAGAAGGAGGAAGG + Intronic
905889330 1:41509752-41509774 AGGTGCAGGTAGAAGGAGGAGGG - Exonic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
907096466 1:51785639-51785661 AGGGCTAACTATAAGAATGAGGG - Intronic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908403488 1:63792039-63792061 AGGGCCAAGAAGAATGAGCAGGG + Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
908943868 1:69470386-69470408 AGGGCTAAGTGAATGGAAGAAGG + Intergenic
910252795 1:85215669-85215691 AGGGCCAAGTAGCAGAAGGATGG - Intergenic
910607129 1:89099439-89099461 AGGTCTGAGTAAGAGGAGGAAGG - Intergenic
910610210 1:89133512-89133534 ATGGCTAAGTAGATGGAGTCAGG + Intronic
911458014 1:98152284-98152306 AGGGCTTATTGGAAGGTGGAGGG - Intergenic
912432972 1:109639220-109639242 GGGGCAAGGTGGAAGGAGGAGGG + Intergenic
913008428 1:114658146-114658168 AGGTTTAAGGAGAAGGAAGAAGG + Intronic
913575944 1:120175174-120175196 ACTGCTAAGGAGAAGGAAGAGGG - Intronic
914344458 1:146786554-146786576 AGGGCTTATTTGAGGGAGGAAGG - Intergenic
914558258 1:148790745-148790767 ACTGCTAAGGAGAAGGAAGAGGG - Intergenic
914614577 1:149339485-149339507 ACTGCTAAGGAGAAGGAAGAGGG + Intergenic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915580162 1:156808673-156808695 AGGGCTGGGGAGAAGGAAGAGGG + Intronic
916738411 1:167628341-167628363 AGGACTAGGTAGAGGGAGAAAGG + Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
918991395 1:191701187-191701209 AGGGCAAAGGAGAGGGAAGAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919469821 1:197964367-197964389 AGGCTGAAGTGGAAGGAGGATGG + Intergenic
919840503 1:201605781-201605803 AGGGCTAAGGAGAGGGGGAATGG + Intergenic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920285520 1:204875932-204875954 GGGGAAAAGTGGAAGGAGGAGGG + Intronic
921218457 1:212956317-212956339 AGGGCTAGGGGGCAGGAGGAGGG - Intronic
921320128 1:213930638-213930660 AGGGCTGATTAGAAGGCAGAGGG - Intergenic
922572183 1:226640689-226640711 AGCGTTAAGGAGAAGGCGGATGG + Intronic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
923538547 1:234871522-234871544 AGGGCTGGGGAGAAGCAGGATGG - Intergenic
924328141 1:242916144-242916166 AGGGGTTTGTAGAATGAGGAAGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063862186 10:10323076-10323098 AAGGTTAAGTAGATGGTGGATGG + Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064806233 10:19137194-19137216 AGGGATGAGTAGGAGGAGGGTGG + Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065464204 10:26001679-26001701 AGGTCTTAAAAGAAGGAGGAGGG + Intronic
1065586554 10:27224124-27224146 AGGCCAAAGCAGGAGGAGGATGG + Intronic
1067013120 10:42732913-42732935 TGGGCTAAGGAGGAAGAGGAGGG + Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067082881 10:43221545-43221567 AGGGCTCCGGAGAAGGAGAATGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068777863 10:60887615-60887637 AGGGCCAAGGAGCATGAGGACGG + Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1068936817 10:62643782-62643804 AGGGTGAAGTAGAAGGAAGCTGG + Intronic
1069181469 10:65365143-65365165 AGGGCTAAGAATAAAGAGCAGGG - Intergenic
1070290875 10:75112258-75112280 AGGTTTGACTAGAAGGAGGAGGG + Intronic
1071083591 10:81841699-81841721 AGAGCTAAGTAGAAGAAGGCAGG + Intergenic
1071379045 10:85039320-85039342 AGGGCTTACTTGAAGGTGGAGGG - Intergenic
1072014044 10:91328301-91328323 GGTGCTAAGCAGAAGGGGGAGGG - Intergenic
1072185498 10:93034352-93034374 GGGGCTAAGAACAAGGAGGTGGG - Intronic
1073122507 10:101131388-101131410 AGGCTAAAGTAGAAGGGGGAGGG - Exonic
1073358838 10:102880078-102880100 AGGGCTATAGAGAAGTAGGATGG + Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1074547288 10:114410862-114410884 GGGGCTAGGGAGAAGGAGAATGG - Intergenic
1077439543 11:2561660-2561682 ATCGCTAAGCAGGAGGAGGATGG - Intronic
1078127696 11:8584635-8584657 AGGGCCAGGCATAAGGAGGAAGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079638262 11:22772724-22772746 AGAGATGAGTAGAAGGAGGGAGG + Intronic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1084395736 11:68908795-68908817 AGGACTGAGTACAAGGAGGACGG - Intronic
1087365802 11:97217400-97217422 AGGGGAAAGTGGAAGCAGGATGG - Intergenic
1087528868 11:99353610-99353632 ATGGCTAAGTCAAAAGAGGAGGG + Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089380897 11:118030695-118030717 AGGGCTGAGCAGGAAGAGGAAGG + Intergenic
1090178236 11:124670999-124671021 AGAGCTAAGTAGAGAGAGGGTGG + Intronic
1091387276 12:103332-103354 GGGGCTCAGGAGAAGGAGGTGGG + Intronic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094397387 12:30022733-30022755 AGAGCTCAGTGGGAGGAGGAAGG + Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096240489 12:49957309-49957331 AGGGCTGGGTGGTAGGAGGAAGG - Exonic
1096470708 12:51873836-51873858 AGGACTAGGTAGATGCAGGATGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096580768 12:52583290-52583312 TGGGCTAAGTGAAAGGTGGAGGG - Intergenic
1096793292 12:54058460-54058482 ATGGCTAAGTAAAAAGAAGACGG + Intergenic
1097240036 12:57568870-57568892 AGGGCTCAGTCCACGGAGGAAGG - Intronic
1097861446 12:64522469-64522491 TGGGCTGAGTGGGAGGAGGAGGG - Intergenic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098234115 12:68402045-68402067 ACAGCTAACTAGATGGAGGAAGG + Intergenic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1100029592 12:90169851-90169873 AGGGCAGAGTAGAAGAAAGATGG + Intergenic
1100196623 12:92253613-92253635 AGGGCTAAGTGAAAGAAGGGAGG + Intergenic
1100604889 12:96143529-96143551 AGGGCAGAGCAGAAAGAGGAAGG + Intergenic
1100982210 12:100170724-100170746 AGTGCCAAGTTGAAGGATGATGG + Intergenic
1101346979 12:103894888-103894910 AGAGCTCTTTAGAAGGAGGAAGG - Intergenic
1102037663 12:109781458-109781480 AGGGCAACGTAGAAGGAGGTGGG + Intergenic
1103763991 12:123269294-123269316 AGGGCTGAGAGGGAGGAGGAAGG + Intronic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1103862931 12:124028595-124028617 AGGGCCAAGCAAAAGCAGGAGGG + Intronic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104896102 12:132164584-132164606 ATGGCTAGGTAGACGGATGATGG - Intergenic
1105660417 13:22487999-22488021 TGGGCCAAATAGGAGGAGGAGGG + Intergenic
1106124019 13:26885384-26885406 AGGGGAAAGTAGCAGGAGGAAGG + Intergenic
1106260829 13:28065213-28065235 AGGGATATGTAGAAAGAGGGTGG + Intronic
1107420124 13:40238354-40238376 AGCCCCAAGTGGAAGGAGGATGG - Intergenic
1108178695 13:47820217-47820239 AGGGCTAAGTAGAAAATGAAGGG - Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1109086445 13:57977875-57977897 AAGGCTAAGAAAATGGAGGATGG + Intergenic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1112207302 13:97337429-97337451 TGGGCAAAGGAGACGGAGGAAGG - Intronic
1112240430 13:97676289-97676311 AGTGCCAGGTAGAAGGTGGATGG - Intergenic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116991738 14:51284522-51284544 AGAGATAAGTAAAAGGAGGCAGG - Intergenic
1117610027 14:57473659-57473681 AGGGGAAAGTAAAAGGATGAAGG - Intronic
1117872388 14:60214642-60214664 AGGTCAAAGTAGAAGAAGGTTGG + Intergenic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118850592 14:69580340-69580362 AGGGCAATGTTGCAGGAGGAAGG + Intergenic
1119171077 14:72536875-72536897 AGTTCTAAGGAGGAGGAGGAAGG - Intronic
1119556381 14:75556434-75556456 AGGGCTGAGCAGAATGAGCAAGG - Intergenic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120930056 14:89839343-89839365 AGAGCAAAGTAGAATGGGGATGG + Intronic
1120940790 14:89947110-89947132 AGTGCAAAGGAGAAGGAAGATGG + Intronic
1121159668 14:91726059-91726081 ATGGCTACCTAGAAGGGGGATGG - Intronic
1121460871 14:94076925-94076947 TAGGCTGAGTAGAAAGAGGAGGG - Intronic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1123219116 14:106840267-106840289 GGAGCTACGTTGAAGGAGGATGG - Intergenic
1202893163 14_KI270722v1_random:178764-178786 AGGCCTAATGAGAAGGAGCATGG - Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124637440 15:31374036-31374058 AGGGCTGAGTAGAAGCAGGATGG - Exonic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124985382 15:34604845-34604867 AGGGATTACTAGAAGGAGAAGGG + Intergenic
1125419142 15:39486789-39486811 AAGACTAAGTAGAAGGAATACGG - Intergenic
1125822751 15:42646940-42646962 AGGCCTGAGTAGAGGGAGAAAGG + Intronic
1127010689 15:54624036-54624058 AGGGCTAAGGAAAATGAAGAAGG + Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1128258438 15:66214980-66215002 AGGGCTGAGGAGCAGGAGGGAGG + Intronic
1128435780 15:67646106-67646128 AGTGGTAAGAAGAAGGAGGTGGG + Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128671379 15:69576896-69576918 AGGGATAGGAAGGAGGAGGAAGG + Intergenic
1129118944 15:73383261-73383283 AGGGCTTTGAAGATGGAGGAAGG + Intergenic
1129344790 15:74910291-74910313 AGGTCTGAGTAGTAGGAGCAAGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129952815 15:79607088-79607110 AGGGCCAGGTCCAAGGAGGAAGG - Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1132611459 16:818380-818402 AGGCCAAAGCAGAAGGAGGCAGG + Intergenic
1132788679 16:1672829-1672851 AGAGCTGAGGAGACGGAGGACGG - Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1135991613 16:27222025-27222047 TGGGGTAACTAGAAGGGGGATGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137333765 16:47527858-47527880 AGGACAAAGCAGCAGGAGGATGG + Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1138339063 16:56276737-56276759 AAGGCTAAATAAAAGGAGGGAGG + Intronic
1138589592 16:57992484-57992506 AGGGCTGGGAAGAAGAAGGAAGG - Intergenic
1139164382 16:64548741-64548763 AGGGTTCTGTAGGAGGAGGAAGG - Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139989541 16:70928795-70928817 AGGGCTTATTTGAGGGAGGAAGG + Intronic
1140198758 16:72877782-72877804 AGGGCTGACTGCAAGGAGGAGGG - Intronic
1141428918 16:83960877-83960899 GGGGCTGGGTAGAGGGAGGAGGG - Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1143349653 17:6277943-6277965 AGGGCTCATTAGAAGGAAAAAGG - Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143612918 17:8030296-8030318 AGGGCTAAGCAGAATGAGATAGG - Intergenic
1144366999 17:14554188-14554210 AGGTCTCAGAAGAAGGAGGTTGG + Intergenic
1144942374 17:18950661-18950683 AGGACTAGGCAGAAGAAGGAAGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1146376079 17:32295460-32295482 AGGGCTAAGGAGCAGCGGGATGG + Intronic
1146432386 17:32809983-32810005 AGGGCTAAGTAAAGGGTGAAGGG + Intronic
1146472221 17:33133751-33133773 GGGGCAGGGTAGAAGGAGGAGGG - Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1147301872 17:39535869-39535891 AGGGCTAAGTGGAATGGGAATGG + Intronic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1148745204 17:49914208-49914230 AGGGCTGAGCAGCTGGAGGAGGG - Intergenic
1148988937 17:51648597-51648619 AGTGCAAAGTTGAAGGAGGAAGG - Intronic
1149374630 17:56031697-56031719 ATGGCTGAGTAAAATGAGGAAGG + Intergenic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1149775737 17:59355598-59355620 AGAGCTCAGGAGAAAGAGGAGGG - Intronic
1150119442 17:62587634-62587656 AGGGCTTAGCAGAGGGAGAAGGG + Intronic
1150610801 17:66731599-66731621 AGGGCTCAGCAGAAAAAGGAAGG - Intronic
1151425356 17:74027706-74027728 AGGGCTGAGATGAGGGAGGAAGG + Intergenic
1153224367 18:2887271-2887293 AGGACAAAATAAAAGGAGGAGGG - Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1157030493 18:43900972-43900994 AAGGCTAAGGAAGAGGAGGAAGG - Intergenic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1158498969 18:57983114-57983136 AGGACTAAGCCGATGGAGGAAGG + Intergenic
1158547594 18:58409413-58409435 AGGGTCAAGTAGAAAGTGGAAGG + Intergenic
1158983991 18:62794909-62794931 AGGATTAAGTAGATGGAGTAGGG + Intronic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1161195438 19:2983752-2983774 AGGACAGAGAAGAAGGAGGAGGG + Intronic
1161816537 19:6502702-6502724 AGGTCTAAATAGAATGAGAAGGG - Intronic
1162182280 19:8878307-8878329 AGTGATAAATGGAAGGAGGAAGG - Intronic
1162194372 19:8972951-8972973 AGGGGGAAGTGGAAGAAGGATGG + Exonic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1165914771 19:39251319-39251341 AGGGCTAGGAAAAAGGAGGCTGG - Intergenic
1167166531 19:47803154-47803176 AGGGAAAAGTAGGGGGAGGAGGG + Intronic
1167175310 19:47860610-47860632 AGGGGAAAGTAGGGGGAGGAGGG - Intergenic
1167208415 19:48117847-48117869 AGGGCTGGGGAGAGGGAGGAAGG + Intronic
1167566773 19:50261736-50261758 AGGGCTGAGGAGCAGGTGGATGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925553452 2:5101982-5102004 GGGGATTAGTAGAAGGAGAAGGG + Intergenic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
926948997 2:18220906-18220928 AGGGCTAAAGAAAAGGGGGATGG + Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
929286631 2:40142265-40142287 AGGGTTTATTTGAAGGAGGAAGG + Intronic
930044206 2:47154932-47154954 AGGGCGAAGGAGAAGGAAAAGGG + Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931392385 2:61855013-61855035 AGGGCTGGGGAGCAGGAGGAGGG - Intergenic
935131654 2:100265292-100265314 AGGGCTGGGGAGAAGGAGAAGGG - Intergenic
935713491 2:105919432-105919454 AGCTGTAAGTAGAGGGAGGATGG + Intergenic
936342165 2:111643304-111643326 AGAGAAAATTAGAAGGAGGAAGG - Intergenic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937609739 2:123846414-123846436 AGGGATGACTAGAAGGAGGATGG + Intergenic
937969108 2:127536033-127536055 GGGGCTGAGGAGGAGGAGGAGGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938394020 2:130928694-130928716 AGGGTAAAGTAGATGTAGGAGGG - Intronic
938625623 2:133105978-133106000 GGGTTTAGGTAGAAGGAGGATGG - Intronic
939360835 2:141170486-141170508 ATGGCTAAGTAAAAGGAAGTGGG - Intronic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
939992605 2:148889423-148889445 TGGGCTATATAGAGGGAGGAAGG + Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940093991 2:149952852-149952874 AGGGCTCAGGAGAAGGGGAAAGG - Intergenic
941159240 2:162017373-162017395 AGGGCTCAGTAGAATGAAGTAGG + Intronic
941329601 2:164164009-164164031 AGGGCTTAGTAGGAGGAGTGGGG - Intergenic
941420646 2:165279734-165279756 AGAGATTAGTGGAAGGAGGAGGG + Intronic
941673438 2:168319306-168319328 GCAGCTGAGTAGAAGGAGGATGG + Intergenic
942051797 2:172147113-172147135 AGGGCTAAGAAGCGGGAGGGAGG + Intergenic
942302913 2:174579729-174579751 AGGGCTCTGTTGAAGGAGGCTGG - Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944658884 2:201903759-201903781 AGGGCTGAGAAGGAAGAGGAAGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945976648 2:216276295-216276317 AGGGCTCAGCAGGAGTAGGAAGG + Intronic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
947135384 2:226972420-226972442 AGGGCTGAGAAAGAGGAGGATGG - Intronic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
1169118830 20:3083539-3083561 AGGGCGAGGAGGAAGGAGGAAGG - Intronic
1169454634 20:5741473-5741495 AGGTCTAAGGAAAAGAAGGAGGG - Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1172435846 20:34928494-34928516 AGGACTGAGTGGTAGGAGGAGGG - Exonic
1172471154 20:35197430-35197452 AGGGCCAAGAAGAGGGAGAAAGG - Intergenic
1173554055 20:43953052-43953074 ACGGCTATGAAGATGGAGGAAGG + Intronic
1173662878 20:44746151-44746173 ATGGCGAAGTAGAAGGAGCCGGG - Exonic
1173698403 20:45043844-45043866 AGGGGAAAGTGGAAGGAGGGAGG - Intronic
1174058194 20:47814071-47814093 AGGGCTGAGGGGAAGGAGAATGG + Intergenic
1175333479 20:58179957-58179979 AGGGCTAGGGGGAAGCAGGACGG + Intergenic
1175817137 20:61889119-61889141 GGGGCTCACTAGAGGGAGGAGGG - Intronic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1177797237 21:25791862-25791884 AGGGCTTAGTTGAGGGTGGAGGG - Intergenic
1178072447 21:28983674-28983696 ATGGCTAATTGAAAGGAGGAAGG + Intronic
1178120652 21:29466851-29466873 AGGGTTAAGAAGAAAGAGAAAGG - Intronic
1178333635 21:31723889-31723911 AGGGCTCAGTGAAAGGTGGATGG - Intronic
1178752504 21:35318054-35318076 AGGGCTAAGCAGAAGAAGCATGG + Intronic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1180392612 22:12298350-12298372 AGGCCTAAGTACAATGAAGAGGG - Intergenic
1180407136 22:12566418-12566440 AGGCCTAAGTACAACGAAGAGGG + Intergenic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181875245 22:25935550-25935572 AGGGCTAAGTAGGAAGTAGAGGG + Intronic
1182033230 22:27176511-27176533 AGCGTGAAGTAGAATGAGGACGG - Intergenic
1182150274 22:28022645-28022667 AGGGCTCAGTTGAGGGAGGAAGG - Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1182971813 22:34586351-34586373 AGGGCTGAGAAGAAGTAGAATGG + Intergenic
1183064799 22:35355380-35355402 AGTGCTAAGGGGAGGGAGGAGGG + Intergenic
1184024964 22:41848687-41848709 AGGGCTTAGAGGAAGGAGTAAGG + Intronic
1184401728 22:44278508-44278530 AGTGCTGAGGAGAAGGAGGTAGG + Intronic
1184408909 22:44315487-44315509 TGGGCTCAGTAGGAGGAGGCTGG - Intergenic
950163073 3:10774456-10774478 AGGGCTGGGGAGAAGGAGGCAGG + Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
951550002 3:23867734-23867756 AGAGCAAAGGAGAAGGAAGAGGG + Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953338602 3:42115308-42115330 AGGGCAAAGGAAAGGGAGGAAGG - Intronic
954644830 3:52124842-52124864 AGCGCTTAGTGGAAGGAGGCTGG - Intronic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955195250 3:56800149-56800171 AGGACTAAGTAATAGTAGGAAGG + Intronic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
956864686 3:73357245-73357267 AGGTATAAGTAGAAGTAGGGTGG - Intergenic
956973926 3:74558248-74558270 AGGATTAAGAAGAGGGAGGAAGG - Intergenic
957154629 3:76532128-76532150 AGGTCTAATTGGGAGGAGGAAGG - Intronic
957640781 3:82850403-82850425 AGGGATAAGAAGAAAGAAGAAGG - Intergenic
957990190 3:87617001-87617023 AGGGCTTAATAGAAGAAGAAAGG + Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959365915 3:105457390-105457412 TGGGCCTATTAGAAGGAGGAGGG + Intronic
960846590 3:122009613-122009635 AGGGCCAAGGAGAAAGAGGTTGG + Intronic
962202708 3:133414406-133414428 AGGGGTAAGTAGAGGGGAGAGGG - Intronic
962202743 3:133414526-133414548 AGGGGTGAGTAGAAGGGAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203369 3:133417066-133417088 AGGGCTGAGTAGAAGGGAGAGGG - Intronic
962203383 3:133417114-133417136 AGGGGTAAGTAGAGGGGAGAAGG - Intronic
962203630 3:133418107-133418129 AGGGGTGAGTAGAAGGTAGAGGG - Intronic
963506938 3:146198164-146198186 AGGGCTAGGGACAAAGAGGAGGG + Intronic
965440721 3:168710402-168710424 TAGGCTAAGAAGAAGAAGGAGGG - Intergenic
966409211 3:179631362-179631384 AGAGCTAATTAGAAGCAGAATGG - Intergenic
966854790 3:184186478-184186500 AGGGCGTGGTAGAACGAGGAAGG - Intronic
967950174 3:194834559-194834581 AGGGCTTGGTAAAAGGAGCATGG + Intergenic
968276408 3:197443780-197443802 AGTGCTGGGTGGAAGGAGGAGGG + Intergenic
968612309 4:1562865-1562887 AGGGCCGAGCAGAAGGAGGGTGG + Intergenic
968624736 4:1622036-1622058 AGGGCAGAGGGGAAGGAGGAAGG - Intronic
969107882 4:4821609-4821631 AGGGCTCAGAAGAAGAAGGAAGG + Intergenic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
970765824 4:19547757-19547779 AGGCATAAGTAGAAAGAAGATGG + Intergenic
971089018 4:23317831-23317853 GGAGCTAAGAAGAAGGATGAGGG + Intergenic
971121144 4:23706304-23706326 AGGGGCAAGTAGTAGGAGTAAGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
972027283 4:34398777-34398799 ATGGTAGAGTAGAAGGAGGAAGG + Intergenic
973229315 4:47823857-47823879 GGGTCTGAGTAGGAGGAGGAAGG - Intronic
974199301 4:58618487-58618509 AGTGGTAAGTAGAAGAGGGATGG + Intergenic
974279255 4:59770232-59770254 AGGACAAAATAAAAGGAGGAGGG + Intergenic
974980405 4:68949346-68949368 AGGCCTAAGAAGAAGTGGGATGG + Intronic
975986443 4:80204968-80204990 AGGGAAGAGTAGAAAGAGGAGGG - Intergenic
977262955 4:94819976-94819998 AGGGCTAAGAAGAAAAAGCAGGG - Intronic
978341077 4:107721451-107721473 AGGGCTAGTTCGTAGGAGGATGG + Intergenic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
979552766 4:122009700-122009722 AGGACTAAGAGGCAGGAGGAGGG + Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
981616885 4:146651806-146651828 AGGGGAAAATGGAAGGAGGAAGG - Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
983987629 4:174079403-174079425 AGGACTGTGTAGAAAGAGGAAGG - Intergenic
984290399 4:177787206-177787228 AGTTCTAAGTGGAAGGAGTAGGG + Intronic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984747130 4:183232432-183232454 AGGGCTCAGAGGATGGAGGAGGG - Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985487267 5:158593-158615 AGGACGGAGTAGAACGAGGAGGG - Intronic
986465639 5:8019999-8020021 AGTGCTGAGCAAAAGGAGGAAGG - Intergenic
987112563 5:14701284-14701306 AGGGCTCAGTAGAAAGAAGCTGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
988776623 5:34482847-34482869 AGGGTTAAGGAGAAAGGGGAAGG + Intergenic
989187754 5:38641513-38641535 AGTGCTACTTAGAAGTAGGATGG - Intergenic
989983737 5:50672037-50672059 AAGGCTCAGGAGAAAGAGGAAGG - Intronic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
991125016 5:63060411-63060433 AGGGCTAAGTAGAAAGAAGGGGG - Intergenic
992384828 5:76274642-76274664 AAGGCCAAGTAGTAGGTGGAGGG - Intronic
994253321 5:97563081-97563103 AGGGATATGGAGAAGGAAGAAGG + Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995082267 5:108066070-108066092 AAAGCTAAGAAGAAGAAGGAGGG + Intronic
995785182 5:115820122-115820144 GGGGATAACTAGAGGGAGGATGG - Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
996929426 5:128868554-128868576 ATGGCTAAGGTGAAGGATGAAGG + Intronic
997411849 5:133696719-133696741 AGGGCTGTGGGGAAGGAGGAGGG + Intergenic
998288869 5:140892897-140892919 AGGGTGAAGGAAAAGGAGGATGG - Intronic
998451149 5:142235597-142235619 TGGGCAAAGGAGCAGGAGGAGGG - Intergenic
999968364 5:156833877-156833899 AGGGCTAGGAGAAAGGAGGAAGG + Intergenic
1000051123 5:157563678-157563700 ATGGCTAAGTAGATGGGGAATGG + Intronic
1001120185 5:168973735-168973757 AGGGCTAGGTAGGAGGAAGAGGG - Intronic
1001568408 5:172714991-172715013 AGGCCTCGGGAGAAGGAGGAGGG - Intergenic
1001609130 5:172985738-172985760 AGGGCTAAGTGGAAACAGGATGG - Intronic
1001658211 5:173370416-173370438 AGTGCAAAGTAGAAGGAGTGTGG - Intergenic
1004125079 6:12865220-12865242 AGGACTAGGCAGAGGGAGGAAGG + Intronic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1006099317 6:31676371-31676393 AGGCCCAGGTAGAAGGAGGTGGG - Intergenic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1007103476 6:39267583-39267605 AGGGCTCATGGGAAGGAGGAGGG - Intergenic
1007595011 6:43045915-43045937 AGGGCCAGATAGAAGCAGGAGGG + Intronic
1008075438 6:47140549-47140571 AAGGCCATGTAGAAGGAAGAAGG + Intergenic
1008228837 6:48958442-48958464 GGGGCTGAGTAGAAGGTGAAGGG - Intergenic
1009481932 6:64169878-64169900 GGGGCTAAGTGTAAGGAAGAAGG + Intronic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1010187128 6:73157326-73157348 AGGGCTGAGGAAGAGGAGGAAGG + Intronic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1011755220 6:90491917-90491939 AAGTCTAAGTTTAAGGAGGAAGG - Intergenic
1013282082 6:108647996-108648018 AGAGCTAAGTGGAAAGAGGAGGG + Intronic
1015121368 6:129704897-129704919 AGGGGTCAGGATAAGGAGGAGGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015615402 6:135069386-135069408 AGGGCTGAGAAGAAGAAAGAGGG - Intronic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1017035371 6:150262428-150262450 AGGGTTATGAAGAAGGAGGGTGG - Intergenic
1017058144 6:150456234-150456256 AGGACTGAGGAGAAGGAAGAGGG - Intergenic
1017949085 6:159120379-159120401 GGAGCAAAGGAGAAGGAGGAAGG - Intergenic
1018779161 6:167046377-167046399 AGGGAAAAATGGAAGGAGGAAGG + Exonic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1021252541 7:18348710-18348732 AGGGCTAAAGAGAAGGCAGAAGG - Intronic
1021415827 7:20383384-20383406 ATGACTAAGTAGAAGTAGGTGGG - Intronic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022634359 7:32118117-32118139 AGGGCTAAGGAGAGAGTGGAGGG + Intronic
1023013649 7:35944515-35944537 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024077481 7:45829319-45829341 AGGACAAAGAGGAAGGAGGAGGG + Intergenic
1024967868 7:55040362-55040384 AGGGATAATTAATAGGAGGAAGG + Intronic
1025126929 7:56352088-56352110 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025214980 7:57048782-57048804 AGGGCTAATTAGAAGGCTCAGGG - Intergenic
1025656972 7:63528035-63528057 AGGGCTAATTAGAAGGCTCAGGG + Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026217657 7:68363999-68364021 AGGGCGAAGGAGGAGGAGGGAGG - Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027164415 7:75824238-75824260 AGGCCTAAGGAGAAGGAAGCAGG + Intergenic
1027167258 7:75843832-75843854 AGGGCTAAGAAAAATGAGGCTGG - Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027795799 7:82691639-82691661 ATGCCTAAGTAGACAGAGGAAGG - Intergenic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029548070 7:101221830-101221852 AGGTCCAAGGAGGAGGAGGAAGG + Intronic
1030035518 7:105405310-105405332 AGGGCAGGGGAGAAGGAGGAGGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031381808 7:121095205-121095227 TGGGCTATGGAGAAGGGGGATGG + Intronic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032620783 7:133529194-133529216 AAGGCAAAGAAGAAGGAGAAAGG - Intronic
1032640369 7:133759754-133759776 AGGGAAAAGAAGAAGGAGAAAGG + Intronic
1032871215 7:135988114-135988136 AGGGCTAAGCAGAAAGTAGAGGG - Intergenic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1033481336 7:141743986-141744008 AGGGGTAAGTTGAAGAGGGAAGG + Exonic
1033534396 7:142298687-142298709 AGCCATAAGTAGAAAGAGGAAGG + Intergenic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035108901 7:156464172-156464194 AGGGCTGAGTGGCAGGTGGACGG - Intergenic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1036767263 8:11556884-11556906 CGGGCTTAGCAGGAGGAGGAGGG + Intronic
1036806911 8:11841371-11841393 ATGGCTCAGTAGATGGAAGAAGG - Intergenic
1037514114 8:19612511-19612533 AGGCCCAAGAAAAAGGAGGAGGG + Intronic
1038034082 8:23672303-23672325 GGAGCAAAGGAGAAGGAGGAGGG - Intergenic
1038407030 8:27329693-27329715 AGGGTTAAGGAGAAAGAGCAGGG + Intronic
1039099373 8:33924487-33924509 AGGGCAAAGGAGAGGGAAGAAGG - Intergenic
1039380008 8:37076254-37076276 AGGGTTAAGGAGGAGGAAGATGG + Intergenic
1039816616 8:41100317-41100339 AGTGATAATTAGAAGGAAGAAGG - Intergenic
1040546445 8:48401633-48401655 AGGGGTAGGAGGAAGGAGGAGGG + Intergenic
1041406243 8:57502313-57502335 AAGGCTTAGAAGAAAGAGGAAGG - Intergenic
1041517821 8:58721195-58721217 ATGGCTTAGTGGAAGGAGCAAGG + Intergenic
1042629055 8:70796214-70796236 AGAGCCTAGTAGAAGGTGGAGGG - Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043820128 8:84853177-84853199 AGGGCTAGGAAGAATGAGGCTGG - Intronic
1043864305 8:85358152-85358174 TGGGCTACTTACAAGGAGGAAGG + Intronic
1044966347 8:97577437-97577459 AGGACAGAGCAGAAGGAGGATGG + Intergenic
1045418912 8:101994593-101994615 AGGGCTGAGGAGAAGCAGCAGGG + Intronic
1045736588 8:105303039-105303061 AGGGCTTATCAGAAGGTGGAGGG + Intronic
1045879223 8:107018257-107018279 TGAGCTAAGTAGTAGGGGGAAGG + Intergenic
1046351530 8:113020809-113020831 GGGGAACAGTAGAAGGAGGATGG + Intronic
1047403212 8:124563048-124563070 AGTGGTAAGAGGAAGGAGGAAGG + Intronic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG + Intronic
1050092721 9:2031711-2031733 GGGGCCAAGGAGAAGCAGGATGG - Intronic
1050793267 9:9502269-9502291 AGGGCTCAGCAGAGGGAGAAAGG - Intronic
1050861328 9:10435498-10435520 AGAGCAAAGTAGCAGGAGTAAGG - Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051564322 9:18479819-18479841 AGGGAAAAGTACAAGTAGGAAGG + Intronic
1052340609 9:27360913-27360935 AGAGCCAAGGAGAAGGTGGAGGG + Intronic
1054730809 9:68701249-68701271 AGGGCAATGTGGCAGGAGGATGG + Intergenic
1054747362 9:68868245-68868267 AGGATAAAGAAGAAGGAGGATGG + Intronic
1055407533 9:75990170-75990192 AGGGCTCAGGAAAAGGAAGAAGG - Intronic
1055529826 9:77172888-77172910 AAGGTTAAGTATAAGTAGGATGG - Intergenic
1056632202 9:88303173-88303195 AGTGCGGAGTAGAAGGTGGAAGG - Intergenic
1056691327 9:88811004-88811026 AAGGCCACGTATAAGGAGGAGGG - Intergenic
1058212249 9:102183762-102183784 AGGAATAAATAGAAAGAGGAGGG - Intergenic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1059013088 9:110484127-110484149 ATGGCTAAATAGAAGGACCATGG + Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059418539 9:114176762-114176784 AGCCCTGAGCAGAAGGAGGAGGG - Intronic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060287352 9:122265408-122265430 AGGGTTAAGTAAATGGAGAAGGG - Intronic
1060944146 9:127560071-127560093 AGGGCAGAGTAGAAAGAGGCCGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062159514 9:135072410-135072432 GGGGCTAAGGGGAAGGAGGTTGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1187452669 X:19412581-19412603 AGGGCTGAAGAGAAAGAGGAAGG + Intronic
1188172437 X:26943910-26943932 AGTGGAAAGTAGGAGGAGGAGGG + Intergenic
1190055540 X:47179239-47179261 AGGGCTTGGTATAGGGAGGAGGG + Intronic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1190618238 X:52260676-52260698 AGTGCTAAGTGGAAGGGTGAGGG + Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1193095526 X:77544374-77544396 AGAGCTAATCAGAAGGGGGAAGG - Intronic
1194256221 X:91638236-91638258 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1195128568 X:101832462-101832484 AGGGCCAAGAAGATGGAGGCGGG - Intronic
1196224175 X:113146104-113146126 GGGGCTAAGAAGATGGAAGAAGG - Intergenic
1197190568 X:123642851-123642873 AGAACTGAGTAGATGGAGGATGG + Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199192748 X:144990423-144990445 GGGGCTAAGTATACAGAGGAGGG + Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1200206095 X:154317462-154317484 AGGGCCAAGTGGTAGGAGCATGG + Intronic
1200574950 Y:4877520-4877542 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1201225537 Y:11815109-11815131 AGGGGTTTGTAGAATGAGGAAGG - Intergenic
1202017426 Y:20425256-20425278 AGGGCTGAGAGGAAAGAGGAGGG + Intergenic