ID: 950176353

View in Genome Browser
Species Human (GRCh38)
Location 3:10877575-10877597
Sequence CTGAGAGTCTGGAAGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 334}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950176353_950176360 28 Left 950176353 3:10877575-10877597 CCCTCTGACTTCCAGACTCTCAG 0: 1
1: 0
2: 2
3: 40
4: 334
Right 950176360 3:10877626-10877648 CATTGCTATACAAATGGTCTAGG 0: 1
1: 0
2: 0
3: 10
4: 111
950176353_950176359 22 Left 950176353 3:10877575-10877597 CCCTCTGACTTCCAGACTCTCAG 0: 1
1: 0
2: 2
3: 40
4: 334
Right 950176359 3:10877620-10877642 AAATCACATTGCTATACAAATGG 0: 1
1: 0
2: 1
3: 22
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950176353 Original CRISPR CTGAGAGTCTGGAAGTCAGA GGG (reversed) Intronic
900036104 1:410455-410477 CTGAGACTCTTGCAGTCACACGG + Intergenic
900057728 1:646207-646229 CTGAGACTCTTGCAGTCACACGG + Intergenic
900633332 1:3650087-3650109 CTCCGAGGCCGGAAGTCAGAAGG + Intronic
901899377 1:12345514-12345536 GTGACATTCAGGAAGTCAGATGG + Intronic
902768745 1:18633477-18633499 CTGCGAGGCTGGTAGGCAGATGG - Intronic
903661450 1:24981300-24981322 CTGAGGGTCTGGAAGGCATCAGG + Intergenic
903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG + Intergenic
905649516 1:39647008-39647030 CTGAGCTCCTTGAAGTCAGATGG + Intergenic
906724888 1:48037014-48037036 CTCAGAGACTGGCAGTCAGAGGG - Intergenic
907035766 1:51214887-51214909 CTTAGAGTCTGGAGGGCAGTTGG - Intergenic
907067065 1:51494656-51494678 CTCACAATCTGGAAGCCAGAAGG + Intronic
907856053 1:58304732-58304754 CAGAGATTCTGTAAGTCAGCTGG - Intronic
907922749 1:58928789-58928811 TTCAGAGTCTGGAATTCAGGAGG - Intergenic
908889711 1:68830938-68830960 CAGAGAATTTGGAAGCCAGAAGG + Intergenic
909744256 1:79073717-79073739 CTGTGAGTCTTGAAGTCCAAAGG + Intergenic
911232109 1:95372440-95372462 CTGAGAGTTTTGACGTCAAAGGG + Intergenic
911858536 1:102914603-102914625 CTGAGACTCTGGAACATAGATGG - Intronic
912228069 1:107758610-107758632 AGGAGAGACTGCAAGTCAGAAGG - Intronic
913243705 1:116852743-116852765 CTGGGAGTATGGAAGTGAGATGG + Intergenic
914522075 1:148426526-148426548 CTGATATTCTAGTAGTCAGATGG - Intergenic
916150928 1:161789294-161789316 CTGAGAAGCTGGTAGTGAGATGG - Intronic
916533778 1:165683398-165683420 CTGAGGCTCTGAAAGTCACAGGG + Intronic
917970364 1:180202081-180202103 AAGAGAGTCTGGAAATCACAAGG + Exonic
920098480 1:203501688-203501710 CTGAGAGGGTGGAAGTCACTGGG - Intronic
922579115 1:226684019-226684041 CTGACACTCAGAAAGTCAGATGG - Intronic
924106892 1:240658196-240658218 CTGTGAGTCAGGAATTCAGGAGG + Intergenic
924339839 1:243018800-243018822 CTGAGACTCTTGCAGTCACATGG + Intergenic
1063144952 10:3288554-3288576 CTGAGAGTCTGTGAGCCAGGAGG + Intergenic
1064673630 10:17740201-17740223 CTGGGAGTCTGGAAGTTTGGTGG + Intergenic
1064780757 10:18835762-18835784 CACAGTGTCTGGAAGTCTGATGG - Intergenic
1064959122 10:20944038-20944060 CTGTGTGTCTGAAAGTTAGATGG - Intronic
1065341448 10:24710603-24710625 CTCAGTGTCTGGCACTCAGAAGG + Intronic
1067789697 10:49278397-49278419 CAGAGTGCCTGGAAGGCAGATGG - Intergenic
1068593179 10:58871792-58871814 ATGAGAGTCTGGAATACAAAAGG + Intergenic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1070425932 10:76287213-76287235 CTGAGAGTGGGGCAGGCAGATGG - Intronic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1073177895 10:101567698-101567720 CTGGGAGGCTGGAAGCCAGGAGG + Intergenic
1074444867 10:113513391-113513413 CAGAAAGTCTGAAAGGCAGAAGG - Intergenic
1075564736 10:123495057-123495079 CAGAGATTCTGGAAGTAGGAGGG - Intergenic
1076425578 10:130365120-130365142 TTAATAGTCTGGATGTCAGAAGG + Intergenic
1076532661 10:131155101-131155123 GGGAGAGACTGGAAGTGAGACGG + Intronic
1076684183 10:132189648-132189670 CAGAGAGGCTGGGAGTCAGGAGG - Intronic
1078118910 11:8486111-8486133 TTGAGAGTATGGAGATCAGATGG - Intronic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078953829 11:16167143-16167165 GTGAGGGTCTGGAAGTTGGAGGG - Intronic
1079717245 11:23763894-23763916 CTGGAAGTCTGGAAGTCCAAAGG + Intergenic
1080217151 11:29857099-29857121 CAGAGATTTTGGAAGCCAGAAGG + Intergenic
1080231713 11:30023515-30023537 CTGAGAGTATGGGTGTCATAAGG + Intergenic
1081482669 11:43504161-43504183 CTGAGAATCAGGAATGCAGAGGG + Intergenic
1081744870 11:45465811-45465833 CTGAGAGTCTGGTGGTAAGTTGG - Intergenic
1083177592 11:60961041-60961063 CTGAGAGACTTGAGGGCAGAAGG + Intergenic
1083712116 11:64555892-64555914 CTGAGGGGCAGGAAGGCAGAAGG + Exonic
1084846372 11:71903664-71903686 CTGAGAGTCTAAAAGACTGAGGG - Intronic
1087715436 11:101603172-101603194 TTCACAGTCTGGAAGTCTGAAGG + Intronic
1088133987 11:106531361-106531383 CTCAGAGTCTGGTACTCAAATGG + Intergenic
1089468207 11:118699638-118699660 GTGACAGTCTGTAAGACAGAAGG - Intergenic
1089623120 11:119734162-119734184 CTGAGCATCTTGTAGTCAGAAGG + Intergenic
1090156398 11:124442776-124442798 CTGAGAGGCTAGAACACAGAAGG - Intergenic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1090481919 11:127076566-127076588 ATAAGAGTCTGGAACTCAGAAGG + Intergenic
1090645895 11:128766481-128766503 CTGAGATATTAGAAGTCAGACGG - Intronic
1091322224 11:134659837-134659859 CTTAGAGGCTGGAGGACAGATGG + Intergenic
1091440608 12:509682-509704 CTGACAGTCTGGAATCCAGGAGG - Intronic
1091928792 12:4377792-4377814 CTGAAAGTCTGGTAGTGAGCTGG + Intronic
1093276920 12:17140377-17140399 CTGAGAGACAGGAAAGCAGAAGG + Intergenic
1093348215 12:18066864-18066886 CTGAGAATGTGGAGGTCAAAAGG - Intergenic
1093623596 12:21321116-21321138 CTGAGAGTCACGAAGTAAGATGG - Intronic
1094382552 12:29858727-29858749 CTGCAAGCCTGGAAGTGAGAGGG - Intergenic
1094408550 12:30145728-30145750 CTTAGAGTCTGCATGTCAAATGG + Intergenic
1096611115 12:52802367-52802389 CTGAGACTCTGGAAGCCTAAGGG - Intergenic
1098693670 12:73523661-73523683 CAGAAATTATGGAAGTCAGAAGG + Intergenic
1098896733 12:76071274-76071296 CTGGGAGGGTGGAAGTCAGAGGG - Intronic
1099896631 12:88655996-88656018 CAGAGAGCCTGGAAGTCATTGGG - Intergenic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102959858 12:117085407-117085429 GTGAGGGTCGGGAAGGCAGAAGG + Intronic
1103031065 12:117613373-117613395 CTGAAAGTCTGGGACTCAGCTGG - Intronic
1104664232 12:130635975-130635997 CTCGGAGGCTGGAAGGCAGAGGG - Intronic
1104807080 12:131596487-131596509 CAGAGAGCCTGGAATTCAGGAGG + Intergenic
1105306408 13:19172111-19172133 GTGAGACTCTGGCGGTCAGAAGG + Intergenic
1106828343 13:33549728-33549750 TTCAGAGTCTGGCAGTAAGATGG - Intergenic
1107293473 13:38884067-38884089 CTGAGAGGGTGGAATTCAGAAGG - Exonic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1110027673 13:70562221-70562243 GTGAGAGACAGGAAGTCAAAGGG + Intergenic
1110871821 13:80461397-80461419 CTGAGAGACAGGAAGGCAGAAGG - Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1112552440 13:100434284-100434306 GTGAGAGACAGGAAGGCAGAAGG + Intronic
1112897477 13:104318223-104318245 CAGAGAGTCTGCAATTCAGAGGG - Intergenic
1112950468 13:104989478-104989500 CTGAAAATTTGGAAGTCATATGG + Intergenic
1113075320 13:106462311-106462333 CTGAGACTCTGGAAGTCTCCGGG - Intergenic
1117159641 14:52976060-52976082 CTGAGACCCTGGAAGCCAAATGG - Intergenic
1117166706 14:53041769-53041791 ATGAGAGTCTGGAAGAAAGAAGG + Intronic
1117748227 14:58893062-58893084 ATGAGAGTCTTCAAGGCAGAAGG + Intergenic
1117802692 14:59461579-59461601 CTGAGAGATTGGAAGTGACAAGG - Exonic
1121718941 14:96095922-96095944 CTGAGTCACTGGAAGCCAGATGG - Intergenic
1202829891 14_GL000009v2_random:16512-16534 CTGAAAGTTTGAATGTCAGAAGG + Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125537410 15:40449953-40449975 AGGAGAGTTTGGAGGTCAGAGGG + Intronic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1127975314 15:63992791-63992813 CTGACTGTCAGGAACTCAGATGG - Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128438069 15:67675435-67675457 CTGAGAGGATGGGAGACAGAGGG + Intronic
1128543396 15:68552019-68552041 CTGAGGTTCTGGAACCCAGAAGG + Intergenic
1129161502 15:73750596-73750618 ATCAGAGTCTGGGAGACAGATGG + Intronic
1129521551 15:76189579-76189601 CTGAGAGTCTGGGAGGAAGGGGG + Intronic
1130250076 15:82294338-82294360 CTGAGAGTCAGGAGGTTGGATGG - Intergenic
1131342861 15:91619145-91619167 CTGAGAGTTTGGACGTATGAAGG + Intergenic
1131696903 15:94887283-94887305 CAGAGAGGCTGACAGTCAGATGG - Intergenic
1135846425 16:25922773-25922795 CTCAGAGACTGGAATTCAGTAGG - Intronic
1137379517 16:47984325-47984347 CTATGAGTCAGGAAGTCTGATGG + Intergenic
1140127133 16:72127050-72127072 TTCTGAGTCTGGAAGCCAGAGGG + Intronic
1140271189 16:73467833-73467855 CTGAGGAGCTGGAAGTCAGCAGG - Intergenic
1140636927 16:76925957-76925979 CTAAGACTGTGGAAGTCAAATGG + Intergenic
1140699974 16:77572663-77572685 TTGAGAGTCTTAAAGCCAGAGGG - Intergenic
1140766928 16:78168548-78168570 CTTGGAGTTTGGAAGCCAGATGG - Intronic
1141113033 16:81285913-81285935 CTGAGGGTAAGGAAGTCAGCAGG + Intronic
1144135246 17:12289132-12289154 CCGAGAGAAGGGAAGTCAGAAGG + Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146628499 17:34453174-34453196 CAAAGAGTCTGGAAGTGTGAGGG - Intergenic
1147448107 17:40487317-40487339 CTGGGAGCCTGGAAGTCACTGGG + Exonic
1147817515 17:43220867-43220889 CTGAGAGCCAGGAAGGGAGAGGG + Intergenic
1147853074 17:43457507-43457529 TTGAGAGTGTGGATGGCAGACGG + Intergenic
1148756059 17:49973521-49973543 CTCAGAGGCAGGAACTCAGAAGG + Intronic
1149894078 17:60415438-60415460 CAGTGATTCTGGAAGTTAGATGG - Intronic
1150711172 17:67531987-67532009 CAGAGAGGCAGGAAGGCAGATGG + Intronic
1150979812 17:70128403-70128425 CTGAGAGAGGGGAAGTTAGAAGG - Intronic
1151078071 17:71297052-71297074 CTGTGTCTCTGAAAGTCAGAGGG + Intergenic
1151964765 17:77425566-77425588 CTTGGAGGCTGGAAGTCAGGCGG - Intronic
1153068927 18:1082271-1082293 CTGAGACTAAAGAAGTCAGAGGG - Intergenic
1153608836 18:6861311-6861333 CTGAGAGACTGTAAGACAGGAGG - Intronic
1153962618 18:10152457-10152479 GAGAGAGGCTGGAATTCAGAGGG - Intergenic
1155491476 18:26405514-26405536 CGGAAAGTCTGGAAGTCAGCGGG + Intergenic
1156544248 18:37947691-37947713 CTCACAGTCTGGAGGCCAGAAGG - Intergenic
1157211902 18:45750003-45750025 CTGAGACCCTGGAAGTTAGCTGG - Exonic
1158603010 18:58870937-58870959 CTGTGAGTCTGGAATTTAGGAGG + Intronic
1160077506 18:75692338-75692360 CTGAGAGACAGTAATTCAGATGG + Intergenic
1160438743 18:78872330-78872352 CTCCGAGGTTGGAAGTCAGAGGG - Intergenic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162403085 19:10457717-10457739 CTCAGAGTCAGGAAACCAGAGGG - Intronic
1163486620 19:17591385-17591407 CTGGGAGTCTGGAAAACAAAAGG - Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1164621103 19:29696580-29696602 CTGGGTGTCTGGATGTCAGGTGG - Intergenic
1166325153 19:42045283-42045305 CTGAGACTCTGGAATTCACACGG - Intronic
1166395066 19:42433609-42433631 CTGAGAGTCAGGAAGAAAGTGGG + Intronic
1168413401 19:56154179-56154201 GTGAGAGTCTGGAAACCAGAGGG + Intronic
1202642795 1_KI270706v1_random:111274-111296 CTGAAAGTTTGAATGTCAGAAGG - Intergenic
925088299 2:1131428-1131450 CTGACAGGATGGAAGTCAAATGG - Intronic
926855323 2:17250235-17250257 CTGAGAGCCTGGCAGTCTAATGG + Intergenic
926984902 2:18612034-18612056 CTGAGAGTCCAAAAGTGAGAAGG + Intergenic
928020604 2:27701858-27701880 CTGAGAGAGTGGGAGCCAGAGGG + Intergenic
928200040 2:29241989-29242011 CTGAGAGTCTGGGAATTAGGAGG - Intronic
929379366 2:41332438-41332460 CTGAGAGACTAGAAGTGTGAAGG - Intergenic
929919147 2:46160301-46160323 CTGAGAATCTGGAAGGCAGAAGG - Intronic
930090618 2:47528819-47528841 CAGAGAGCATGGAAGTGAGATGG + Intronic
931279333 2:60774951-60774973 TCGAGAGTCTGGAAGTTAGGAGG + Intronic
931387333 2:61809429-61809451 TTATGAGTCTGGAATTCAGAAGG - Intergenic
932703798 2:74008314-74008336 CTGCAAGTCTGGGAGTCTGATGG + Intronic
932814115 2:74848150-74848172 CTGAGAGACTGGCAATCAAAGGG - Intronic
934690089 2:96351939-96351961 GAGAGAGTCTGGACATCAGAGGG - Exonic
934706752 2:96486523-96486545 GGGAGAGTTTGGAAGGCAGAGGG - Intergenic
935057317 2:99578885-99578907 CTGAGAGTCTGGGATTCAGCAGG + Intronic
936751460 2:115647267-115647289 CTGAAATTCTAGAATTCAGAAGG - Intronic
937626263 2:124047303-124047325 CTTACAGTCTTCAAGTCAGAAGG + Intronic
937675186 2:124582448-124582470 CTCAGAGCCTAGAAGTCAAAAGG + Intronic
938310286 2:130285012-130285034 CTGAGGGGCAGGAAGGCAGAGGG - Intergenic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
940074675 2:149727888-149727910 CTGACAATCTGGAAGCCTGAGGG + Intergenic
942072780 2:172330313-172330335 GTGAGTGGCAGGAAGTCAGATGG + Intergenic
942627071 2:177912594-177912616 CTGAGGGTCTGGAAATAAGAGGG - Intronic
942860168 2:180599686-180599708 GTTAGAATTTGGAAGTCAGAAGG - Intergenic
943209125 2:184940075-184940097 TTGAGAATCTGGAAGTGGGATGG + Intergenic
945139413 2:206667987-206668009 GTGACTGTCTGGAAGTTAGAGGG - Intronic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947820910 2:233068866-233068888 CTGGGAGCCTGGAAGCCAGCAGG + Intronic
948051491 2:234982561-234982583 CTGAGAGTCTGGGTGGCAGGTGG + Intronic
948532234 2:238616617-238616639 CTGAGGGTCTTGAAGTGAGGAGG + Intergenic
1169305800 20:4489384-4489406 CTGAGAGTCTGTATCTCAGAGGG - Intergenic
1169409962 20:5359949-5359971 CTGAGAGTCTGGAAGCCCTGGGG - Intergenic
1169762211 20:9108188-9108210 TTAAGAGTCTGGAATTCAGATGG + Intronic
1170255079 20:14333107-14333129 TTGAGAGTCATGAAGTCTGAAGG + Intronic
1170285660 20:14705550-14705572 CTGAGGGCCTGAAAATCAGAAGG + Intronic
1170360866 20:15544835-15544857 CTGAAGGGCTAGAAGTCAGAGGG - Intronic
1171037801 20:21730065-21730087 CTGTGAGTCAAGAAGTTAGAAGG + Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171204749 20:23270158-23270180 CTGACGTTCTGGGAGTCAGAAGG + Intergenic
1172012926 20:31856901-31856923 CAGAGATTCTGGAAGCCAGATGG + Intronic
1172138371 20:32703608-32703630 CTGAGAGACTTGAATGCAGAAGG + Intronic
1172502687 20:35438076-35438098 CTGAGACTCTTGAAGTCTGCCGG + Exonic
1173048002 20:39531066-39531088 CTGAGCTTCTGAAGGTCAGAGGG - Intergenic
1173825751 20:46046703-46046725 CAGGGAGGCTGGAAGTCAGCTGG + Intronic
1174366750 20:50061146-50061168 CTGTGACTCTGGAAGTCGGGAGG + Intergenic
1175254748 20:57634389-57634411 CTCAGAGTACTGAAGTCAGAGGG + Intergenic
1175795596 20:61768934-61768956 CTCAGAGTCTGAGATTCAGAGGG + Intronic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1176106890 20:63393633-63393655 CTGAGAGCCTGCAAGTCCCACGG - Intergenic
1176144452 20:63559371-63559393 CTGTGAGGGTGGGAGTCAGATGG + Intronic
1176609079 21:8861351-8861373 CTGAAAGTTTGAATGTCAGAAGG + Intergenic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1180359172 22:11871182-11871204 CTGAAAGTTTGAATGTCAGAAGG + Intergenic
1180646154 22:17340795-17340817 CTGAGAGGCTGGGAGTCAGGAGG + Intergenic
1180755583 22:18158691-18158713 CTGAGAGGCTGAAAGGCAGAAGG - Intronic
1184788570 22:46684894-46684916 CTGAGATTCTGAATGTCAGCAGG + Exonic
949344195 3:3061522-3061544 CTGAAAGTCTGGAAATTGGAAGG + Intergenic
949977685 3:9475909-9475931 CTGATAGTCCGTAAGTCTGATGG - Exonic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
950433370 3:12964568-12964590 CTGAGAATGTGGATGTCTGAAGG - Intronic
950847171 3:16026333-16026355 GTGAGAGTCTTGAAGGCAGTGGG + Intergenic
952162527 3:30708433-30708455 CTGAGAGATAGGAAGGCAGAAGG - Intergenic
953801285 3:46024921-46024943 CTCAGAGTCTAGAAGTCAGTTGG - Intronic
954449371 3:50563377-50563399 CTGAGACCCTGGGATTCAGAAGG + Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
954576977 3:51681727-51681749 CTGAGTGTCTGCATGGCAGAGGG - Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
960147400 3:114217963-114217985 CTGAGAGTGTGGAAGGCCCAGGG + Intergenic
960243566 3:115374325-115374347 GAGAGAGTCTGAAAGGCAGAAGG + Intergenic
961072609 3:123948778-123948800 CTGAGATTCTGTAAGTAAGAGGG + Exonic
961145218 3:124587366-124587388 CTGCATGACTGGAAGTCAGATGG - Intronic
961468659 3:127097532-127097554 CTGAGAACCGGGAAGACAGATGG - Intergenic
961638010 3:128345398-128345420 CTGAGAGTCTGGTAGGCTCATGG + Intronic
962420909 3:135228713-135228735 CTGAGAGTCGGGCAGTCTGAGGG + Intronic
962622041 3:137189896-137189918 CTGAGAGTCTTCAGCTCAGAGGG - Intergenic
963046224 3:141104539-141104561 CTTAGATTCTGGAAGTCTGTGGG + Intronic
965394050 3:168140573-168140595 ATGAGAATCTGAGAGTCAGAAGG - Intergenic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
968269586 3:197393177-197393199 TTGAAAGTCTGGAATTCATAAGG + Intergenic
968285571 3:197506612-197506634 CTGCGGGTATAGAAGTCAGATGG + Intergenic
968698617 4:2044303-2044325 CTGAGACTGTGGGAGACAGAGGG + Intergenic
968922171 4:3527931-3527953 CTGAGAGTTGGGGAATCAGAGGG - Intronic
968964233 4:3761454-3761476 CTGAGGCCCTGGAAGCCAGAAGG + Intergenic
969459002 4:7317743-7317765 CTGGGAGCCTGGAAGTGATATGG - Intronic
970552120 4:17192876-17192898 CTGAGACTCTGTGAGTCACAGGG - Intergenic
970870323 4:20809642-20809664 CTGTCATTCTGGAAGTCATAGGG + Intronic
971009200 4:22413258-22413280 CAAGGAGGCTGGAAGTCAGATGG - Exonic
971017249 4:22501032-22501054 CTGAGAGTCTGAGAATCAGGTGG - Intronic
971556518 4:28019279-28019301 TTGAAAGTCAGAAAGTCAGATGG + Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
973633935 4:52844560-52844582 CTTAGAGTTAGGAAGTCAAAAGG - Intergenic
974410680 4:61538356-61538378 CTGAGAGTGTGGAGGTCTTAGGG + Intronic
974619881 4:64340963-64340985 CTGAGAGCTTGGAAGACAGCAGG + Intronic
975572057 4:75827902-75827924 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
977046392 4:92072980-92073002 ATGCGAGTCTGGAACCCAGAAGG - Intergenic
977916849 4:102603493-102603515 CTGAGAGTCCCCAAATCAGAAGG - Intronic
978413680 4:108453437-108453459 ATGAGAGTCTTGTCGTCAGATGG - Intergenic
978529334 4:109698416-109698438 TTAAGAGTTTGGGAGTCAGAAGG - Intronic
979013868 4:115406487-115406509 CTGAGAATCTGGAAATACGAAGG + Intergenic
979263017 4:118669779-118669801 CTGAGACTCTTGCAGTCACATGG - Intergenic
979993326 4:127401875-127401897 CTGAGAGCCTGGGAGTCAGTGGG - Intergenic
980301525 4:131001039-131001061 ATGAGATTCTAGAGGTCAGAAGG - Intergenic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982092138 4:151889516-151889538 CTCAGTGTTTGGAAGTCAGCTGG - Intergenic
983111691 4:163758195-163758217 GAGGGAGTCTGGAAGGCAGAAGG + Intronic
983182312 4:164662841-164662863 GTGAGAGTGTGGAGGTCAAAAGG - Intergenic
984901324 4:184589257-184589279 CTGAGATTTTAAAAGTCAGATGG - Intergenic
1202770166 4_GL000008v2_random:197173-197195 CTGAAAGTTTGAATGTCAGAAGG - Intergenic
986434514 5:7715035-7715057 GAGAGATGCTGGAAGTCAGAGGG + Intronic
987612494 5:20224133-20224155 CAGAGAATCTGAAAGTCATAAGG - Intronic
989496608 5:42116400-42116422 CAGAGAGACAGAAAGTCAGAAGG + Intergenic
989619313 5:43368861-43368883 TTCAGAGTCTAGAAGTCTGAAGG - Intergenic
990079609 5:51897245-51897267 CTGAGATACTAGAAGTTAGAAGG + Intergenic
990289600 5:54334662-54334684 CTGAGAATGGGGATGTCAGATGG - Intergenic
990472361 5:56127764-56127786 CAGAGGGTCTGGTACTCAGATGG - Intronic
992346018 5:75879465-75879487 ATGAGAGTCTGAAACCCAGAAGG + Intergenic
992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG + Intergenic
992425519 5:76652929-76652951 ATGTGAGCCTTGAAGTCAGAAGG + Intronic
992483254 5:77171851-77171873 CTGACTGACTGGAAGCCAGAGGG + Intergenic
994985357 5:106926526-106926548 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
995512564 5:112923059-112923081 AGGAGTGTCTGGAAGTCATATGG - Intergenic
996315734 5:122158730-122158752 CTATGAGTCTGGAACTCAGAAGG + Intronic
996532319 5:124539327-124539349 CTCAGAGTCAGGAAATCAGTAGG - Intergenic
997210001 5:132071679-132071701 CTGAAAGGCTAGAAGTCAGGTGG - Intergenic
998078530 5:139255860-139255882 CTGAGGGTCAGGAATTCAGGAGG - Intronic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
1000045375 5:157517931-157517953 CTGACAGTCTGGGATTCAGGAGG + Intronic
1000055625 5:157603613-157603635 CTCAGAGGCTGGAAATCAAAGGG + Intergenic
1000330305 5:160200311-160200333 CTGAGAGTTCAGAGGTCAGATGG - Intronic
1000349604 5:160343001-160343023 CTGGCAGCCTGGATGTCAGAGGG + Intronic
1002427839 5:179186335-179186357 CTGAGAGGCTGGACAGCAGAAGG - Intronic
1002737717 5:181408409-181408431 CTGAGACTCTTGCAGTCACACGG - Intergenic
1006424821 6:33957411-33957433 CTGACAGCCTGGAACTCAGGTGG + Intergenic
1007120797 6:39379352-39379374 GTGTGAGTCTGGAAGTCACCTGG + Intronic
1007177309 6:39905765-39905787 CTGAAAGGCTGCAAGTCTGATGG + Exonic
1007425493 6:41743583-41743605 CCAAGATTCTGTAAGTCAGAAGG - Intronic
1007734976 6:43976293-43976315 ATGAGAGTCTGGAGGACACAAGG + Intergenic
1007749905 6:44065469-44065491 CTGGGAGCCTAGAAGACAGAGGG + Intergenic
1008116050 6:47551673-47551695 CTGTGAGTCAAGAATTCAGATGG + Intronic
1008679633 6:53858348-53858370 GGGAGAGTCTGGAAGTGGGAAGG - Intronic
1010910524 6:81549676-81549698 CTGAAACTCTGCAAGCCAGAAGG - Intronic
1011473710 6:87732716-87732738 ATGAGACTTTGGAAGCCAGAGGG - Intergenic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013825791 6:114209736-114209758 GTGAATGACTGGAAGTCAGAAGG + Intronic
1014292685 6:119577158-119577180 CTTGTAGTCTGGAAGTAAGAAGG + Intergenic
1015864385 6:137712893-137712915 AGGAGAGACTGGAAGGCAGAAGG - Intergenic
1017888407 6:158619999-158620021 CTGAGAATCTGAAAGTTAAAGGG + Intronic
1018459305 6:163982345-163982367 CTGAAAGTCTGGAAATTAGTAGG - Intergenic
1019242815 6:170683966-170683988 CTGAGACTCTTGCAGTCACACGG - Intergenic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1022130049 7:27396746-27396768 CTGAGAGTCTGCATGTCTAATGG + Intergenic
1022417366 7:30189777-30189799 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
1027050088 7:75016408-75016430 CTGAGAGCCTGGAAGTCCCAGGG - Intronic
1027164606 7:75825491-75825513 CTGAGTTTCTGGAAGGCAAAAGG + Intergenic
1027207540 7:76113561-76113583 CTCAGAATCTGTAAGTCATAAGG - Intergenic
1029382947 7:100225260-100225282 CTGAGAGCCTGGAAGTCCCAGGG + Intronic
1030149472 7:106388589-106388611 TTGAAAGTCTGAAAGTCAGTTGG - Intergenic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1031905606 7:127457208-127457230 CTGAAAATCTGGGAGTAAGATGG + Intergenic
1032156234 7:129470705-129470727 CTGAAAGTCTGGTAAGCAGATGG + Exonic
1032905246 7:136357295-136357317 TTGAGAATCTTGAAGTAAGATGG + Intergenic
1034211923 7:149371399-149371421 CTCAAAGTCTGCAAGTCTGATGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034688891 7:152998271-152998293 AGGAGGGGCTGGAAGTCAGATGG + Intergenic
1035505305 8:124189-124211 CTGAGACTCTTGCAGTCACACGG + Intergenic
1036424057 8:8626961-8626983 TTGAGAATATTGAAGTCAGAAGG - Intergenic
1036782531 8:11659396-11659418 CGAAGAGGCTGGGAGTCAGAGGG - Intergenic
1037077488 8:14738801-14738823 CTGTGAGTCTGAAAATGAGAGGG + Intronic
1037231470 8:16663962-16663984 CTGGAAGTCTGTAAGGCAGATGG + Intergenic
1037399901 8:18485333-18485355 AGGAGAGACTGGAAGTCAGTTGG - Intergenic
1037726515 8:21486913-21486935 CTGAGAATCTGGAAGACTGCAGG - Intergenic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1042730644 8:71930246-71930268 CTCAGATTCTTGAAGTCAGATGG + Intronic
1042756509 8:72219657-72219679 CAGAAAGTTTGAAAGTCAGATGG - Intergenic
1043095864 8:75971047-75971069 CTGACAGTCTGTAAATCAGCAGG + Intergenic
1043378911 8:79681974-79681996 CTGAAAGAGTGAAAGTCAGAAGG - Intergenic
1043395220 8:79828876-79828898 TTGAGTGTCTGGGAGTCTGAGGG - Intergenic
1044804499 8:95991383-95991405 CTGAGAGTCTGTCATTCAGTAGG + Intergenic
1045648008 8:104317985-104318007 CTGAGAGGCTAGAAGCAAGATGG + Intergenic
1045729758 8:105223731-105223753 CAGAGAGTATGCAAGTGAGAGGG + Intronic
1046972751 8:120240475-120240497 CTGAGGGTCTTGAAATCACATGG + Intronic
1047432621 8:124805838-124805860 GTGAGAAGCTGGAATTCAGAAGG - Intergenic
1048682728 8:136863695-136863717 ATGACACTCTGGAATTCAGAAGG - Intergenic
1050384369 9:5070794-5070816 CTGATAATCTGGCAGTCAGGTGG + Intronic
1051580621 9:18669913-18669935 CTGAGAGGCTGGGAGTTGGAAGG - Intronic
1052528730 9:29655295-29655317 CTGAGAATGTGGAGGTCAAAAGG + Intergenic
1052694073 9:31854047-31854069 ATGAGAGCCTGGAAAACAGAAGG - Intergenic
1055407450 9:75989526-75989548 CTGAGGGTCAGGAATTCAGACGG + Intronic
1055643811 9:78343933-78343955 CTGTGAGACTGTATGTCAGAGGG + Intergenic
1055852698 9:80651347-80651369 CTAAGACTCTGGGAATCAGAAGG + Intergenic
1056487028 9:87069410-87069432 CACAGTGTCTGGAAGACAGAAGG + Intergenic
1056804623 9:89718900-89718922 CTGAGAGCCAGGAAGCCAGTGGG - Intergenic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057485846 9:95483524-95483546 CTGAGAGACAGGAAGGCACAGGG - Intronic
1058951838 9:109911114-109911136 GTCAGAGGCTGGAGGTCAGAAGG + Intronic
1060484359 9:124037719-124037741 CAGAGAGGCTGGGAGCCAGAGGG - Intergenic
1061014603 9:127974487-127974509 CTGGGAGCCTTGAAGGCAGAGGG - Intronic
1061085147 9:128393882-128393904 GGAACAGTCTGGAAGTCAGAGGG + Intergenic
1203704479 Un_KI270742v1:26583-26605 CTGAAAGTTTGAATGTCAGAAGG + Intergenic
1203559522 Un_KI270744v1:39233-39255 CTGAAAGTTTGAATGTCAGAAGG - Intergenic
1203603006 Un_KI270748v1:33190-33212 CTGAGACTCTTGCAGTCACACGG - Intergenic
1185789736 X:2919693-2919715 CTGGGAGTCTGGAATTCGGGTGG + Intronic
1186506374 X:10096272-10096294 CTGAGAGTCTGCTAGCAAGATGG + Intronic
1187340736 X:18419408-18419430 CTGAGTGTCAGGAATTCAGGAGG + Intergenic
1187468615 X:19548274-19548296 CTGTAATTCTGGAAGTCACAAGG + Intronic
1187878987 X:23828851-23828873 CTGTGACTCTGGAAGACAGAAGG - Intergenic
1189221764 X:39378116-39378138 CTGACAGTCTGGGAGGCAGTGGG + Intergenic
1190734808 X:53249233-53249255 CTGAGGGTCTGTGACTCAGAGGG - Intronic
1192304783 X:69947650-69947672 CTGAGATTCTGGAAGTCAGTTGG - Intronic
1192358658 X:70425107-70425129 GGGGGAGGCTGGAAGTCAGAAGG + Intronic
1194046018 X:89004243-89004265 CTGAGAGACAGAAAGGCAGAAGG + Intergenic
1194576951 X:95625018-95625040 CTGAGAAACAGAAAGTCAGAAGG - Intergenic
1194694325 X:97026660-97026682 CTGATAGTCTGGATGTAACAAGG - Intronic
1194734961 X:97501277-97501299 CTGAAAGTCTGGAAGGAAAAAGG + Intronic
1195120231 X:101742297-101742319 CTGAGAATCTAGATGTCATATGG + Intergenic
1196303124 X:114069279-114069301 ATGAGAGTCTCCAAGTCAGAAGG + Intergenic
1196441198 X:115721541-115721563 CTGAGAGTGTGAACGTCAGTTGG + Intergenic
1196444726 X:115839529-115839551 CTGAGAGTGTGAACGTCAGTTGG + Intergenic
1197967339 X:132079194-132079216 CTCAGAGTCTGGAAGTAGGATGG - Intronic
1198219397 X:134585892-134585914 CTGTGACTCAGGAAGTCAGCAGG - Intronic
1198508663 X:137327187-137327209 CTTGGAGTTTTGAAGTCAGATGG - Intergenic
1198756164 X:139984853-139984875 CAGAAAGTCTGGAAAGCAGAAGG - Intergenic
1199538357 X:148929696-148929718 CTAAGAGTCTGGAACCCAGTAGG + Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1202303264 Y:23440695-23440717 CTGACAGTCTGGAAGGCAAAGGG - Intergenic
1202385079 Y:24318248-24318270 CTGAGACTCTTGCAGTCACACGG - Intergenic
1202485706 Y:25351880-25351902 CTGAGACTCTTGCAGTCACACGG + Intergenic
1202567547 Y:26229899-26229921 CTGACAGTCTGGAAGGCAAAGGG + Intergenic