ID: 950181104

View in Genome Browser
Species Human (GRCh38)
Location 3:10914067-10914089
Sequence CTGTCCCACCAGCAGGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950181104_950181114 18 Left 950181104 3:10914067-10914089 CCATACCCCTGCTGGTGGGACAG 0: 1
1: 1
2: 3
3: 11
4: 186
Right 950181114 3:10914108-10914130 CACATCACTGGGTCATCATGTGG 0: 1
1: 0
2: 1
3: 15
4: 177
950181104_950181111 7 Left 950181104 3:10914067-10914089 CCATACCCCTGCTGGTGGGACAG 0: 1
1: 1
2: 3
3: 11
4: 186
Right 950181111 3:10914097-10914119 GAATTAACCACCACATCACTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
950181104_950181115 27 Left 950181104 3:10914067-10914089 CCATACCCCTGCTGGTGGGACAG 0: 1
1: 1
2: 3
3: 11
4: 186
Right 950181115 3:10914117-10914139 GGGTCATCATGTGGCTCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 68
950181104_950181110 6 Left 950181104 3:10914067-10914089 CCATACCCCTGCTGGTGGGACAG 0: 1
1: 1
2: 3
3: 11
4: 186
Right 950181110 3:10914096-10914118 GGAATTAACCACCACATCACTGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950181104 Original CRISPR CTGTCCCACCAGCAGGGGTA TGG (reversed) Intronic
902653715 1:17853328-17853350 CTGTCCCAGGAGCAGGGCTGGGG - Intergenic
903377199 1:22874372-22874394 CTGTCCCACCAGGAGGCCAAAGG + Intronic
903791374 1:25895488-25895510 CTGGGCCTCCAGCAGGGGCAGGG + Intronic
904301032 1:29555209-29555231 CTGTACCCCCAGCAGGGCTCTGG - Intergenic
906948907 1:50318657-50318679 ATGTCCCCCCACCAAGGGTAGGG + Intergenic
910515983 1:88060755-88060777 CCTTCCCAGCAGCAAGGGTACGG + Intergenic
910863186 1:91763577-91763599 CTGTCCCCTCTTCAGGGGTAAGG + Intronic
912055139 1:105587340-105587362 CTCTCCTACCAGTAGGGGAAGGG + Intergenic
912771742 1:112470678-112470700 CTGCTCCACCAGTGGGGGTAGGG + Intronic
917034029 1:170726565-170726587 CTGCCCCAGCAGCAGGGTTTGGG + Intronic
918218610 1:182415496-182415518 CTTTCCCACTATCAGGGGAAGGG - Intergenic
919606226 1:199688105-199688127 CTGGCTAACCAGCTGGGGTAAGG - Intergenic
919809962 1:201402769-201402791 CAGTCCCTCCAGCAGGGAGATGG - Intergenic
920296250 1:204958936-204958958 CTCTGCCATCAGCAGGGATAGGG - Intronic
922099866 1:222471401-222471423 CTGGCACAGCTGCAGGGGTAGGG - Intergenic
923375038 1:233353196-233353218 ATGTCCTGCCAGCAGGTGTAAGG + Intronic
923936695 1:238768997-238769019 CTCAGCCATCAGCAGGGGTAAGG + Intergenic
1062854160 10:771292-771314 CTGTCACACCCGCAGGAGTGAGG + Intergenic
1067686741 10:48470386-48470408 CTGTCCCATCAGCAGGGGTGGGG + Intronic
1068080955 10:52316027-52316049 CTTTCCCACCAACTGTGGTAGGG - Intronic
1069035556 10:63642576-63642598 TTCTACCACCAACAGGGGTAAGG + Intergenic
1070911123 10:80119289-80119311 CAGTCCCACCTGCTGGTGTAGGG - Intergenic
1071600280 10:86955620-86955642 CTGTCCCTGCAGCATGGGAAGGG - Intronic
1071824189 10:89308196-89308218 ATGTTCCACCAGTAGGGATAGGG + Exonic
1075307126 10:121377975-121377997 CAGCCCCACCAGAAGGGGTTGGG - Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1075955190 10:126517518-126517540 CTCTCCCAATAGCTGGGGTATGG - Intronic
1076128036 10:127991770-127991792 CTGTCCGTCCAGCAGGGATCTGG + Intronic
1076137856 10:128057234-128057256 CTGGCCCAGCAGCAGGGGGGCGG + Intronic
1076361863 10:129895224-129895246 CTGCCTCACCAGCAGGAGTTTGG + Intronic
1076754797 10:132563770-132563792 CTGTCTCACCAGCAAGCGCAAGG - Intronic
1077017828 11:404715-404737 CTGGGCCACCAGGAGGGGCAGGG + Exonic
1077178667 11:1202738-1202760 CTGTCCCACCATCAGGCGTGGGG - Intergenic
1077390969 11:2300474-2300496 GTGCCCCACCAGCGGGGGCAGGG - Intronic
1077444308 11:2583203-2583225 ATGTCCCACCAGCACATGTAAGG - Intronic
1077499559 11:2903029-2903051 CTGGCCCACCTGCAGGGGTCGGG + Intronic
1078153220 11:8776561-8776583 CTGTGCCACTTGTAGGGGTAAGG + Intronic
1078879996 11:15438587-15438609 CTGTCCTATGAGCAGGGGTTGGG - Intergenic
1080916567 11:36666319-36666341 CTGTCCCAACAGCAGGAAAACGG + Intergenic
1081540068 11:44028127-44028149 CTGTCACCCAAGCAGGAGTACGG - Intergenic
1082229036 11:49741953-49741975 CTGTCCCATCAGCAGGAAAATGG - Intergenic
1082822093 11:57551038-57551060 CTGGCTCACCTGCAGGGGTGTGG + Intergenic
1083890671 11:65594255-65594277 CTCCCCCACCAGAAGGGGCAGGG - Intronic
1083945529 11:65920686-65920708 CTGTCCCATCACCAAGGGCAGGG - Intronic
1090026848 11:123174988-123175010 CTGTCACGCCAGCTGGAGTATGG + Intronic
1092154675 12:6274511-6274533 TTGTCCCACTGGCAGGGGCAGGG - Intergenic
1092234270 12:6796408-6796430 TTGTCTCACCAGCAGGGGCCAGG + Intronic
1096553626 12:52390213-52390235 GAGTCCCCCCAGCAGGGGTGGGG + Intergenic
1096579263 12:52573919-52573941 CTGGCCCATCAGCAGGGGAAAGG - Intergenic
1096715409 12:53488134-53488156 CTGTCCCCCCAGCACAGGTGGGG + Intronic
1099721038 12:86361871-86361893 CAGTCCCACCAACAGGGTAAAGG - Intronic
1099958228 12:89371913-89371935 CTCTCCCATCAGGAGGGGAAAGG + Intergenic
1103717178 12:122951687-122951709 GTGCCCCACCAGGAGGGGTGGGG - Intronic
1107011490 13:35675163-35675185 CAGGCCCACCACCAGGGGTGAGG - Intergenic
1111874822 13:93880100-93880122 CAGTCCCACCAACAGGGTAAAGG - Intronic
1112555641 13:100466189-100466211 ATGTCTCACCAGCAGGATTACGG - Intronic
1117498555 14:56329870-56329892 CTGCCCTAGCAGAAGGGGTATGG + Intergenic
1119807430 14:77491319-77491341 CTGTCCCACCTGGAGCGGGATGG - Intronic
1121440017 14:93942627-93942649 CTAGCCCAACAGCAGGGGAATGG + Intronic
1122506191 14:102233312-102233334 CGGTCCCGCCAGCAGGGCTGTGG + Intronic
1122882852 14:104697788-104697810 ATGTCCCACTAGCATGGGTGGGG + Intronic
1123147471 14:106146889-106146911 CTGTCTCAGGAGCAGGGGTGAGG + Intergenic
1124079235 15:26475747-26475769 CAGACCCACCTGCAGGGGTCAGG - Intergenic
1125730068 15:41888075-41888097 CTGTCCCGCCAGGAGGAGTTTGG - Exonic
1125742070 15:41972288-41972310 CTGGCCCACCAGCAGGATCATGG + Exonic
1128061519 15:64738608-64738630 CTTTCCCACCAGCACAGGCAGGG + Intergenic
1128404951 15:67326572-67326594 CTGTCCCACCAGCGGTGTAAGGG + Intronic
1128703452 15:69821197-69821219 CTTTCCCACCATCAGTGGGAGGG - Intergenic
1129190405 15:73934125-73934147 CTGGCCCACAAGCAGGGGGAAGG - Intronic
1129458085 15:75686390-75686412 CTGTGCCTCCAGGAGGGGTGGGG - Intronic
1135421051 16:22305747-22305769 CTGGCCCAGCAGCAAGGGGAGGG - Intronic
1136141890 16:28293350-28293372 CTTCCCCACCTGCAGGGCTATGG - Intronic
1136989989 16:35146195-35146217 CTGTCCCACCCGCAAGGTAACGG - Intergenic
1137576636 16:49604342-49604364 CTGTGCCACTACCAGGGCTAGGG - Intronic
1138170079 16:54840686-54840708 CAGTCCCCACAGCAGGGGAAGGG + Intergenic
1139346530 16:66307368-66307390 CAGGCCCCCCAGCAGGGGTCTGG + Intergenic
1140526389 16:75626425-75626447 CTTAAACACCAGCAGGGGTAGGG + Intergenic
1141230547 16:82163072-82163094 ATGTCCCACCAGGAGGGATCGGG - Intronic
1141529395 16:84635732-84635754 CTGTCCAACCAGGAGAGGAAAGG - Intergenic
1142878743 17:2868256-2868278 CTGGCCCTCCACCAGGGGGATGG - Intronic
1144808169 17:17981311-17981333 CTGTCCCGTCTGCAGGGATAGGG - Intronic
1147688566 17:42301337-42301359 CCCGCCCACCAGCAGGCGTACGG - Exonic
1148071968 17:44913898-44913920 CTGCCCCAGAAGGAGGGGTAAGG - Intronic
1148080513 17:44965594-44965616 TTTTCCCTCCAGCAGGGGCAGGG - Intronic
1148735024 17:49860481-49860503 GTGGCCCACCATCAGGGGAAGGG + Intergenic
1148752386 17:49952708-49952730 CTGAACCACCTGCAGGGATATGG + Intergenic
1153525061 18:5987011-5987033 CTCTCCCACCATCAGTGGGATGG + Intronic
1153905636 18:9659090-9659112 CTATCCCACCAGCTGGGTTTGGG + Intergenic
1155054483 18:22171748-22171770 CCGTACCACCTGCAGGGGTCGGG + Exonic
1156379485 18:36544731-36544753 CAGTCCCACCAGAAAGGGGAGGG - Intronic
1158494168 18:57938510-57938532 CTGTCCCTCCACCAGGGGTATGG + Intergenic
1158706962 18:59801460-59801482 CTGTCCCCCAAGCTGGAGTACGG + Intergenic
1159688371 18:71453038-71453060 ATGTCCCACCAGGAAGAGTATGG - Intergenic
1160578210 18:79869043-79869065 CTGTCCCAGGTGCAGGGGTGGGG + Intronic
1162440592 19:10689870-10689892 CTGACCCACCAGCAGTGCAATGG + Exonic
1162509932 19:11111864-11111886 CTGTTCCACCAGTAGGGCTGAGG - Intronic
1163847760 19:19646936-19646958 CTGTACCACCTGGAGGGGTCTGG + Intronic
1165325693 19:35113291-35113313 CTGTCCCACCACCATGGGGATGG - Intergenic
1168695616 19:58402365-58402387 GTGTCCCCCCACCAGGGGGATGG + Intronic
925182625 2:1827000-1827022 CTGGGGCACCAGCAGGGGTGGGG - Intronic
925292280 2:2755869-2755891 CAGTCCCACCAGCAGGGGTAGGG - Intergenic
926727606 2:16010569-16010591 CTGCCCCACAAGCTGGGGTTGGG - Intergenic
927813603 2:26194663-26194685 CAGTCCCAGCAGCAGGGCCAGGG - Intronic
931538194 2:63301280-63301302 CTGTCCCATCAGCAGGAAAATGG + Intronic
932215035 2:69961106-69961128 CTTTGCCAACAGCATGGGTAAGG - Exonic
937218631 2:120328642-120328664 CTAGGCCACCAGCAAGGGTATGG - Intergenic
938090731 2:128432939-128432961 CTGTCCCCCAAGCTGGAGTATGG + Intergenic
942163280 2:173215183-173215205 CTGTCTCACTGGCAGGGGTGTGG + Intronic
942319796 2:174726275-174726297 CTGCCCCAGCAGCAGGAGTGAGG - Intergenic
943816702 2:192266760-192266782 CTGTCCCAGCATCCAGGGTATGG - Intergenic
944663290 2:201938903-201938925 CTGTTCCACCAGCTGTGGTCAGG - Intergenic
947103486 2:226646006-226646028 CTTTACCACCAGTAGGCGTAGGG + Intergenic
1168766878 20:387938-387960 TCCTCCCACCAGCAGGGGAAAGG + Intronic
1169075822 20:2759321-2759343 CTGTGCCACCATCCGGGGTGTGG - Exonic
1169340104 20:4790087-4790109 CTGTGCCCCCAGCTGGTGTATGG - Intronic
1169855506 20:10097760-10097782 CATTCCCACCAGCAGAAGTAAGG + Intergenic
1175514639 20:59561240-59561262 CTGTCCCTCCAGCTGAGGTGTGG - Intergenic
1176011616 20:62899867-62899889 CTGTCCCACCTGGAGTGGAATGG - Intronic
1176861261 21:14012696-14012718 CTGCCCCCAGAGCAGGGGTAAGG - Intergenic
1178793204 21:35719390-35719412 CTTTTCCTCCAGCAGGGCTATGG - Intronic
1179928878 21:44553838-44553860 CTGTCCCACTAACCAGGGTATGG + Intronic
1184903649 22:47464165-47464187 TAGTCCCACCAGCAGGGCCAGGG + Intronic
1185395619 22:50585963-50585985 ATGTCCCACCAGCAGGTGCTCGG - Intronic
950181104 3:10914067-10914089 CTGTCCCACCAGCAGGGGTATGG - Intronic
950645484 3:14374289-14374311 CCGTCTCTCCAGCTGGGGTAGGG + Intergenic
953468923 3:43150239-43150261 GTGACCCAACAGCTGGGGTATGG + Intergenic
953908173 3:46878779-46878801 CTGCCACACCAGCAGGGGTGGGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
957369381 3:79272559-79272581 ATCTCCCAGCAGCAGGGGCATGG + Intronic
961172752 3:124809893-124809915 CACTCCCACCAGCAGGGTTGGGG - Intronic
962990303 3:140572001-140572023 CTGTGCCAGCAACAGGGGAAGGG + Exonic
966918725 3:184598825-184598847 CTGTCCCACCATACTGGGTAGGG - Intronic
968825782 4:2895692-2895714 CATTCACACCAGAAGGGGTAAGG - Intronic
968930331 4:3575559-3575581 CTGTTCCAGCGGGAGGGGTATGG - Intergenic
969338831 4:6527902-6527924 CTGTCCCAGGAGCTGGGGAAGGG + Intronic
969483954 4:7461350-7461372 CCGCCTCACCAGCAGGGGGATGG + Intronic
971469237 4:27001965-27001987 TTCTCCCACCAGCAGGGGCGTGG + Intronic
972083364 4:35182290-35182312 CTATGCCAACAGCAGTGGTATGG - Intergenic
973712928 4:53647064-53647086 CTGTCCCAGCACCAGAGGTTAGG + Intronic
975498201 4:75057503-75057525 CTGTCCCACCAGCTGGATAAAGG - Intergenic
976627368 4:87200670-87200692 CATTCCCACCAGCAGTGGAAAGG - Intronic
978019113 4:103786441-103786463 CTGTCCCATCAGCAGGAAAATGG + Intergenic
980642312 4:135596548-135596570 CTGTCCCATCAGCAGGAAAATGG + Intergenic
989217862 5:38923670-38923692 CTGTCCCCCCAGCAGTGGAGGGG + Intronic
991244051 5:64490054-64490076 TTGTGACACCAGCAGGGGCAGGG - Intergenic
997735997 5:136213078-136213100 CAGTCCCACCTGCAGTGGGAGGG + Intergenic
1000464234 5:161555394-161555416 CTGCTTCACCAGCAGGAGTAAGG - Intronic
1001041535 5:168339188-168339210 TTGTCCCCTCAGCAGGGGTAAGG + Intronic
1001907429 5:175484535-175484557 CTTTTCCACCCGCAGGGGTCAGG - Intronic
1002845384 6:940322-940344 CTTTCCCCCCAGCAGGGGTGGGG - Intergenic
1004851739 6:19706504-19706526 CTGTCCCTCCAGAAAGGGTTTGG + Intergenic
1005595988 6:27379916-27379938 CTGTCCCACCAAAGGGGGTAGGG + Intronic
1006152302 6:31996046-31996068 CTGTCCCAGCAGCAGGCTGACGG + Exonic
1006158605 6:32028784-32028806 CTGTCCCAGCAGCAGGCTGACGG + Exonic
1006189904 6:32201347-32201369 CAGTACCACCAGCAGGGCCAGGG + Exonic
1009494300 6:64329431-64329453 CTGTCCCAACAACAGAGGAATGG + Intronic
1011353021 6:86444316-86444338 CTGTCCCACCTCCAGGAGGAAGG + Intergenic
1011443539 6:87412693-87412715 CTGTCCCCCAAGCTGGGGTGCGG + Intronic
1011600375 6:89054494-89054516 CAATCCCACCAACAGGTGTAAGG + Intergenic
1015811489 6:137165808-137165830 CTGTCCCAACAACAGAGGAATGG + Intronic
1018910221 6:168097457-168097479 CTGTCCCGTCAGCGGGGCTAGGG - Intergenic
1019483431 7:1276646-1276668 CTGTGCCCCCAGCAGGGTGATGG + Intergenic
1019713642 7:2528762-2528784 CTGTCCCTCCTGCAGGGGCTGGG - Intronic
1020026920 7:4905779-4905801 ATTTCCCACCAGCTGGGGTCAGG - Intergenic
1021517565 7:21504821-21504843 CTCTCCTACCAGCAGGGCTGTGG + Intronic
1022007594 7:26280412-26280434 CTGTCTCTCAAGCAGGGGTCTGG - Intergenic
1023931141 7:44707413-44707435 GTGTCCCCCCAGCGGGGGTCAGG + Intronic
1028351707 7:89857639-89857661 CTGTCCCATCAGCAGGAAAACGG + Intergenic
1029375300 7:100173859-100173881 CTGTCTCAGCAGCAGGGGACTGG - Exonic
1030180584 7:106704459-106704481 CTGTGCTTCCAGCAGGGGTGGGG - Intergenic
1033499775 7:141936341-141936363 CTGTCACTGCAGCAGGGATAGGG - Intronic
1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG + Intronic
1034786402 7:153929659-153929681 CTTTCCCACCAGCAGTGGGTGGG + Intronic
1035022475 7:155807701-155807723 ATGTCCCACCAGCAGCAGCAGGG - Intronic
1035644095 8:1205277-1205299 GTGTCCAACCAGGAGGGGTCGGG + Intergenic
1038284140 8:26191808-26191830 CTGTCCCACATGCAGGTGTGTGG - Intergenic
1039883538 8:41642353-41642375 CTGTCCCCGCAGCATGGGTTAGG - Intergenic
1040109036 8:43558030-43558052 CTGGCCCACCAGCTGATGTAAGG + Intergenic
1044929693 8:97239974-97239996 CTGAGCCACCAGCAGAGGCAAGG - Intergenic
1048996468 8:139796853-139796875 CATTCCCACCAGCAGTGGGAGGG + Intronic
1049335118 8:142080157-142080179 CTTCCCCACCAGAAGTGGTAGGG - Intergenic
1050343086 9:4660566-4660588 CTGTCCCACCAACAGTGTAAAGG - Intronic
1052294135 9:26878776-26878798 CTGTCCCCCAAGCTGGAGTACGG - Intronic
1054459773 9:65456355-65456377 CTGTTCCAGCGGGAGGGGTATGG + Intergenic
1056797814 9:89670643-89670665 CTGTCTCTCCAGAAGGGCTAAGG - Intergenic
1056879833 9:90380529-90380551 CTGTCCCATCAGCTGGGGGTGGG - Intergenic
1056958389 9:91101035-91101057 CTGTCCCAGCAGCACGGGGTGGG + Intergenic
1057871745 9:98723272-98723294 CTGTCCCTCCAGCTTGGGGAAGG - Intergenic
1058175114 9:101726424-101726446 CTGTACCACCAGAAGGTGTTTGG - Intronic
1058330203 9:103750925-103750947 CTGTCCCACCAACAGTGTAAAGG + Intergenic
1059164338 9:112064180-112064202 CTGGCCCACCACCTGGGGTTGGG - Intronic
1060361277 9:122959846-122959868 CTGTCCCAGGAGCAGGGGCTGGG - Intronic
1060758373 9:126228506-126228528 CTCTCCCACCATCATGTGTATGG - Intergenic
1061135139 9:128729453-128729475 CTGTGCCACCATCAGGGAGAAGG - Intergenic
1062504190 9:136865070-136865092 CTGTGCAACCAGTAAGGGTAGGG + Intronic
1187240174 X:17505769-17505791 CTGTCTCTCCAGCAGGGGTGAGG + Intronic
1189216652 X:39330873-39330895 CTGTCACCCAAGCTGGGGTATGG - Intergenic
1193790807 X:85813405-85813427 CTGTCCCATCAGCAGGAAAATGG + Intergenic
1196577177 X:117332972-117332994 CTGTCTCACAAGCAGTGCTATGG + Intergenic
1200839685 Y:7768310-7768332 CTGTCACAACTGCAGGGATAGGG + Intergenic
1202381271 Y:24277840-24277862 CTGGCACAGCTGCAGGGGTAGGG + Intergenic
1202489514 Y:25392286-25392308 CTGGCACAGCTGCAGGGGTAGGG - Intergenic