ID: 950181254

View in Genome Browser
Species Human (GRCh38)
Location 3:10915062-10915084
Sequence GTAAGGGACTCGAGCTCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950181254_950181262 30 Left 950181254 3:10915062-10915084 CCCGTGGAGCTCGAGTCCCTTAC 0: 1
1: 0
2: 0
3: 0
4: 46
Right 950181262 3:10915115-10915137 GCTTTTCACCTGAGTCTTCCTGG 0: 1
1: 0
2: 0
3: 18
4: 245
950181254_950181260 8 Left 950181254 3:10915062-10915084 CCCGTGGAGCTCGAGTCCCTTAC 0: 1
1: 0
2: 0
3: 0
4: 46
Right 950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 126
950181254_950181259 1 Left 950181254 3:10915062-10915084 CCCGTGGAGCTCGAGTCCCTTAC 0: 1
1: 0
2: 0
3: 0
4: 46
Right 950181259 3:10915086-10915108 CCTGTTCACATTGCCACAGATGG 0: 1
1: 0
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950181254 Original CRISPR GTAAGGGACTCGAGCTCCAC GGG (reversed) Intronic
904379637 1:30102096-30102118 CTGAGGGACTGGAGCCCCACAGG - Intergenic
906168562 1:43705941-43705963 GCAAGGGACTCAACCTCCAGTGG + Intronic
1062789529 10:293070-293092 GTCAGGGGCTCCAGCTGCACTGG - Intronic
1071460431 10:85888598-85888620 GACAGTGACTCGAGCTCCTCTGG + Intronic
1072686404 10:97539928-97539950 GGAAGGGCCTCGGGCTGCACAGG - Intronic
1076131045 10:128014169-128014191 GGCAGGGACCCCAGCTCCACAGG + Intronic
1076247585 10:128959333-128959355 GCAAGGGCGTCCAGCTCCACCGG + Intergenic
1088021264 11:105122551-105122573 GTAAAGGACTCTAGGTCTACAGG - Intergenic
1116947348 14:50848120-50848142 GTAACGCACCCCAGCTCCACAGG - Intergenic
1128604608 15:69027510-69027532 GTCAGACACTAGAGCTCCACAGG + Intronic
1131471768 15:92703940-92703962 GAAAGAAACTGGAGCTCCACAGG + Intronic
1133850191 16:9496126-9496148 ATAATGGCCTCTAGCTCCACGGG + Intergenic
1149535397 17:57429659-57429681 GTTACAGACTAGAGCTCCACTGG - Intronic
1158941694 18:62410762-62410784 GTAAGGGACTCGAGCATCCATGG - Intergenic
1159908834 18:74124009-74124031 GTAAGGGAGTCTAAGTCCACAGG + Intronic
1160842501 19:1152522-1152544 GGCCGGTACTCGAGCTCCACCGG + Intronic
1164588116 19:29490310-29490332 GTGAGGGACTCGAGTTTCATAGG - Intergenic
1165788639 19:38477648-38477670 GTCAGGGACTCGGGCTCCCTGGG - Intronic
1168333735 19:55585238-55585260 GTAAGGGACTCGATCACCCAGGG - Intergenic
927146777 2:20171455-20171477 CAAAGGTACTGGAGCTCCACAGG + Intergenic
928039066 2:27855408-27855430 GTAAGGAACTCAAGATGCACTGG - Intronic
930006157 2:46898774-46898796 GTGAGGGGCTGGAGCCCCACTGG - Intergenic
935357881 2:102221411-102221433 GTAAGGGACTGCAGATACACTGG + Intronic
948869961 2:240792823-240792845 GGAAGGGACCCGAGCTCCCTGGG + Intronic
1175924717 20:62466086-62466108 GAATGGGAATCCAGCTCCACGGG - Intronic
949825771 3:8163812-8163834 GTAAAGGACTCCAGCATCACTGG + Intergenic
950181254 3:10915062-10915084 GTAAGGGACTCGAGCTCCACGGG - Intronic
963121744 3:141782364-141782386 GTGAGGGTCTCTAGCTCCAGTGG + Intronic
969303408 4:6310602-6310624 GTAAGGAACTTGAGCTTCAGAGG - Intergenic
979867440 4:125774433-125774455 GTAATGAACTCGAGTTCCAAGGG - Intergenic
985160684 4:187041405-187041427 GTAAGGAGCTGGAGATCCACTGG - Intergenic
998231145 5:140362131-140362153 GTAAGGGACCCCAGTACCACAGG - Exonic
1001919921 5:175591671-175591693 GTAATGGACTAGACATCCACAGG + Intergenic
1007363556 6:41374657-41374679 GTCAGGGCCTGGAGCTCCAGAGG - Intergenic
1012819912 6:104073189-104073211 GTAAGGGACTTGAGCATCAGTGG + Intergenic
1016639075 6:146327949-146327971 ATAAGGGACTGGATTTCCACAGG + Intronic
1020791100 7:12629237-12629259 GTAAAGATCTCGAGTTCCACAGG + Intronic
1022970994 7:35517170-35517192 GGAAGGGTCTTGAGCTCTACAGG - Intergenic
1025020337 7:55475343-55475365 GCAAGGGACTCGGCCACCACAGG + Intronic
1028456856 7:91047876-91047898 GTCAGGGACTGGGGCTCCCCTGG - Intronic
1032133161 7:129248316-129248338 ATAAGGGACTCGAGCATCCCAGG - Intronic
1039842564 8:41304338-41304360 GTAAAGGACTCCAGCTTCCCAGG + Intronic
1040885634 8:52260643-52260665 GTAAGTCATTCTAGCTCCACAGG + Intronic
1042993180 8:74663978-74664000 ATAATGGCCTCCAGCTCCACTGG - Intronic
1049556882 8:143286988-143287010 GGAAGGACCTCAAGCTCCACAGG - Intergenic
1186461816 X:9754082-9754104 GTAGGGGGCTGGAGCTCCATGGG + Intronic
1187501740 X:19844632-19844654 GTAGGGGACTCAAGGCCCACAGG - Intronic