ID: 950178067

View in Genome Browser
Species Human (GRCh38)
Location 3:10889918-10889940
Sequence CACTTCAGAGCTTCCTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950178064_950178067 8 Left 950178064 3:10889887-10889909 CCATGCCAGGGGGGAGAGAGAGA 0: 1
1: 0
2: 0
3: 46
4: 487
Right 950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 173
950178062_950178067 16 Left 950178062 3:10889879-10889901 CCTCGCTCCCATGCCAGGGGGGA 0: 1
1: 0
2: 1
3: 9
4: 159
Right 950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 173
950178055_950178067 21 Left 950178055 3:10889874-10889896 CCTGCCCTCGCTCCCATGCCAGG 0: 1
1: 0
2: 0
3: 30
4: 380
Right 950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 173
950178060_950178067 17 Left 950178060 3:10889878-10889900 CCCTCGCTCCCATGCCAGGGGGG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 173
950178063_950178067 9 Left 950178063 3:10889886-10889908 CCCATGCCAGGGGGGAGAGAGAG 0: 1
1: 0
2: 1
3: 27
4: 310
Right 950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 173
950178052_950178067 28 Left 950178052 3:10889867-10889889 CCACCCACCTGCCCTCGCTCCCA 0: 1
1: 0
2: 11
3: 112
4: 1759
Right 950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 173
950178053_950178067 25 Left 950178053 3:10889870-10889892 CCCACCTGCCCTCGCTCCCATGC 0: 1
1: 0
2: 0
3: 26
4: 402
Right 950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 173
950178065_950178067 3 Left 950178065 3:10889892-10889914 CCAGGGGGGAGAGAGAGAGAGAG 0: 2
1: 16
2: 120
3: 677
4: 2111
Right 950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 173
950178054_950178067 24 Left 950178054 3:10889871-10889893 CCACCTGCCCTCGCTCCCATGCC 0: 1
1: 0
2: 1
3: 78
4: 723
Right 950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950178067 Original CRISPR CACTTCAGAGCTTCCTGCAA AGG Intronic
902686507 1:18080867-18080889 CACTACAGAGCTACCTGCCCTGG - Intergenic
904309942 1:29622489-29622511 CACCCCAGGGCTTCCTGGAATGG - Intergenic
910739807 1:90502725-90502747 ACATTCAGAGCTTCCTGCAATGG + Intergenic
911359786 1:96862520-96862542 GACTTGAGAGCTGCCTGCAGGGG - Intergenic
911824668 1:102466764-102466786 CATTTCAGAGCCTACTGCTAGGG + Intergenic
912702335 1:111887768-111887790 CACTTCAAAGCATCCAGGAATGG + Intronic
913063326 1:115227397-115227419 CATATCAGAGCTCCCTGCAGAGG + Intergenic
914316438 1:146516877-146516899 AACTTCAGTCATTCCTGCAATGG + Intergenic
914497918 1:148216484-148216506 AACTTCAGTCATTCCTGCAATGG - Intergenic
915101869 1:153506810-153506832 AAGTTCAGAGCATCCTGCAAAGG - Intergenic
916081484 1:161235920-161235942 GACTTCACAGCTTCCAGCAAAGG + Exonic
917173953 1:172210427-172210449 AACCTCAGTTCTTCCTGCAAGGG - Intronic
917516839 1:175715374-175715396 CACTTCTGAGCTTGCCCCAAAGG + Intronic
921275783 1:213518497-213518519 CAGGTCAGGGCTCCCTGCAAAGG - Intergenic
924012150 1:239676979-239677001 CCCTTCACAGCCTCCTGCATGGG + Intronic
1063140199 10:3249862-3249884 CAGTTAAGAGCTTCTTCCAAGGG + Intergenic
1064928630 10:20598661-20598683 CTCTCCAGTGCATCCTGCAAGGG + Intergenic
1066612282 10:37262168-37262190 CATTTCACATCTACCTGCAAAGG + Intronic
1067916134 10:50400901-50400923 CACTTGGGAGCTTCCTGCCCAGG - Intronic
1068853058 10:61766926-61766948 TACTTCAGAGTTTACTGGAATGG + Intergenic
1069556865 10:69404211-69404233 CACTTCAGAGGATCCAGTAAGGG - Intronic
1070760344 10:79020359-79020381 CACTACAGGCCTTCCAGCAAGGG + Intergenic
1072455763 10:95574390-95574412 CAGTTGAGAGGTTGCTGCAATGG + Intergenic
1074342227 10:112643489-112643511 CACTTCAGGGCTTTGTACAATGG - Intronic
1074424871 10:113342075-113342097 CACTTCAGAGATTCATACTAAGG + Intergenic
1077478661 11:2802898-2802920 CCCTACAGCGCTACCTGCAAAGG + Intronic
1078489874 11:11758883-11758905 CAACTCAGAGCTTCAAGCAAGGG + Intergenic
1078668308 11:13343889-13343911 CAGTTGAGAGGATCCTGCAAGGG - Intronic
1080162933 11:29200889-29200911 CACCCCAGAGCTACCTTCAAAGG + Intergenic
1083479539 11:62934669-62934691 CACTTCAGTCTTTCCTGGAAGGG - Intergenic
1083616143 11:64027599-64027621 CCCTTCCCAGCTTCCTGCAGAGG - Intronic
1084558436 11:69889205-69889227 CACTCCGAAGCTTCCAGCAAGGG - Intergenic
1087712269 11:101567457-101567479 CTCTTCAGAGCTGCCTGGCAGGG - Intronic
1089114784 11:116086002-116086024 CACTTCAGCGCTTTTTACAAGGG - Intergenic
1089782732 11:120884864-120884886 AACTTCTGAGCTTTCTGCGATGG - Intronic
1090989700 11:131804889-131804911 CCCTTCTGACCTTCCTGCCATGG + Intronic
1094870596 12:34597281-34597303 CACTTCAGAGGTTCCCCCAAGGG + Intergenic
1097083852 12:56453286-56453308 CTCTCCAGGGGTTCCTGCAATGG + Intronic
1097266737 12:57750242-57750264 CATTTCAGAGCTTTCTGCTATGG + Intronic
1098697113 12:73572989-73573011 CTCTTCAGAGCTTCCAGGCAGGG - Intergenic
1099421736 12:82470223-82470245 CATTTCTTAGGTTCCTGCAAGGG + Intronic
1100004556 12:89878823-89878845 CACTTCAGTGCTTCCTTCCCAGG - Intergenic
1102418930 12:112788571-112788593 CACTTCACAGCTACCTGAAGTGG - Intronic
1103012286 12:117466532-117466554 TACTTCAGAGCTCTATGCAAAGG + Exonic
1104910562 12:132238294-132238316 GACCCCAGAGCTACCTGCAAAGG - Intronic
1104995493 12:132651852-132651874 CACTTCCGAGCTCCCTCCCATGG - Intronic
1107312874 13:39098598-39098620 CTCTTCACAACTTCATGCAATGG - Intergenic
1107455871 13:40554060-40554082 CACTCCATAGCTTCCTCCCAAGG + Intergenic
1110758333 13:79201953-79201975 TATTTGAGAGCCTCCTGCAATGG - Intergenic
1114049077 14:18905255-18905277 CACCTCAGTGTTTCCTGCAGTGG + Intergenic
1114113487 14:19496678-19496700 CACCTCAGTGTTTCCTGCAGTGG - Intergenic
1114115192 14:19614431-19614453 CACCTCAGTGTTTCCTGCAGTGG - Intergenic
1115519384 14:34218030-34218052 CACTCCAGAGATGCCAGCAATGG + Intronic
1116945689 14:50832979-50833001 CAATTCTGATCTTCCTGCACAGG - Intergenic
1117586094 14:57206956-57206978 CACATCAGAGCTTTCTAAAATGG + Exonic
1120070561 14:80097859-80097881 CACCTCAGTGCTTGCTACAACGG - Intergenic
1121381183 14:93469125-93469147 CACCTCAGAGCTTGCTGCTTAGG + Intronic
1123505137 15:20934824-20934846 CACCTCAGTGTTTCCTGCAGTGG + Intergenic
1123562380 15:21508520-21508542 CACCTCAGTGTTTCCTGCAGTGG + Intergenic
1123598625 15:21945807-21945829 CACCTCAGTGTTTCCTGCAGTGG + Intergenic
1127263874 15:57345873-57345895 CACCCCACAGCTTCCTGCAATGG - Intergenic
1128745402 15:70110823-70110845 CCCTTCAGAGCTGCCTCAAAAGG - Intergenic
1130713971 15:86313526-86313548 TACATCACAGCTTCCTTCAAAGG - Intronic
1131027029 15:89151993-89152015 CACTTAGGAGCAGCCTGCAAAGG + Intronic
1131569505 15:93520350-93520372 CACTGCAGAGTTTCCCGGAAGGG - Intergenic
1132258475 15:100400058-100400080 CACTTCAGTGGTTCCTGCACAGG + Intergenic
1202970728 15_KI270727v1_random:235667-235689 CACCTCAGTGTTTCCTGCAGTGG + Intergenic
1133760854 16:8797487-8797509 CACGCCAGAGCTTCCTCCCACGG + Intronic
1137230962 16:46567921-46567943 CACTTCAAAGTTTCCTTCTAAGG + Intergenic
1138766347 16:59609894-59609916 AACTTCATAGCTTAGTGCAAGGG + Intergenic
1144727972 17:17511317-17511339 CAGTTCAGTGCTTCCTGCTCAGG - Intronic
1148536678 17:48444877-48444899 CAGTTCAGAGCTTCCCAGAAGGG + Intergenic
1148798840 17:50210636-50210658 CACTTCAGAGCCCCCTGCCTGGG - Intergenic
1158302488 18:56067186-56067208 CACTTCTGACTTTTCTGCAAAGG - Intergenic
1158626742 18:59078161-59078183 CACTTCAGTGCTTACTGGATTGG + Intergenic
1164758507 19:30709005-30709027 CACATGAGAGCTTCCAGGAACGG + Intronic
1165704597 19:37966701-37966723 CACTCCAGGGCTGCCTCCAAAGG + Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925840231 2:7985198-7985220 CACTAAAGAGTTTCCTGCAGGGG - Intergenic
926296679 2:11573994-11574016 ACCTTCAGAGCTCCCTGGAAGGG - Intronic
927015709 2:18958881-18958903 CACTTCAAATCATCCTTCAATGG - Intergenic
928129962 2:28642283-28642305 CTCATCACAGCTTCCAGCAAGGG + Intronic
929396049 2:41523512-41523534 CACTGGAGAGTTTTCTGCAAAGG + Intergenic
929646839 2:43637072-43637094 GACTCCAGAGCTTGCTGCAGCGG - Intergenic
929884942 2:45870120-45870142 CCCTTCAGAGGTAGCTGCAATGG - Intronic
932855519 2:75229928-75229950 CAGTTAAGAGATTCTTGCAAGGG + Intergenic
935177472 2:100662346-100662368 CACTTGAGGCCTTCCTGCATGGG + Intergenic
936045057 2:109180902-109180924 CACTGCAGAGCTCTCTGCATGGG - Intronic
936339756 2:111620759-111620781 CCCTTCAGAGGATCCTGCAGAGG + Intergenic
936506557 2:113112430-113112452 GACTCCAGAACTTCCTGCAGGGG - Intronic
937970711 2:127546711-127546733 CACACCAGTGCTTCCTGTAAGGG + Intronic
938426387 2:131193516-131193538 CACCTCAGTGTTTCCTGCAGTGG + Intronic
940071904 2:149698165-149698187 CACTGCACTGCTTCCTTCAAGGG - Intergenic
942942947 2:181640762-181640784 CACTTCAGAACTTCCTACTTTGG + Intronic
946956303 2:224933604-224933626 GACGTAAGAGCTTCCTGAAAGGG - Intronic
947526487 2:230879635-230879657 CACTTCAGATCCTCCAGGAATGG - Intergenic
1172469427 20:35180521-35180543 CACTCCAGAGCTCCCTGCCAGGG + Intergenic
1172525646 20:35599480-35599502 CACTGCAGAGCTTCCTTCAAAGG + Intergenic
1173644151 20:44623065-44623087 CTCTTCACAGCCTCCTGGAAGGG + Exonic
1175444067 20:59008195-59008217 CACCTCAGCGCTTCCGGGAATGG - Intergenic
1178360808 21:31947429-31947451 CATTTCTGAGCTCCCTGCCAGGG + Intronic
1178942643 21:36919953-36919975 TACTGCAGAGAGTCCTGCAAAGG + Intronic
1180467554 22:15627644-15627666 CACCTCAGTGTTTCCTGCAGTGG + Intergenic
1183301148 22:37059789-37059811 CACTTCAGAGAGTGCAGCAAAGG - Intronic
1183316604 22:37140564-37140586 ACCTACAGAGCTCCCTGCAAGGG + Intronic
1183371293 22:37433921-37433943 AATTCCAGAGCTCCCTGCAAGGG - Intergenic
1183588700 22:38767781-38767803 CAGTTCTGAGCTCCCTGCAGGGG - Intronic
1183768921 22:39906495-39906517 CACTTGAGAGCTTTCTGTAATGG - Intronic
1184227156 22:43135630-43135652 CACTTCTGGGCTTCCTTCCAAGG + Intronic
949683356 3:6541036-6541058 CTCTTCAGAGCTGCCAGCCAGGG + Intergenic
950178067 3:10889918-10889940 CACTTCAGAGCTTCCTGCAAAGG + Intronic
951846079 3:27086219-27086241 CACTCCAACGCTTCCAGCAATGG - Intergenic
951953878 3:28232436-28232458 CATTTTAAAGATTCCTGCAAAGG - Intergenic
952818453 3:37465784-37465806 CACTTCAGAGCTGCCCTCAAAGG + Intronic
955954288 3:64272605-64272627 CAGTTCAGTGCTTCTTCCAAAGG - Intronic
958854890 3:99373035-99373057 GACGTCAGAGCCTCATGCAATGG + Intergenic
961638596 3:128350352-128350374 CACAGCATGGCTTCCTGCAAGGG - Intronic
962416531 3:135187762-135187784 CACATCAGAGCTTTTTGCCAGGG - Intronic
962919740 3:139939702-139939724 CACTGCAGAACTTCCTGCAGGGG + Intronic
963138445 3:141928839-141928861 CACTTCAGAGCACCCTTCAGAGG + Intergenic
963707786 3:148709808-148709830 CACTTCAGAGCTTGTTTCACAGG + Intronic
965308717 3:167101283-167101305 CACCTGAGAGCTTCTTGAAAAGG + Intergenic
968487580 4:871297-871319 CACCTCAGAGCTGCCTGCCTGGG - Intronic
968701618 4:2060374-2060396 CCCCTCAGAGCTTCCTGCCGGGG + Intronic
969477803 4:7431301-7431323 CACCCCAGAGCTACCTGCAGTGG - Intronic
970904600 4:21201455-21201477 CAATTCATAGTATCCTGCAATGG - Intronic
972787826 4:42344215-42344237 CACTTCTGGGCTTTCTGTAAGGG + Intergenic
973926868 4:55747819-55747841 GACAACAGAGCTTCCTGAAAGGG - Intergenic
974509534 4:62820424-62820446 CACATCAGAGCTTTCTAAAATGG - Intergenic
975844834 4:78514133-78514155 CTCTCCAGAGCTCCCTGCCATGG - Intronic
976476486 4:85489630-85489652 TTTTTCAAAGCTTCCTGCAAAGG - Intronic
977467700 4:97402900-97402922 CTCTTCAGAGCTTCCAGGCAGGG + Intronic
978765471 4:112400850-112400872 CTCTTCACATCTTCCTGCCAGGG - Intronic
981359881 4:143834158-143834180 CACTTCAGAAATTCCTTCTAGGG - Intergenic
981370649 4:143955234-143955256 CACTTCAGAAATTCCTTCTAGGG - Intergenic
982967799 4:161936147-161936169 CAATACAGAGCTTCCTTCAATGG + Intronic
983788103 4:171759652-171759674 CTCTTCAGAGCTTCCAGGCAGGG - Intergenic
983869917 4:172813384-172813406 GAATTCAGAGATTCCTGAAAAGG + Intronic
984757879 4:183340804-183340826 CAATTCAGTGGTTCCTCCAAAGG - Intergenic
985521758 5:377153-377175 CACCACAGAGCTTCCTGCCCAGG - Intronic
989998358 5:50862631-50862653 CCTTTCAGAGCTCCCTGCCATGG + Intergenic
990655611 5:57951254-57951276 CATTTCAGAGTTCCCTGCCAGGG + Intergenic
991528561 5:67591236-67591258 CTCTTGAGACCTTCCTGCATTGG - Intergenic
993958508 5:94267141-94267163 CACCTCATTGCTTCCTGGAAAGG - Intronic
997390331 5:133509891-133509913 GACTTCTGAGGTTCCTGCCAAGG - Intronic
999157034 5:149465264-149465286 CACTTCAGGGCTTCCATCATCGG + Intergenic
1003957800 6:11180563-11180585 CACTGCAGAACTTTCTGCAATGG - Intergenic
1004442433 6:15666615-15666637 CATCTGGGAGCTTCCTGCAAAGG + Intergenic
1006102455 6:31693930-31693952 GAAGTCAGAGCTTCCTTCAACGG - Intronic
1012791186 6:103698472-103698494 CACTTCAAAGGATCCTGCGAGGG + Intergenic
1014018212 6:116558824-116558846 AACTCAAGAGCTTCCTGCATGGG - Intronic
1019258189 7:64863-64885 CCCTTCAGAACAGCCTGCAAGGG - Intergenic
1019469642 7:1211853-1211875 CATTCCAGAGCCTCCTGCATGGG - Intergenic
1022869176 7:34457808-34457830 CTCTTCAGAGCTGCCTGGTAGGG - Intergenic
1023594536 7:41815120-41815142 CACTGCCGAGCATCCTTCAAAGG - Intergenic
1024598579 7:50960723-50960745 CACTGCAGAGAGGCCTGCAATGG - Intergenic
1026565564 7:71487196-71487218 CATTTCAGAGCTTGCTGCCAGGG + Intronic
1028036227 7:85987514-85987536 CACTTCAAAGCTTTCGGAAAAGG - Intergenic
1028487454 7:91375515-91375537 CCTTTCAGAGCTTCCTAGAATGG - Intergenic
1028964742 7:96789671-96789693 CATTTCAGATCTTTCTTCAAGGG + Intergenic
1029232329 7:99080844-99080866 CACTTCCCAGCTCCCTGCAAGGG + Intronic
1030137864 7:106274880-106274902 CAGTTCAAAACTTCTTGCAAAGG - Intronic
1031527765 7:122842146-122842168 CACTTCAGATGCCCCTGCAAGGG + Intronic
1034924550 7:155110685-155110707 CCCTTCAGAGCTGAGTGCAAAGG - Intergenic
1035988207 8:4457819-4457841 CACTGCAAAGCTGTCTGCAAGGG - Intronic
1038861844 8:31396425-31396447 CACTTCAGAGCAATCTGGAATGG + Intergenic
1039468083 8:37797633-37797655 CACTTCAGAGATTTCTGGACAGG + Intronic
1041374149 8:57194527-57194549 CACTTCAAAGTTTCCTTCTAAGG - Intergenic
1041573738 8:59369196-59369218 CACTTCAGAGTTTCTAGCACTGG + Intergenic
1045920846 8:107527236-107527258 CACCTCAAAGCCTCCTGAAATGG - Intergenic
1047389454 8:124438326-124438348 CACTGCAGTGCTTACTGCCAAGG + Intergenic
1047405973 8:124586212-124586234 AACCTCAGAGCTGGCTGCAAGGG - Intronic
1048488175 8:134867708-134867730 CACTGCAGAGCTTTCTGAATAGG + Intergenic
1049428723 8:142549466-142549488 CACTTCAGAACCCCCTGCCAGGG - Intergenic
1051760821 9:20461994-20462016 CACATCAGAGCCTCCAGGAATGG + Intronic
1055355028 9:75428788-75428810 GCCTGCAGAGCCTCCTGCAAGGG - Intergenic
1056789534 9:89616622-89616644 CTCTCCAGAGCGTCCTGCACAGG + Intergenic
1056858967 9:90162055-90162077 CACTTCATGGCTTCCTACACTGG + Intergenic
1057488184 9:95502367-95502389 CTCTGGAGAGCTTTCTGCAATGG + Intronic
1059797404 9:117713885-117713907 AACACCAGAGTTTCCTGCAATGG + Exonic
1060284126 9:122233947-122233969 AATGTCAGAGCTTCCTGGAAGGG - Intergenic
1061363779 9:130159799-130159821 CACATCAGAGCTGTCTGCCATGG - Intergenic
1185691224 X:2156652-2156674 CATTTCTGAGCTTCCTGCCTAGG - Intergenic
1186552738 X:10523614-10523636 CAATTCAAACCTTCCTCCAAGGG - Intronic
1187244091 X:17538488-17538510 CACGTCAGAGTTTCCTGCCTAGG + Intronic
1187556361 X:20356097-20356119 CATTGCAGAACTTTCTGCAATGG + Intergenic
1189450137 X:41121445-41121467 CACTTCGAAACTTCCTGCAGTGG + Intronic
1191699614 X:64026315-64026337 TACTTCAAAACTTACTGCAAAGG - Intergenic
1197702286 X:129608405-129608427 CACTTCAGAGTTCCCTGACATGG + Intergenic
1201681437 Y:16648234-16648256 CACTTCAGAGCTTACAACAGAGG + Intergenic