ID: 950181260

View in Genome Browser
Species Human (GRCh38)
Location 3:10915093-10915115
Sequence ACATTGCCACAGATGGAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950181257_950181260 -9 Left 950181257 3:10915079-10915101 CCTTACTCCTGTTCACATTGCCA 0: 1
1: 0
2: 2
3: 24
4: 408
Right 950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 126
950181256_950181260 -8 Left 950181256 3:10915078-10915100 CCCTTACTCCTGTTCACATTGCC 0: 1
1: 0
2: 0
3: 26
4: 285
Right 950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 126
950181255_950181260 7 Left 950181255 3:10915063-10915085 CCGTGGAGCTCGAGTCCCTTACT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 126
950181254_950181260 8 Left 950181254 3:10915062-10915084 CCCGTGGAGCTCGAGTCCCTTAC 0: 1
1: 0
2: 0
3: 0
4: 46
Right 950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950181260 Original CRISPR ACATTGCCACAGATGGAGCG TGG Intronic
900737654 1:4309177-4309199 ACATTGCCACAGGTGGCCAGGGG - Intergenic
902830510 1:19009411-19009433 ACATCGCTACAGATGAAGCTGGG + Intergenic
903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG + Intronic
903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG + Intronic
923235716 1:232031099-232031121 ACACTGCCAAAGAAGGAGGGAGG + Intronic
1067697451 10:48546179-48546201 ACACTGCCACAGGAGTAGCGGGG - Intronic
1070403140 10:76070939-76070961 TCCTTGCCACTGATGGAGCCAGG + Intronic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1073893937 10:108132295-108132317 ACATGGACACACATGGAGTGAGG + Intergenic
1074670509 10:115785125-115785147 ACATATCCACCGATGGAGAGGGG - Intronic
1076171506 10:128323893-128323915 TCATTGCACCAGAAGGAGCGTGG + Intergenic
1076495246 10:130892996-130893018 AGATTGCCACAGCTGGACCAAGG + Intergenic
1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080761516 11:35254582-35254604 ACAGTGCCCCAGAAGGAGTGAGG + Exonic
1089357914 11:117867351-117867373 ACTTTGCCACAGATGCAGTGTGG - Intronic
1090198462 11:124837552-124837574 TCTTTGTCACTGATGGAGCGGGG - Intergenic
1090479620 11:127056589-127056611 ACATGGCCACAGAGGGCGCTGGG + Intergenic
1091204807 11:133812857-133812879 AAGTTGCCACAGATGAAGTGAGG + Intergenic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1093337210 12:17920876-17920898 ACATTGGCACAGATGCTGCCTGG + Intergenic
1094821707 12:34231321-34231343 ATATTGCCCCAGATTGGGCGTGG + Intergenic
1095742348 12:45621192-45621214 CCATTGCCATAGAGGGAGCCTGG + Intergenic
1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG + Intergenic
1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG + Exonic
1106752928 13:32793589-32793611 AAATTGCTACAGATGGAGATGGG - Intergenic
1110786237 13:79530410-79530432 AAATTGCCACAGCTGGAGCTGGG - Intronic
1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG + Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115391562 14:32860479-32860501 ACAGAGCCACAGAGGGAGCCAGG - Intergenic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1122859673 14:104576953-104576975 TCACTGCCACAGAGGGAGCTGGG + Intronic
1124111195 15:26790259-26790281 ACATTGCCACAGATGCTCCGCGG + Intronic
1124356153 15:28996350-28996372 ATCTTGCCAGGGATGGAGCGTGG + Intronic
1128768668 15:70266233-70266255 ACACTGGCAGAGATGGAGAGGGG - Intergenic
1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG + Intronic
1131223568 15:90605656-90605678 ACAGTGCAACAGAAAGAGCGTGG - Intronic
1131866277 15:96714100-96714122 ACATTGCCATAGATTCAGCTGGG + Intergenic
1133119377 16:3596780-3596802 AAAATGCCTCAGATGGAGCCCGG - Intronic
1134016024 16:10889051-10889073 TCATTGCCACGGATGAAGAGAGG + Intronic
1136412373 16:30084922-30084944 ACATTCCCACAGCTGGAAGGCGG - Exonic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1144720658 17:17467456-17467478 ACATGGCCTCACATGGAGCAGGG + Intergenic
1152425890 17:80218498-80218520 ACATTGCCTCTGAGGGAGCTGGG - Intronic
1157170830 18:45403579-45403601 GCAGTGGCACAGATGGAGCATGG + Intronic
1163730900 19:18948691-18948713 CCAAGGCCACAGAAGGAGCGTGG - Intergenic
1164768653 19:30791195-30791217 AAATTGCCAAAGGTGGAGTGTGG + Intergenic
1168335240 19:55593471-55593493 ACATTGCAGCAGACGGAGCAGGG + Exonic
925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG + Intergenic
929171207 2:38934681-38934703 ACAGTGCCTGAGATGGAGGGAGG - Intronic
931231726 2:60380821-60380843 ACAGCCCCACAGATGGAGCTGGG - Intergenic
932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG + Intronic
932817035 2:74870333-74870355 ACATAGCCACAGATGGCCAGTGG + Intronic
933300349 2:80533620-80533642 GCATTGCCAGAGATGGATCCTGG + Intronic
933814502 2:86054879-86054901 ACATTCCCAGAGATGAAGCAGGG + Intronic
935115688 2:100134065-100134087 ACATTTCCAAAGATAGAGAGTGG - Intronic
935312509 2:101799431-101799453 GGATTGCCACAGGTGGAGGGAGG - Intronic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
943074826 2:183180990-183181012 TCATTGCCTCAGATGGAGGTAGG - Intergenic
1168966105 20:1898951-1898973 CCTTTGCGACAGATGGAGAGGGG + Intronic
1170073394 20:12392883-12392905 ACAGAGTCTCAGATGGAGCGTGG + Intergenic
1170714339 20:18818956-18818978 ACATGGCCAAAGAAGGAGCAAGG + Intronic
1174361371 20:50030852-50030874 AGAGAGCCACAGAAGGAGCGAGG + Intergenic
1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG + Intronic
1178385763 21:32149015-32149037 ACATTGCCACTGAAGGACAGGGG + Intergenic
1180127273 21:45801042-45801064 CCATTGCCAGAGTTGGAGAGTGG - Intronic
1181849820 22:25742100-25742122 ACATTGGCCCAGAAGGAGGGTGG + Intergenic
1183348047 22:37318783-37318805 ACATTGCCAGACAGGGAGGGAGG - Intergenic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954628415 3:52035410-52035432 ATGTTCCCACAGAGGGAGCGAGG - Intergenic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
961830683 3:129621568-129621590 ACAGTGGCACAGAAGGAGTGTGG - Intergenic
963507046 3:146199383-146199405 ACCTTGCCACAGATAAAGAGTGG - Intronic
965086319 3:164103501-164103523 ACATGGCCAAAGAAGGAGCACGG - Intergenic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
967665024 3:192160908-192160930 ACTTTGACACAAATGGAGCAAGG + Intronic
968290011 3:197531929-197531951 ACACTGCCACAGGTGGAGACTGG - Intronic
969938727 4:10708829-10708851 ACAGTGTCACAGAAGGAGCACGG + Intergenic
971051254 4:22865207-22865229 ACATGGCCAAAGATGGAGTCAGG - Intergenic
971095780 4:23400197-23400219 ACATGGCCACTGCTGGAGGGCGG + Intergenic
971145704 4:23974234-23974256 ACATTGTCACAGATGGTTTGCGG - Intergenic
972588740 4:40463886-40463908 ACATTGCCATATATGATGCGTGG + Intronic
976589479 4:86834870-86834892 ACATGGCCAGAGAGGGAGCAAGG + Intronic
979752167 4:124291981-124292003 ACATGGCAAGAGAGGGAGCGGGG - Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
983737595 4:171082394-171082416 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
986650571 5:9959492-9959514 CTATTGCCAAAGATGGAGGGAGG + Intergenic
986831558 5:11585106-11585128 ACATTTCCATAGCTGGAGGGTGG + Intronic
992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG + Intergenic
995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG + Intergenic
996728526 5:126694573-126694595 ACATTTCCACACACGGAGGGAGG - Intergenic
998302791 5:141041135-141041157 ACAATGCCAGAGGTGGAGGGGGG - Intergenic
1000677034 5:164133377-164133399 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1009376364 6:62975427-62975449 ACAGTGCCACAGACTGGGCGTGG - Intergenic
1010776807 6:79896211-79896233 ACAGTGGCAGAGATGGAGCAGGG - Intergenic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1012384880 6:98668743-98668765 CCATTGCCACAGATAGTGTGTGG - Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1013315660 6:108940277-108940299 ACATGGACACACATGGAGTGAGG + Intronic
1014421056 6:121245803-121245825 ACATTCCCACAGATGAAAAGAGG + Intronic
1014558047 6:122856814-122856836 ACATGGCCACAGCAGGAGCAAGG + Intergenic
1015772499 6:136783599-136783621 ATCTTGCCCCAGGTGGAGCGGGG + Intronic
1017375274 6:153761171-153761193 ACATTCCCACAGATGAAAAGAGG + Intergenic
1017666790 6:156727002-156727024 ACATTGCAATACATGGAGTGTGG - Intergenic
1017930080 6:158944562-158944584 ACATTGAAACAGAGGGAGCATGG - Intergenic
1018886158 6:167939850-167939872 ACATTGTCACAGATAGAGTGAGG + Intronic
1019195762 6:170281784-170281806 ACATGGCCCCAGACGGGGCGTGG - Intergenic
1019215120 6:170438563-170438585 ACACGGGCACAGATGGAGGGTGG - Intergenic
1019784250 7:2964363-2964385 GCATTGCAAAAGATGGAACGTGG - Intronic
1022212191 7:28222367-28222389 ACATTTCCACATATTGAGCTGGG - Intergenic
1022735437 7:33071347-33071369 ACATGGCCAGAGAAGGAGCAGGG - Intergenic
1024526789 7:50355941-50355963 ACATCCCCACTGAAGGAGCGTGG - Intronic
1029710094 7:102294756-102294778 ACCTGGCTACAGATGGAGAGAGG - Intronic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG + Intergenic
1034410799 7:150941150-150941172 ACATTGCCAGTGAAGGAGTGGGG + Intergenic
1034953301 7:155316112-155316134 CCGTTGCCACAGATGGGGAGAGG + Intergenic
1038278521 8:26141866-26141888 ACATGGCCAGAGAGGGAGCAAGG - Intergenic
1039176873 8:34818342-34818364 ACATTGCCTCAGAGAGAGCTTGG - Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1041182207 8:55260503-55260525 ACATGGACACACATGGAGTGAGG + Intronic
1045038963 8:98202565-98202587 ACATAGCAAGAGATGGGGCGAGG - Intronic
1046405122 8:113763302-113763324 ACATTGCACCAGATGGAGTGGGG + Intergenic
1051407560 9:16755222-16755244 ACATGGCCTCAAATGGAGGGAGG + Intronic
1055638317 9:78298524-78298546 ACATCTCCACAGCTGGAGCAGGG - Intronic
1056316542 9:85395864-85395886 ACATGGCCTCAGATGGAAGGTGG + Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1192493549 X:71597554-71597576 AGAGGGCCACAGATGGAGAGAGG - Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1197765570 X:130057441-130057463 ACAATGCCACAGAGGGGGCGGGG - Exonic
1199243751 X:145578334-145578356 ACCTTGCCACAAATGCAGCTAGG - Intergenic