ID: 950182842

View in Genome Browser
Species Human (GRCh38)
Location 3:10927266-10927288
Sequence CCTGCCTGGCAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 0, 2: 1, 3: 76, 4: 660}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950182842 Original CRISPR CCTGCCTGGCAGAGGGAGGC AGG Intronic
900102143 1:966456-966478 CCCGCCTGCCCGCGGGAGGCGGG + Intergenic
900144371 1:1151474-1151496 CCTGTCTGGGACACGGAGGCCGG - Intergenic
900204363 1:1425813-1425835 CCCGCCCGGCACAGGGAGGGAGG + Intergenic
900238377 1:1603234-1603256 TTTGCCTGGCAGGGGAAGGCTGG + Intergenic
900321368 1:2085828-2085850 CCTGCCTGTGAGAGGGGAGCCGG - Intronic
900334107 1:2152819-2152841 CCGGCCAGGCAGAGAGAGGAAGG - Intronic
900724971 1:4210202-4210224 CCTGCCTGGCACAAGGCTGCAGG - Intergenic
900967837 1:5971661-5971683 GCTGCCTGGCTGAGTGAGGCGGG - Intronic
901059693 1:6466220-6466242 CCTGGCGGGCGGGGGGAGGCGGG + Exonic
901071287 1:6520021-6520043 CCTGCCAGGCAGAGAGGGGCTGG + Intronic
902403983 1:16173177-16173199 CCGGCCTGGCAGAGGAGGGGTGG + Intergenic
902709808 1:18230927-18230949 CCTGCTTGGAGGAGGGGGGCAGG - Intronic
903266363 1:22160346-22160368 CCAGCCGGACAAAGGGAGGCAGG + Intergenic
903269373 1:22178073-22178095 CCAGCCTGGCAGAGTGTGACAGG - Intergenic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903678530 1:25082000-25082022 CCCGCCTGGATGAGGGAGGCAGG + Intergenic
903769569 1:25755225-25755247 CCGGCCTGGGAGACTGAGGCAGG + Intronic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904772582 1:32888648-32888670 CTTTCCTGGGAGAGGGAGGAAGG - Intronic
905292791 1:36934243-36934265 CATGCCAGCCAGAGGGAGGGAGG - Intronic
905717143 1:40161648-40161670 ACTGGCTGGCTGAGGGCGGCGGG + Intronic
906622759 1:47297697-47297719 GCTGCTTGGGAGAGTGAGGCAGG - Intronic
907390339 1:54153962-54153984 CCTGCCTGGCTGTGGTAGCCCGG + Intronic
907516250 1:54995163-54995185 CATGCCTGGGAGAGAGAGGCCGG - Intergenic
907811407 1:57874331-57874353 GCTTCCTGGCAGGGTGAGGCAGG + Intronic
908008839 1:59754920-59754942 CCTGTCTGGAAGAGACAGGCTGG - Intronic
909932245 1:81509749-81509771 CTTGCCTGGCACAGTGAGTCAGG - Intronic
910333312 1:86100709-86100731 CCTCCCTGGCAGAGGGGGTAGGG - Intronic
912944848 1:114076392-114076414 ACTGCCTCGCAGAGGGAGGAAGG + Intergenic
915323109 1:155066870-155066892 CCTGCCAGGCAGAGGGCCCCCGG + Exonic
915328289 1:155092551-155092573 CCAGCCTCTCAGAGGCAGGCTGG - Intergenic
915471648 1:156129285-156129307 CCTGCCTGGTGGGGGGAGGTGGG + Intronic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
915839542 1:159203386-159203408 AATGCCTGGCAGAGGGTGGGGGG - Intronic
917441664 1:175074031-175074053 GCTGCATGGCAGAGAGAGGAAGG - Intronic
918070806 1:181132120-181132142 ACTGCCTGGCAGATGGAGGAGGG + Intergenic
918071940 1:181139649-181139671 CCTGCGGGGCATAAGGAGGCTGG + Intergenic
918082404 1:181217778-181217800 CCTTCCTGGAAGAGAGGGGCTGG + Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
919289897 1:195615844-195615866 CATGCCTGGGAGGTGGAGGCGGG - Intergenic
919466499 1:197926645-197926667 CTGGCCTGGCAGAGAGAGGGCGG - Intronic
919879211 1:201891241-201891263 CCTGCTTGGCAGAGTTAAGCAGG - Intronic
920068231 1:203284224-203284246 CCAGTCTAGCAGAGGAAGGCAGG - Intergenic
920226603 1:204443597-204443619 CCTGCAAGGCAGAGGGAGTCAGG + Exonic
920229284 1:204459937-204459959 CCTGCCTGGGAGTTGGGGGCAGG + Exonic
920291073 1:204923548-204923570 TCTGCCTGTCAGAGAGAAGCTGG + Intronic
920512143 1:206559262-206559284 CCTAGCTGGCAGTGAGAGGCAGG - Intronic
921251304 1:213300923-213300945 CCTGACTGCCACAGGGAGGGTGG + Intergenic
923041933 1:230325783-230325805 CCAGCCTGGCAGAAGGGGGAGGG - Intronic
923540042 1:234882063-234882085 CCTGCCTGAGGGTGGGAGGCTGG - Intergenic
923691470 1:236197744-236197766 CCTGGGTGACAGAGTGAGGCAGG - Intronic
924886414 1:248222100-248222122 GCAGCCTTGCAGAGGGAGTCTGG + Intergenic
1063139080 10:3240721-3240743 CCTCCCAGGATGAGGGAGGCAGG - Intergenic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1063382450 10:5594341-5594363 TCTGCAAGGCAGAGGGAGGGAGG - Intergenic
1064243347 10:13650159-13650181 ACTGCTTGGCATAGGGAGGTGGG + Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066227642 10:33399814-33399836 CCTACCTGGGAGACTGAGGCAGG - Intergenic
1067216874 10:44310822-44310844 CCAGCGTGGGAGAGGCAGGCAGG + Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067682840 10:48451188-48451210 CATGACTGGCAGAGCGAGCCTGG - Intronic
1068959690 10:62854071-62854093 GCTGGCTGGCAAAGGGAGCCAGG + Intronic
1069840045 10:71334047-71334069 CCTGCCTGGCAGAAAGACTCTGG + Intronic
1069863028 10:71483065-71483087 CCGTCCTGGCGGATGGAGGCAGG + Intronic
1069956300 10:72053949-72053971 GCTGCCTGGCAGAGTCAGGGAGG + Intergenic
1070652232 10:78245698-78245720 GCTCCCTGGCAGAGGGAAGAAGG + Intergenic
1070724622 10:78779599-78779621 CCTGCCTGGCATGGCGAGGAGGG + Intergenic
1070763916 10:79045562-79045584 CCTGCCTTCCTGAGTGAGGCTGG - Intergenic
1070804911 10:79265262-79265284 CCTGCCCAGCACAGGGAAGCAGG + Intronic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1073321671 10:102619674-102619696 ACTGCCTGGCAGGGGGAGGAGGG - Intronic
1073452873 10:103619896-103619918 CCTCCCTGGCAGGGCTAGGCAGG + Intronic
1074756809 10:116629790-116629812 TCTGCCTGGGAGAGAGAGTCTGG - Intronic
1074761381 10:116669799-116669821 CCTGCCTGGAGGAGGTGGGCAGG + Intronic
1075714104 10:124546020-124546042 CCAGCTTGGCAGAGGGAGGGAGG - Intronic
1075979224 10:126722590-126722612 CCTGCCAGGGAAAGCGAGGCAGG + Intergenic
1076233097 10:128838303-128838325 CCAGCCTGGCAGAGGCATCCAGG - Intergenic
1076425666 10:130365862-130365884 CCTGTCGGGCAGAGGGGGGTGGG - Intergenic
1076502696 10:130949704-130949726 GGTGCGGGGCAGAGGGAGGCTGG - Intergenic
1076600559 10:131654538-131654560 CCAGCCTCTCAGAGGGAAGCAGG - Intergenic
1076873635 10:133205429-133205451 CCTGCCTGCGAGATGGAGCCGGG - Intronic
1076900613 10:133335794-133335816 CCTCCCTGCCAGAGCGCGGCGGG - Intronic
1077017628 11:403929-403951 CCTTCGTGGCTGTGGGAGGCCGG - Exonic
1077094919 11:795230-795252 GCTGCGTGAGAGAGGGAGGCTGG - Intronic
1077170359 11:1163409-1163431 TGGGCCTGGCAGGGGGAGGCAGG - Intronic
1077232007 11:1461964-1461986 CCAGCCTGACAGAGGGGCGCTGG - Intronic
1077337507 11:2012016-2012038 CTGGTCTGGCAGAGGGAGGGCGG + Intergenic
1077347964 11:2073079-2073101 CCTGGCCGGCAGGAGGAGGCAGG - Intergenic
1077393922 11:2311996-2312018 GCTGCTTGGCAGAGCCAGGCAGG + Intronic
1077919043 11:6629807-6629829 CCTGCGTGGCCGAGCGCGGCGGG + Exonic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1078463608 11:11533900-11533922 CCTGCCTGGCAGATGGAGTAGGG + Intronic
1078623833 11:12935147-12935169 GCTACCTGGCAGAGGGACGCAGG + Intronic
1078797594 11:14608237-14608259 GCTGCCTGGGAGACTGAGGCAGG + Intronic
1078938539 11:15974703-15974725 CCAGCCTGGCAGAGGGAGAAGGG + Intronic
1079125202 11:17714077-17714099 CCTGCTTGTCTGTGGGAGGCTGG + Intergenic
1079333796 11:19553834-19553856 CCCGGCTGGCACAGAGAGGCTGG - Intronic
1080853492 11:36091490-36091512 TCTCTCTGGCAGAGGGAGGGAGG - Intronic
1081661962 11:44893883-44893905 CCTGACTGCCAGGGTGAGGCTGG - Intronic
1081831770 11:46120957-46120979 CCCCCCTGGCAGCTGGAGGCAGG + Exonic
1082766463 11:57172141-57172163 CCTCTCTGGCTGAGGCAGGCTGG - Intergenic
1083225055 11:61279835-61279857 CCTGCCTGGGAGATTGAGGTGGG - Intronic
1083299455 11:61732721-61732743 CCTGTGGGGCAGAGAGAGGCAGG + Intronic
1083783652 11:64931627-64931649 GATGCCCGCCAGAGGGAGGCTGG + Intronic
1084192033 11:67503792-67503814 CCTCCGCGGCAGAGGAAGGCGGG - Intronic
1084284399 11:68121785-68121807 CGGGCCTGGCAGGGGCAGGCAGG + Intergenic
1084315437 11:68342913-68342935 CCAGCCCAGCCGAGGGAGGCAGG - Intronic
1084455244 11:69264540-69264562 TGGGCCTGGCTGAGGGAGGCAGG + Intergenic
1084563682 11:69918067-69918089 GCTTCCTGTAAGAGGGAGGCAGG - Intergenic
1084940169 11:72608185-72608207 CCTGCCTGGAGATGGGAGGCTGG - Intronic
1085409069 11:76281060-76281082 CCTGGCTGGGAGCAGGAGGCCGG - Intergenic
1085693651 11:78686027-78686049 CCTGCCTTGGAGAGGAGGGCAGG - Intronic
1086337413 11:85812801-85812823 CCTGCCTTGCTGAGGGAAGCAGG + Intergenic
1087009182 11:93497503-93497525 GCTGCCTGGCTGAGGGTGGAGGG + Intronic
1088590703 11:111400120-111400142 CCAGCCAGTCAGTGGGAGGCTGG - Intronic
1088924195 11:114284192-114284214 TCTGCCTGGCACAGAGAGGCTGG - Intronic
1089230232 11:116967819-116967841 CCTGATGGGCACAGGGAGGCTGG - Intronic
1089329549 11:117680132-117680154 CCTGGATGGCAGAGCTAGGCTGG - Intronic
1089676819 11:120095985-120096007 CCTGCGTGGCCTGGGGAGGCTGG - Intergenic
1089713606 11:120336106-120336128 CCTACGGGGCAGAGGGAGGTGGG - Intergenic
1089774847 11:120828950-120828972 GCTGCCTGGCAGAGGCTGCCGGG - Intronic
1090235950 11:125147207-125147229 CCTGCCTGGCAGGGGAGGGAGGG - Intergenic
1090362876 11:126185598-126185620 CCTGGCCGGCACAGAGAGGCTGG + Intergenic
1090614184 11:128499982-128500004 CCTGCGTGGGAGGGAGAGGCAGG - Intronic
1090806952 11:130208783-130208805 TCTGCCAGGCAGAGGGAGACTGG - Intronic
1091320597 11:134646735-134646757 CCTGCCTGGCAGAGCAGGACAGG - Intergenic
1202820491 11_KI270721v1_random:67198-67220 CTGGTCTGGCAGAGGGAGGGCGG + Intergenic
1091559905 12:1604167-1604189 CCTGTCTGAAAGAAGGAGGCTGG + Intronic
1091776527 12:3188463-3188485 CCTGGGTGGCAGAGGAAGGGAGG + Intronic
1091878758 12:3959638-3959660 TCTGCCAGACAGTGGGAGGCAGG + Intergenic
1091918960 12:4289309-4289331 GCTGCCGGGCAGAGGCAGCCTGG - Intronic
1092493947 12:8973024-8973046 CCAGCTGGGCTGAGGGAGGCTGG + Intronic
1092508076 12:9124773-9124795 CATGAATGGCAGCGGGAGGCAGG + Intergenic
1093021371 12:14207121-14207143 GCTGCCTGGGAGACTGAGGCAGG + Intergenic
1093899897 12:24619973-24619995 CCTGTCGGGGAGTGGGAGGCTGG - Intergenic
1094486109 12:30926923-30926945 CCGGGCGGGCAGAGGGAAGCCGG + Intronic
1096602843 12:52742460-52742482 CATGAATGGCAGTGGGAGGCAGG + Intergenic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1097192759 12:57227191-57227213 CCTGGCTGGAGGAGGGAGGGGGG + Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1100166131 12:91920278-91920300 CCTGGCTGGGACAGGGATGCGGG - Intergenic
1102006027 12:109589805-109589827 CCTGCCTTTCAGAGGGCTGCAGG - Intronic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102505964 12:113384829-113384851 CCTGCCGGGCAGGGGAAGGGAGG - Exonic
1102624654 12:114225324-114225346 CCATGCTGGCACAGGGAGGCAGG - Intergenic
1102722404 12:115028676-115028698 CCTGCCTGGCTGAGGGTGTCAGG + Intergenic
1102854071 12:116277858-116277880 CCGGCCGGGAAGAGGGAGGGAGG + Intergenic
1102910878 12:116713054-116713076 CCTGGCTGGAAGTGGGAGCCGGG - Exonic
1103642233 12:122360916-122360938 CCTGCCTGGGAAGTGGAGGCAGG + Intronic
1103688700 12:122753016-122753038 GCTGCCTGGCGGAAGGGGGCCGG + Intronic
1103902187 12:124309074-124309096 CCTGCATGCCAGGGGGAGGCAGG + Intronic
1103936377 12:124479746-124479768 GATGCCAGGCAGAGGGAGGAGGG + Intronic
1104045711 12:125161121-125161143 CCAGCCTTGCAAAGGAAGGCGGG - Intergenic
1104047643 12:125174330-125174352 CATACCTGGCCCAGGGAGGCTGG + Intergenic
1104288062 12:127443447-127443469 ACACCCTGGCAGAGGGAGGAAGG + Intergenic
1104717774 12:131027733-131027755 CATGGCTGGCAGGGGGATGCAGG - Intronic
1104755961 12:131269507-131269529 CCCACCTGACACAGGGAGGCTGG + Intergenic
1104777752 12:131401174-131401196 CCCACCTGACACAGGGAGGCTGG - Intergenic
1104910091 12:132236200-132236222 GATGCCTGGGGGAGGGAGGCTGG - Intronic
1104971498 12:132532830-132532852 CATGCCTGGGACAGGGAGGCTGG + Intronic
1105836361 13:24215768-24215790 TCTGCTTGGCAGAGGCAGACTGG - Intronic
1106027801 13:25971884-25971906 CTTGGCTGGCACAGGAAGGCAGG - Intronic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1106582816 13:31032373-31032395 ACTGCCTGGCAGAGGGGGCAGGG - Intergenic
1107432380 13:40351715-40351737 CCTGCCTGGCTGAAGGACACAGG + Intergenic
1107436851 13:40387988-40388010 TCTGGCTGGAGGAGGGAGGCAGG + Intergenic
1107658697 13:42617034-42617056 CCTGGCTCCCAGAGAGAGGCAGG + Intergenic
1107682377 13:42865217-42865239 TCTGGCTACCAGAGGGAGGCTGG - Intergenic
1107731342 13:43352109-43352131 TCAGCCTGCCAGAGGGAGGAAGG - Intronic
1108524934 13:51278558-51278580 CCTGGGTGGCAGCAGGAGGCAGG - Intronic
1109527470 13:63595952-63595974 CCAGCATGGCCGAGTGAGGCTGG - Intergenic
1110433634 13:75455493-75455515 GCTGCCTGGGAGACTGAGGCAGG + Intronic
1110468235 13:75827652-75827674 TCTGCATGGCAGACGGAGGGGGG - Intronic
1110803129 13:79723666-79723688 CCCTTCTGGCAGAGGGAAGCTGG + Intergenic
1111115808 13:83775615-83775637 CCTACTTGGCAGACTGAGGCAGG - Intergenic
1111943720 13:94641266-94641288 CATTCCTGGCAGAGGAAGGTTGG + Intergenic
1112621564 13:101058781-101058803 CTCGCATGGGAGAGGGAGGCAGG - Intronic
1113554143 13:111217788-111217810 CCCGTGTGGAAGAGGGAGGCTGG + Exonic
1113572864 13:111370981-111371003 CCTGCTCGGAGGAGGGAGGCGGG - Intergenic
1113924963 13:113936436-113936458 CTTGCCCGGAAGAGGGAGGAAGG - Intergenic
1114265233 14:21069754-21069776 CCTGCCTAGCAGAGAGCGGAGGG - Intronic
1116116680 14:40661437-40661459 CCTGCCTGCAAGAAGCAGGCTGG - Intergenic
1116824628 14:49660637-49660659 TCGGCCTCCCAGAGGGAGGCTGG - Intronic
1117913153 14:60653194-60653216 TCAGCCAGGCAGAGCGAGGCAGG - Intronic
1117913158 14:60653204-60653226 TCTGCCTGGCTGAGGGGAGCAGG + Intronic
1117965727 14:61205306-61205328 CCTGACTGACAGAGTGGGGCAGG - Intronic
1118238225 14:64031258-64031280 TCTGCCAGGCAGAGAGAAGCAGG + Exonic
1118319812 14:64746574-64746596 CCTGCCTATCGGAGGGAGCCAGG - Exonic
1119678126 14:76571596-76571618 CCAGGCTGGCAGATGGAGACTGG + Intergenic
1120188696 14:81420517-81420539 CCTGCCTTGGAGAGAGAGACAGG + Intronic
1120996791 14:90423581-90423603 CCTGCCTGGAAGCCAGAGGCAGG - Intergenic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1121347897 14:93149665-93149687 CCTGCCGGGGTGAGGGTGGCGGG - Intergenic
1121732301 14:96195110-96195132 CCTGCCTGGCAGGGCCTGGCTGG + Intergenic
1121932507 14:97985497-97985519 GCTGCCTGGAAGATGGAGGAAGG - Intergenic
1122254704 14:100468261-100468283 CTTGCGTGGCAGAGGGAGAGGGG + Intronic
1122261944 14:100528740-100528762 CCTGCCTGCCACAGGGACACAGG + Intronic
1122267633 14:100554082-100554104 CCTGCCGGGCTGGGGGAGGACGG + Intronic
1122570255 14:102693564-102693586 CCTGCCTGTGAGAGGGAGTTGGG - Intronic
1122619809 14:103049286-103049308 CCTGCTTGGCTGAAGGAGGGTGG + Intronic
1122854902 14:104555274-104555296 CCAGGCTGGGAGGGGGAGGCAGG + Intronic
1122856101 14:104560987-104561009 CCTGCCTGGTGGAGGGAAGCAGG - Intronic
1122924742 14:104894418-104894440 CCAGCCAGGCAAAGGCAGGCTGG - Intronic
1122992082 14:105241231-105241253 CCTGCCTGCCTGGGGGATGCTGG - Intronic
1123099277 14:105785137-105785159 CCTACTTGGAAGAGTGAGGCAGG - Intergenic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1124212346 15:27774275-27774297 CCTCACTGCCAGAGAGAGGCGGG - Intronic
1124212708 15:27776573-27776595 CCTGCCTGCCATGGGGAGGGCGG - Intronic
1124389553 15:29241930-29241952 GCTGCCTGGAAGAGTGAGGTGGG + Intronic
1124461252 15:29894345-29894367 GCTACCTGGGAGACGGAGGCAGG + Intronic
1124634687 15:31357526-31357548 CCTGCCTGGGGGAGGGAGGGTGG + Intronic
1124658405 15:31526457-31526479 CCTGACTGGCAGAGGGGAGCCGG + Intronic
1125563444 15:40656858-40656880 CCTGGGTGACAGAGGGAGACAGG + Intronic
1125610142 15:40964151-40964173 TATGCCAGGCAGAGGGTGGCAGG + Intergenic
1126878286 15:53067476-53067498 GCTGATTGGCAGAAGGAGGCTGG + Intergenic
1127068269 15:55262748-55262770 CCAGCCTGGACAAGGGAGGCTGG - Intronic
1127480307 15:59371969-59371991 CCCGCCTGGCAGCGGCACGCGGG - Intronic
1127902764 15:63353437-63353459 CAGACCTGGCAAAGGGAGGCCGG - Intronic
1128089845 15:64911970-64911992 TCTGCCTGGAGGAGGGAGGGGGG + Intronic
1128109310 15:65066910-65066932 CCTGGCTGGCTGAAGGAGGGAGG - Intronic
1128153206 15:65376520-65376542 CCTCCCTGGCTGAGGGAGATGGG + Intronic
1128501042 15:68227954-68227976 GCTGCCTGGAAGAGGGGAGCTGG + Intronic
1128737686 15:70062529-70062551 CCTGCCAGCCAGAGGCGGGCTGG - Intronic
1128775855 15:70319807-70319829 CCAGCATGGCAGAGGGAAGGAGG - Intergenic
1129257230 15:74340533-74340555 CCTGCCAGGAGGAGGGAGGTGGG - Intronic
1129676252 15:77633602-77633624 CCTGTCCAGCAGAGGGCGGCAGG + Intronic
1129708795 15:77809683-77809705 CCTGCCTGGCAGGGGGGTGAAGG + Intronic
1129892655 15:79081760-79081782 CCTCCCTGGCACTGGGAGGATGG - Intronic
1130889822 15:88124302-88124324 TCTGCCTGGGAGAGGGGAGCAGG + Intronic
1130954946 15:88621213-88621235 CCTGCCTGGCAGCGGGGAGGCGG - Intergenic
1131383182 15:91981220-91981242 CCTGGCTGGCAGAGCAAGGAGGG - Intronic
1131558529 15:93419777-93419799 TCTGCCTGGCAGGGGGAAGGTGG + Intergenic
1131783249 15:95883080-95883102 CCAGCTTGGCTGAGGGAGGGTGG - Intergenic
1132415390 15:101615365-101615387 CCTGAGTAGAAGAGGGAGGCTGG + Intergenic
1202964830 15_KI270727v1_random:166603-166625 CCCTCCTGGCACAGGGAGGGAGG - Intergenic
1132550348 16:551434-551456 CCGGCCTGGCTGAGGGTGGGTGG + Intronic
1132738505 16:1399114-1399136 CTTGCCTGGCAGAGGGGCCCCGG + Intronic
1132818273 16:1846342-1846364 CCTGACTGTCAGAGAAAGGCAGG + Intronic
1132848212 16:2010504-2010526 TCTGGATGGCAGAGGGAGGGAGG - Intronic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133227069 16:4346123-4346145 GCTGCAGGGCAGAGGGGGGCTGG + Intronic
1133272821 16:4618994-4619016 CTTGCCTTGCATAGGGAGGCAGG + Intronic
1133383998 16:5354146-5354168 CCTGCCTGGCTCAAGGAGACAGG - Intergenic
1134099340 16:11440683-11440705 GCTCCCTTGCCGAGGGAGGCCGG - Intronic
1134102240 16:11460634-11460656 GCTGCCTGGCAGAGGAGGGCAGG - Intronic
1134174012 16:11991416-11991438 CATGCCAGGCAGGGGGAGACAGG + Intronic
1134248237 16:12555796-12555818 CCTTTCTTGCAGAGGCAGGCAGG - Intronic
1134277715 16:12791624-12791646 CCCACCTGGGAGAAGGAGGCTGG + Intronic
1135220542 16:20611139-20611161 TCTGCCTGGCTGAGAGAGGCTGG + Intronic
1135407162 16:22206662-22206684 CCTGTCTGCCCGAGGGAGGTAGG + Exonic
1136186597 16:28592136-28592158 CATGCCTGGGGGAGGAAGGCAGG + Exonic
1136189218 16:28605929-28605951 CATGCCTGGGGGAGGAAGGCAGG + Exonic
1136317814 16:29464445-29464467 CATGCCTGGGGGAGGAAGGCAGG - Exonic
1136432389 16:30203790-30203812 CATGCCTGGGGGAGGAAGGCAGG - Exonic
1136617535 16:31407780-31407802 CCTGCCTGGCAGTGGGTCCCTGG - Exonic
1137029263 16:35506804-35506826 GCTGCCTGGAAGGGCGAGGCAGG + Intergenic
1137756479 16:50906364-50906386 CCTCTCTGTCACAGGGAGGCTGG + Intergenic
1138510945 16:57508153-57508175 GCTGCCTGGTAGAGTCAGGCTGG + Intergenic
1138656591 16:58495112-58495134 CCTGCCTAACAGAGAGATGCTGG + Intronic
1138677825 16:58664962-58664984 CCTGCTTGGTAGAGGGAGCATGG + Intergenic
1139266413 16:65643529-65643551 TCTGCCAGGCAGAGGGATACAGG - Intergenic
1139344827 16:66296245-66296267 CCTGCCTGAGAGGAGGAGGCAGG + Intergenic
1139469689 16:67171473-67171495 CCTGGCTGGTGGAGGGAAGCTGG + Intronic
1139493739 16:67301382-67301404 CGTGCCTGGAAGAGGAAGGATGG + Intronic
1139543812 16:67639203-67639225 CCTGCCTGCTTGAGGGAGGCTGG + Intergenic
1139670102 16:68486960-68486982 CCTGGCTGACAAAGGGAGGAGGG - Intergenic
1139891623 16:70256766-70256788 CCTGCCTGCCAGAGGCCTGCAGG + Intronic
1140187093 16:72784215-72784237 TCTGCCTCACAGAGGGAGGATGG + Exonic
1140553244 16:75890912-75890934 CCTGTCAGGCAGAGGGGTGCAGG - Intergenic
1140759017 16:78094639-78094661 GGGGCCTGTCAGAGGGAGGCAGG - Intergenic
1141088871 16:81116516-81116538 CCTGGGTGACAGAGGGAGACTGG - Intergenic
1141732258 16:85830392-85830414 GCTTCCTGGGAGAGGCAGGCTGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141883884 16:86878782-86878804 CCTGTCGGACAGATGGAGGCTGG - Intergenic
1142202710 16:88768701-88768723 CCTTCCTGGCAGTGAGGGGCTGG + Intronic
1142274621 16:89111284-89111306 GCTGCCTGGCAGAGAAAGGCAGG - Intronic
1142373209 16:89694348-89694370 CCTCCCTGGGAGTGGGAGGCTGG - Intronic
1142426040 16:90002858-90002880 CCCTTCTGGCAGAGGGAGGGAGG - Intergenic
1142704582 17:1686466-1686488 CCTGGGTGACAGAGCGAGGCTGG + Intergenic
1142874536 17:2843636-2843658 CCTGCAAGGTAGTGGGAGGCAGG - Intronic
1143033361 17:3980531-3980553 CCTGCCAGGCCCAGCGAGGCTGG + Intergenic
1143135887 17:4711991-4712013 CCAGCCTGGCAGGAGGTGGCTGG + Intronic
1143544380 17:7587973-7587995 CCAGCCGGGCTGAGGGAGGGAGG - Exonic
1143561455 17:7697977-7697999 CCTGTTTGGGAGAGTGAGGCAGG - Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144033439 17:11342339-11342361 GGTGGCAGGCAGAGGGAGGCAGG + Intronic
1144685879 17:17226080-17226102 CCAGCATTGCACAGGGAGGCAGG - Intronic
1144780729 17:17807223-17807245 CCTGGCTGGCAGAGTCACGCTGG - Intronic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1145217938 17:21066256-21066278 AATGCCTGGCAGAAGGGGGCTGG - Intergenic
1146066686 17:29641372-29641394 CCTGCCTGGAAGGGGGTGGGAGG - Intronic
1146256141 17:31392261-31392283 CCTGCATGGCCGAGGAAGGAAGG - Intronic
1146323433 17:31865128-31865150 CCTGCCTGGGAGGCTGAGGCAGG - Intronic
1146524217 17:33552278-33552300 CCTGCCAGGCTGAGTGGGGCTGG + Intronic
1147184619 17:38706356-38706378 CCTGCCTGGCACAGGCAGCCGGG + Intronic
1147608607 17:41788054-41788076 GCTGCCTGGGAGACTGAGGCAGG + Intergenic
1147628259 17:41913896-41913918 CCTGTCTGGGAGAGAGAAGCTGG + Exonic
1147649516 17:42054006-42054028 CCTTCCTGGCAAAGAGAGACAGG - Intronic
1147752495 17:42744865-42744887 CCTGCCTGGCCGGGGGTAGCAGG - Intronic
1147889186 17:43704962-43704984 CTTGCGGGGTAGAGGGAGGCTGG - Intergenic
1147952016 17:44112652-44112674 CCTGACTGGCAGAAGCTGGCTGG - Intronic
1148071846 17:44913229-44913251 GCTGCCTGGAGGAGGCAGGCTGG + Intronic
1148844124 17:50518751-50518773 CCTTGCTGCCAGATGGAGGCCGG - Intronic
1148853283 17:50565066-50565088 CCATCCTGGCTGAGGCAGGCAGG - Intronic
1149441771 17:56680124-56680146 GCTTCCTGGCATAGGGTGGCGGG - Intergenic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1151247381 17:72805292-72805314 TCTGCCTGGAGGTGGGAGGCTGG - Intronic
1151479348 17:74361249-74361271 GGAGCCTCGCAGAGGGAGGCGGG + Intronic
1151598661 17:75093369-75093391 CCAGCCTGGCAGGAGGTGGCAGG - Intronic
1151681155 17:75623594-75623616 CCTGTGTGACAGAGGGAGACGGG + Intergenic
1152029128 17:77830828-77830850 CCTGCCTGGGACAGGGAAGCAGG - Intergenic
1152110864 17:78357256-78357278 CCTGCCTGGGTGGGGGAGGCTGG - Exonic
1152185744 17:78855443-78855465 AGTGCCTGGCAGAGGGAGGATGG + Exonic
1152230388 17:79111363-79111385 CCAGCCAGGTAGAGGGAGACGGG - Intronic
1152555377 17:81050305-81050327 CCTCTCTTGCAGATGGAGGCAGG + Intronic
1152563216 17:81088991-81089013 GAGGCCTGGCAGTGGGAGGCAGG - Intronic
1152590517 17:81209271-81209293 CACCCCTGGCAGAGGGAGGGCGG + Intronic
1152623901 17:81379706-81379728 CCTGCTGGTAAGAGGGAGGCAGG - Intergenic
1152681836 17:81672481-81672503 CCTGCCAGGCTGAGGGAGAGAGG - Exonic
1153332928 18:3892318-3892340 GCTGTCTGGCAGATGGACGCCGG - Intronic
1153777806 18:8469042-8469064 CTTCCCTGACAGAGGCAGGCAGG + Intergenic
1153811942 18:8759855-8759877 ACGTCCTGGCAGAGGGAGGGTGG + Intronic
1156034773 18:32753991-32754013 CCTGCCTGCAAGTGGGATGCAGG + Intronic
1156350182 18:36296827-36296849 CCCGCCTGGCAGGGGCGGGCAGG + Intergenic
1156509211 18:37621376-37621398 TATGCCTGGCCGAGGGAGGATGG + Intergenic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1158434967 18:57428887-57428909 CCCGGCTGGAAGAGGGACGCGGG - Intergenic
1158679551 18:59554782-59554804 CCTGTCTGGCTGGAGGAGGCTGG - Intronic
1158695206 18:59697416-59697438 CCTGCCGGGAAGAGGGAAGGCGG - Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160041547 18:75350062-75350084 CCTGCCAGCCCGAGTGAGGCGGG - Intergenic
1160340032 18:78081904-78081926 CCTGTGAGGCAGTGGGAGGCGGG + Intergenic
1160486570 18:79298921-79298943 ACTGCCTTGCTCAGGGAGGCTGG - Intronic
1160909325 19:1467591-1467613 CCTGTCTGGCAGAGGTGGGGCGG - Exonic
1160973278 19:1779895-1779917 CCCGCCTGGCTGGGGCAGGCAGG - Exonic
1161287203 19:3474815-3474837 ACTGCCTGGAAGAGGCAGCCAGG + Exonic
1161320681 19:3639459-3639481 CCAGCCTGGCTGATGGAGCCAGG - Intronic
1161552306 19:4920663-4920685 GCTGCTTGGCAGACTGAGGCTGG - Intronic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1161915305 19:7223969-7223991 CCTGGGTGGCAGAGCGAGACTGG - Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162418559 19:10552863-10552885 CCTGGCGGGAAGAGGGAGACAGG - Exonic
1162456637 19:10788907-10788929 ACTGCCTGGCAGAGGGGGTGGGG - Intronic
1162458932 19:10802980-10803002 CCTTCCTGCCTGAGGCAGGCCGG + Intronic
1162563375 19:11431010-11431032 CCTGCCTGCCAGAGGGTGACCGG - Exonic
1162745118 19:12793703-12793725 CCTGCCCGGCAGAGCGGGGGAGG - Intronic
1162810732 19:13163171-13163193 CCTGCCCGCCCCAGGGAGGCGGG + Intergenic
1163640846 19:18461193-18461215 CGTGCCTGGCAGAGCCTGGCAGG - Intronic
1163819377 19:19487397-19487419 CCTGCAAGGCAGGGGGAGGGAGG + Intronic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1163890883 19:20011923-20011945 GCTACCTGGGAGAGTGAGGCAGG + Intronic
1164005329 19:21143053-21143075 ACTGCAAGCCAGAGGGAGGCTGG - Intronic
1164902959 19:31943597-31943619 CCAGCCCGGCAGAGGGAAGGTGG + Intergenic
1165152950 19:33771699-33771721 CTGGCCTGGGAGAGGGTGGCGGG - Intronic
1165318542 19:35072399-35072421 CCTGCTCAGCAGAGAGAGGCTGG - Intergenic
1166014042 19:39966613-39966635 CCTGGGTGACAGAGGGAGACTGG + Intergenic
1166031453 19:40133617-40133639 ACAGCCTGGCAGAGAGGGGCTGG + Intergenic
1166055072 19:40283768-40283790 CCAGCCTGGCCCAGGGAGGAAGG - Intronic
1166749829 19:45159467-45159489 CCTGGCTGGCCCAGGGAGGCCGG + Intronic
1166873919 19:45885964-45885986 CCTGCCTTCGCGAGGGAGGCGGG - Exonic
1167065351 19:47181588-47181610 GCTACCTGGGAGGGGGAGGCAGG - Intronic
1167119529 19:47508232-47508254 CCACCCTGGCACAGGGAGCCGGG + Intronic
1167471455 19:49678161-49678183 CCTGGCGGGCGGAGGGAGGAGGG + Intronic
1168236894 19:55069206-55069228 CCAGCCTGGCAGGAGGAGGAGGG - Intronic
1168290236 19:55354063-55354085 CCTCCAGGGGAGAGGGAGGCGGG - Exonic
925021229 2:569908-569930 CTTGGCTGGCTGTGGGAGGCTGG - Intergenic
925107655 2:1306661-1306683 ACACCCTGGCCGAGGGAGGCTGG - Intronic
925114784 2:1369590-1369612 ACTGCCAGGAACAGGGAGGCTGG - Intergenic
925116153 2:1379690-1379712 CCTGCCAGGAGGAGGGAGCCTGG - Intronic
925175886 2:1783319-1783341 CCTGCCTGGCTGACAGAGGGAGG - Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925286479 2:2719402-2719424 CCTTCCTCACAGAGGGAGGCAGG - Intergenic
926006559 2:9377570-9377592 CCTGCCTGGCAGCTGAAGGCTGG + Intronic
927156963 2:20226010-20226032 CCTGCCTGCCAGATGTGGGCAGG - Intergenic
927177459 2:20420678-20420700 GCTGCCTGGGAGACTGAGGCAGG + Intergenic
927493777 2:23538505-23538527 CCTGTATGGCAGAGAGAGGCTGG - Intronic
927711954 2:25331781-25331803 CCAGGCTTGCAGAAGGAGGCTGG - Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928638316 2:33270621-33270643 CCTGCCTGGCAAAGGATGGAAGG + Intronic
929828612 2:45329680-45329702 CCTGCATGGCTGAGCCAGGCAGG + Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
932214040 2:69954816-69954838 ACAGTCTGGGAGAGGGAGGCAGG - Intergenic
932331397 2:70900351-70900373 CAAGCCCGGCAGAGGGAGACTGG - Intergenic
932634449 2:73376160-73376182 CTTACATGGCAGAGGGAGGGAGG - Intergenic
933787845 2:85858189-85858211 CCTGACTGGAAGATGGAGGCTGG - Intronic
933804465 2:85988027-85988049 ACTGCCGGGCAGAGGGAGGATGG + Intergenic
934560763 2:95312212-95312234 TCTGCCTGCCAGAGAGAGACGGG - Intronic
935729586 2:106054469-106054491 CCTGCCTGCCTGAGGTACGCTGG - Intergenic
936525188 2:113236563-113236585 CCTCCCTGGCAGGTGGAGGGCGG - Intronic
936731509 2:115386663-115386685 CCTTCCTGGTAGAGAGAGGAGGG + Intronic
936839714 2:116754601-116754623 CCTCCCCGGGACAGGGAGGCCGG + Intergenic
936947217 2:117941624-117941646 CCTGCCTGGCAGGGTGGAGCTGG - Intronic
937045417 2:118848656-118848678 CTTCCCTGGCAGTGGGAGTCCGG + Intergenic
937111109 2:119367608-119367630 CCGGATTGGCAGAGGCAGGCGGG - Exonic
937144189 2:119628106-119628128 CCCACCTGGCCCAGGGAGGCAGG + Intronic
937868377 2:126770677-126770699 CCTGCCTGGCTGAGCGCTGCAGG - Intergenic
937917353 2:127105749-127105771 CAGGCCTGGCAGGGGAAGGCCGG + Intronic
937923670 2:127151154-127151176 ACTGCCTGGCTGAGGGTTGCAGG - Intergenic
938278813 2:130050665-130050687 CCTGCCTCTCAGAGGGTGGGTGG - Intergenic
938411585 2:131069103-131069125 ACTGCCTAGCAGAGGCAGGGTGG - Intronic
939710928 2:145519283-145519305 CCTGTCTGGGAGTGGGAGGCTGG - Intergenic
939782393 2:146465143-146465165 CCTGTCTGGCTAAGGGAGGTAGG + Intergenic
941648116 2:168063930-168063952 CCTGCAATGCAGAGGAAGGCGGG + Intronic
943952960 2:194154619-194154641 GCTGTCTGGCAGAATGAGGCAGG + Intergenic
944038726 2:195330180-195330202 CCTTCATGGCTCAGGGAGGCTGG - Intergenic
944962481 2:204890718-204890740 CCTGCTAGCCACAGGGAGGCAGG + Intronic
945039323 2:205730907-205730929 GCTGCCTGGCTAGGGGAGGCTGG - Intronic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946333017 2:219021121-219021143 ACTGCCTGGCATAGAGAGTCGGG - Intronic
946409811 2:219510358-219510380 CCTGAGTGGCAGAGACAGGCTGG - Intergenic
946410600 2:219513452-219513474 GGTGCCTGGCAGAGTGGGGCAGG - Intergenic
946848217 2:223879896-223879918 TCTGTCTGGCAGAGTGAGTCTGG - Intronic
947721049 2:232369500-232369522 GCTGCCTGGCAGATTGATGCTGG + Intergenic
947795000 2:232889079-232889101 GCTGCCAGGCAGAGGCGGGCAGG - Intronic
947907614 2:233776836-233776858 CCTGGCTGACAGAGTGTGGCAGG + Intronic
947919125 2:233854328-233854350 CCTGCGTGTCGGAGTGAGGCTGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948162016 2:235832870-235832892 CCTAGCTGCCAGAAGGAGGCTGG + Intronic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948989889 2:241548393-241548415 CGGGCCTGGCTGTGGGAGGCAGG - Intergenic
949049146 2:241887950-241887972 CCAGCATGGCGGAGAGAGGCAGG - Intergenic
1168849954 20:969677-969699 GCTGCCTGGCACAAGAAGGCTGG + Intronic
1168862427 20:1055338-1055360 CCAGGCTGGCAGAGCAAGGCTGG - Intergenic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169075187 20:2755838-2755860 CCTTCCTGCCACAGTGAGGCAGG - Intronic
1169141678 20:3230344-3230366 TCTTCCTGGCAGGGGGAGGCAGG - Intronic
1169417416 20:5429383-5429405 CCTGACTGGGAGAAAGAGGCAGG - Intergenic
1169909779 20:10637851-10637873 TCTGCCTGACAGAGGGATGGAGG - Exonic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1171181170 20:23091733-23091755 CCAGCCTGGAAGATGGAGCCAGG + Intergenic
1171978245 20:31608774-31608796 CGGGCCTCGCAGAGGGAGGGGGG + Intergenic
1172204834 20:33155880-33155902 CCTGCCCTGAAGAGGGAGGCAGG - Intergenic
1172271396 20:33657533-33657555 CCTGCCTGGCTGAGCGACCCAGG - Exonic
1172802306 20:37584742-37584764 TCTGCCTGATAGAGGGAAGCTGG + Intergenic
1174558016 20:51410096-51410118 CCTACCTGGCAGGCTGAGGCAGG + Intronic
1174578394 20:51553766-51553788 CCTCCCTGGCAGAGGGATGGCGG - Intronic
1175169796 20:57072198-57072220 CCTGCCTGGCAGTGGGAGAAGGG - Intergenic
1175569699 20:60009550-60009572 CCTGCCCCGCAGAGGGAGGAGGG - Intronic
1175978748 20:62726581-62726603 CCTGCCTGGGAGGCTGAGGCAGG + Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176257735 20:64160886-64160908 CCTGCCAGGCAGATCCAGGCAGG - Intronic
1178493614 21:33070074-33070096 CCTGCGGGGCAGCGGGTGGCGGG - Intergenic
1178881853 21:36456131-36456153 TCTGCCTGGCAGTGGGGGACAGG + Intergenic
1178892684 21:36533234-36533256 CCAGCCAGGCAGAGAGTGGCTGG + Intronic
1179012198 21:37564457-37564479 TCTTCCTGGCAGAAGGTGGCAGG + Intergenic
1179189240 21:39108841-39108863 CCTCCCTGGCAGATGAGGGCAGG + Intergenic
1179922147 21:44513216-44513238 ACAGCCTGGCATAGGGAGGAGGG - Intronic
1179926832 21:44539369-44539391 CTGGCCTGGCAGGAGGAGGCAGG + Exonic
1180116181 21:45706698-45706720 CTAGCCAGGCAGAGGGAGGCAGG + Intronic
1180147340 21:45928757-45928779 CCTGCCTGGCTGTGGGTCGCAGG + Intronic
1180170301 21:46054982-46055004 TGTGCAGGGCAGAGGGAGGCAGG - Intergenic
1180170339 21:46055091-46055113 TGTGCGGGGCAGAGGGAGGCAGG - Intergenic
1180259565 21:46659652-46659674 CTTGCCTGGCAGTGGCAGGGAGG + Intronic
1180675182 22:17581657-17581679 CTAGCCAGGCAGAGAGAGGCAGG - Intronic
1180710027 22:17833148-17833170 CCTGCCCTGTGGAGGGAGGCAGG + Intronic
1180853358 22:19032385-19032407 CCAGCAGGGCACAGGGAGGCTGG - Intergenic
1181345798 22:22219806-22219828 CCAGCCTGGAAGAGGGAACCTGG - Intergenic
1181562817 22:23715504-23715526 ACTGCCTGTCACAGGGAGGAAGG + Intergenic
1181580990 22:23827923-23827945 CCTGCCTGGGGAAAGGAGGCTGG + Intronic
1182074365 22:27484949-27484971 CCTGGATGGCAGAGCAAGGCTGG - Intergenic
1182102860 22:27670149-27670171 GGTGCCTGGCACAGGTAGGCAGG - Intergenic
1182274994 22:29182492-29182514 CCTGGGTGGCAGAGTGAGACGGG + Intergenic
1182431606 22:30302172-30302194 CCTGCCTGCCTTAGGGAGGATGG + Intronic
1182512508 22:30829089-30829111 ACTGCCTGGCTGGGGGAGCCTGG - Intronic
1182570199 22:31231511-31231533 CCTGCCTGACAGAGGAAGGAAGG + Intronic
1182684057 22:32107160-32107182 CCTGCCTGCCCCAGGGAGGCAGG - Intronic
1183149953 22:36029078-36029100 GCTGGCTGCCCGAGGGAGGCCGG + Intergenic
1183191116 22:36322581-36322603 CCTGCCTGGAAGGGGGACGATGG + Intronic
1183639386 22:39083894-39083916 CCTGCCTGGATGCGGGTGGCTGG - Intronic
1183690034 22:39383213-39383235 TCTGCCTCCCATAGGGAGGCTGG - Exonic
1183733709 22:39631996-39632018 CCAGCTGGGCAGAGTGAGGCGGG + Intronic
1183939599 22:41285931-41285953 CCTGCCTGGAACAGGGGTGCGGG - Intronic
1183948683 22:41340716-41340738 CCTGCCAGGCAGAGGAAGCAGGG + Intronic
1184036541 22:41920734-41920756 CCTGCCTGGTAGCCAGAGGCTGG - Intergenic
1184043458 22:41957968-41957990 CCCCCAAGGCAGAGGGAGGCCGG + Intergenic
1184602804 22:45553376-45553398 CCTGCGTGGCAGGGGGGGACGGG + Intronic
1185150342 22:49160589-49160611 CACGCCTGGCGGGGGGAGGCAGG - Intergenic
1185190466 22:49433096-49433118 CCTGCCGGGGAGAGGGAGTTGGG + Intronic
949885641 3:8691422-8691444 GCTGCTTGGGAGATGGAGGCAGG - Intronic
950110361 3:10414772-10414794 GCTGCCTGGAAGAGGGAGGGAGG - Intronic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
950459871 3:13114959-13114981 CCTGCGTGGGTGAGTGAGGCAGG + Intergenic
950474029 3:13204486-13204508 CCAGCCTAGAAGATGGAGGCCGG + Intergenic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
950578054 3:13844909-13844931 TCTGCCGGGAAGAGGGAGGGAGG - Intronic
950805737 3:15601716-15601738 CCAGAATGCCAGAGGGAGGCGGG + Exonic
950880229 3:16317345-16317367 ACTGCCTGGCTGGGGGATGCTGG - Intronic
950954900 3:17041830-17041852 GCTACCTGGGAGATGGAGGCTGG + Intronic
951268877 3:20601940-20601962 CCTGCCTGGCAGAGGGCGTGGGG + Intergenic
952408363 3:33025830-33025852 CCTGCCTGGCCCCGTGAGGCTGG - Intronic
954106299 3:48411484-48411506 AGTGCCTGCCAGAGTGAGGCTGG + Intronic
954362271 3:50128387-50128409 CCTGCTTGGCAGAGCTGGGCTGG - Intergenic
954415409 3:50391036-50391058 CTGGCTTGGCAGAGGCAGGCAGG + Intronic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954450889 3:50571137-50571159 CCTGTCTGGCCCAGGGAGGAGGG + Exonic
954580320 3:51699689-51699711 TATGCTTGGCAGAGGGAGGAAGG + Intronic
954703547 3:52465784-52465806 CCTGCCTGTGAGCTGGAGGCTGG + Intronic
954748551 3:52800803-52800825 GAGCCCTGGCAGAGGGAGGCAGG - Intronic
954866993 3:53738084-53738106 CCCGACCAGCAGAGGGAGGCTGG + Intronic
956910398 3:73810153-73810175 CCTACCTGCCAGAGGGTGGCGGG + Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
961321444 3:126079096-126079118 CCTTTCTGGCAGAGGGAGCTGGG - Intronic
961457186 3:127030070-127030092 CCTGGCTGGCAGATGGGGGCAGG + Intronic
961512785 3:127413276-127413298 TCTCCCTGGCAGAGGGTGACAGG - Intergenic
961648395 3:128404922-128404944 TCCGCCTGCCAGAGGGAGACCGG + Intronic
961648857 3:128407559-128407581 CCTGCCTGCCAAAGGGAGCCAGG + Intronic
961773185 3:129265115-129265137 CCTGGGTGACAGATGGAGGCCGG - Intronic
961831789 3:129626868-129626890 CCCGCCCCGCAGAGAGAGGCCGG + Intergenic
962853766 3:139326812-139326834 CCTGGCTGGCAGTGGGACACAGG + Intronic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
963651567 3:147987681-147987703 CCTGTGTGGCAGAGTGAGGTTGG - Intergenic
965941164 3:174183231-174183253 TCTGCCTGGCAGGAGAAGGCAGG - Intronic
967231435 3:187341204-187341226 CCTGTCAGGCAGAGGGAGAGAGG - Intergenic
967852682 3:194093950-194093972 CCTGCGTGGCAGTGTGAGGCAGG + Intergenic
968001492 3:195209717-195209739 CCCGCCAGGCAAGGGGAGGCCGG + Intronic
968130711 3:196191352-196191374 CCTGCCAGGAAAAGGCAGGCAGG + Intergenic
968540989 4:1168329-1168351 CGTGCACGGCAGAGTGAGGCGGG - Intronic
968554233 4:1239247-1239269 CCTGCCTGGCACGGGGCGGTCGG - Intronic
968582548 4:1401801-1401823 CCTGCCTCACAGAGGGAGCTTGG - Intergenic
968725895 4:2247673-2247695 GTTCCCTGACAGAGGGAGGCAGG + Exonic
968810554 4:2797821-2797843 CCTGCCCAGGAGTGGGAGGCTGG - Intronic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
969515972 4:7648464-7648486 ACTCCCAGGCAGAGGAAGGCGGG - Intronic
970137212 4:12938007-12938029 GCTGCCTGGCAGACAAAGGCAGG - Intergenic
970424157 4:15930962-15930984 CCTGCCTGTGAGATGGAGCCTGG - Intergenic
972638914 4:40908474-40908496 CCTGACGGAGAGAGGGAGGCCGG + Intronic
972764712 4:42141928-42141950 CCTGGGTGACAGAGGGAGACTGG - Intronic
973613665 4:52659273-52659295 TTTGGCTGGGAGAGGGAGGCCGG + Exonic
975327040 4:73069962-73069984 CCAGCCTGGCGGAGGGCAGCAGG - Intergenic
976092414 4:81471954-81471976 CGGGGCTGGCAGCGGGAGGCAGG - Intronic
976152349 4:82104897-82104919 CCTGCCTTCAAGAGGGAGCCTGG + Intergenic
976673337 4:87678015-87678037 CCTGACTAGCGGAGGGAGGGTGG + Intergenic
976874571 4:89837345-89837367 CCTGCCTGGCCGCGCAAGGCGGG + Intronic
978589121 4:110304886-110304908 CCTACCTGGGAGACTGAGGCAGG - Intergenic
978842279 4:113229004-113229026 CCTGTCAGGCAGATGGAGTCAGG - Intronic
980889045 4:138794705-138794727 CCTCTCTAGAAGAGGGAGGCAGG - Intergenic
983795250 4:171854160-171854182 GCTGCCTAGCACAGGGAAGCGGG + Intronic
985209537 4:187577464-187577486 ACAGCCTGGCAGACAGAGGCAGG + Intergenic
985390649 4:189489040-189489062 CCTGCCTGGCAGCGAGAAGGCGG - Intergenic
985578195 5:683430-683452 CCTGCCAGGCAGAAGCACGCGGG - Intronic
985593122 5:775570-775592 CCTGCCAGGCAGAAGCACGCGGG - Intergenic
985653001 5:1115714-1115736 CCTGCCAGGCAGAAGGCGGGTGG - Intergenic
985893918 5:2738268-2738290 CCTGCCTGGAAGAAGCAGGTTGG + Intergenic
986853821 5:11844932-11844954 ACTGACTGGCGGAGGGGGGCAGG + Intronic
987123697 5:14791805-14791827 CCTGCGTGGCAGAGGTTTGCTGG - Intronic
989418245 5:41205646-41205668 ACTGCAAGGCACAGGGAGGCTGG + Intronic
990097514 5:52135403-52135425 CCTGGGTGACAGAGCGAGGCTGG + Intergenic
991036367 5:62131698-62131720 CCTGGCTAGCAGAGGGAAGTGGG - Intergenic
991085726 5:62646916-62646938 GCTGTGTGGCAGAGGGAGGAAGG - Intergenic
991221696 5:64225780-64225802 CCTCCCAGCCAAAGGGAGGCTGG - Intronic
992084452 5:73265457-73265479 CCTATCTGGCAGTGGCAGGCAGG + Intergenic
992179218 5:74180494-74180516 GCTGGCTGGAAGAGGGAGGTGGG - Intergenic
992182054 5:74207135-74207157 CCTGCCTGGCATTGGGTGCCTGG + Intergenic
992365478 5:76084811-76084833 CCGGCGGGGCAGAGGGGGGCGGG + Intronic
992397847 5:76384099-76384121 CCGGCATTGCAGATGGAGGCAGG - Intergenic
992627469 5:78648602-78648624 CGCGCCTGGAAGAAGGAGGCGGG + Exonic
992663561 5:78984769-78984791 CCGGCCTGGAAGAGCGAGGTTGG + Intronic
992992153 5:82294653-82294675 CCAGCCTGACAGAGCGAGACTGG + Intronic
994718118 5:103347978-103348000 CCTGCCTGTGTGAGGTAGGCTGG + Intergenic
995724645 5:115170165-115170187 CCAGCCTGGCATAGGGCGACGGG - Intronic
996606443 5:125328780-125328802 CCTGCCTGGAAAAAGCAGGCTGG - Intergenic
997430411 5:133835184-133835206 GCTGCCTTGAAGAGGCAGGCGGG + Intergenic
997446303 5:133942886-133942908 CCAGCCTAGCAGAAGGAGGGTGG + Intergenic
997511795 5:134459384-134459406 CCTCCGCGGGAGAGGGAGGCAGG + Intergenic
997605493 5:135173071-135173093 CCAGCCTTGCATGGGGAGGCAGG - Intronic
997614740 5:135238664-135238686 CCTGCCTGGGACAGAGAAGCAGG + Intronic
997803285 5:136888500-136888522 CTTGCCAGGCAGAGGGATGAGGG - Intergenic
997888795 5:137657183-137657205 CCTTCCTGGAAGAAGCAGGCAGG + Intronic
999743282 5:154573327-154573349 GCTGCCTTGGAGACGGAGGCAGG - Intergenic
1001097543 5:168787365-168787387 ACTCCCTGGCAGGTGGAGGCGGG + Intronic
1001454315 5:171848890-171848912 CCTGCCTGGCAGAGACCGGCTGG - Intergenic
1001592874 5:172878330-172878352 CCTGCCTGGAAGAGGGAAACAGG - Intronic
1001971862 5:175962634-175962656 GCTGCTTGGCAGACTGAGGCAGG - Intronic
1002245580 5:177881145-177881167 GCTGCTTGGCAGACTGAGGCAGG + Intergenic
1002313593 5:178329417-178329439 CCTGGCTGGCAGGGGGAGCCTGG - Intronic
1002372595 5:178767170-178767192 ACTGGCTGGCACAGGGAGGATGG - Intergenic
1003531566 6:6941402-6941424 CTTGGCAGGCTGAGGGAGGCTGG + Intergenic
1004076184 6:12346151-12346173 CTTGCCTGGGAGAGGGATGGAGG + Intergenic
1005811566 6:29519881-29519903 CCTGCAAGGCAGAGGGAGAGAGG - Intergenic
1006725674 6:36197301-36197323 CCTGCCCGTCAGAGGGACCCAGG - Intronic
1006878234 6:37316845-37316867 ACAGCCTGGCACAGAGAGGCCGG - Intronic
1006911057 6:37563943-37563965 CCTCCCTGGCACAGGGAGCCTGG - Intergenic
1007091864 6:39189873-39189895 CCTGCCTGGCCCAAGGGGGCTGG + Exonic
1007221358 6:40281646-40281668 CTTGCCTGGCAGAGAGAGAAAGG + Intergenic
1007269364 6:40624436-40624458 CCTGCCAGACAGGGTGAGGCAGG + Intergenic
1007351058 6:41273816-41273838 CCTCCCTGGCAGGTGGTGGCAGG - Intronic
1007587293 6:42999265-42999287 CATGCATGTCAGAGGGAGGTGGG - Intronic
1007687102 6:43673500-43673522 CATGCCTTGGAGAGGGAAGCTGG + Intronic
1007746107 6:44043854-44043876 CCTGGCAAGCTGAGGGAGGCAGG - Intergenic
1008434340 6:51457448-51457470 GCTGCTTTCCAGAGGGAGGCTGG + Intergenic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1008965840 6:57311897-57311919 CGTGCCTGGCAGGCCGAGGCGGG + Intergenic
1013168757 6:107617390-107617412 CCTGCCTTTTAGAGGGTGGCTGG - Intronic
1014155920 6:118109709-118109731 CCTGCCAGACAGTGAGAGGCTGG - Intronic
1015272011 6:131346076-131346098 CCTTCCTGGTAGAGAGGGGCAGG - Intergenic
1015715046 6:136183760-136183782 CCTGCCTGCCAGGAGCAGGCTGG - Intronic
1017636367 6:156447497-156447519 CCTGCATGGGAGAGGTGGGCAGG - Intergenic
1018726468 6:166616654-166616676 CTGGCCTGGCAGAGGGAGGATGG - Intronic
1018936261 6:168275878-168275900 CCTGGCTCTCAGAGGGAGTCTGG - Intergenic
1019114882 6:169751871-169751893 CGAGCCTGGCCCAGGGAGGCCGG - Intronic
1019217150 6:170451369-170451391 CGTGCCTGGCAGAGGATGGTAGG + Intergenic
1019329455 7:455467-455489 CAGGCCTGGCACAGGGAGGAGGG - Intergenic
1019352568 7:561874-561896 CCTGCATGCCAGAGTGAGGCAGG + Intronic
1019544148 7:1565151-1565173 CCAGCCTGCCCGAGGGAGGTTGG + Intergenic
1019730729 7:2627945-2627967 CCTTCCTGGCAGCTGGAGGGAGG + Intergenic
1021097041 7:16547055-16547077 CCTGCCTGGCTGTGCGAGGGTGG - Intronic
1022114674 7:27251658-27251680 GCTGCCTGCGCGAGGGAGGCGGG - Intergenic
1022383731 7:29883929-29883951 CTAGCCTGGGAGAGGCAGGCGGG - Exonic
1022508868 7:30922778-30922800 CCTGCCATGTAGAGGCAGGCTGG + Intronic
1023335166 7:39161498-39161520 CCTGCCAGGCAGATCCAGGCTGG + Intronic
1023600490 7:41877294-41877316 CATGCCTGGCAGGTGGAGGTGGG - Intergenic
1023821441 7:43982877-43982899 CCAGGCTGGGAGAGGCAGGCAGG - Intergenic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1024243815 7:47454757-47454779 CCAGCCAGGCAGAGCCAGGCAGG + Intronic
1024578891 7:50785683-50785705 CCAGCCTGGTGGAGGGAGGCTGG - Intronic
1025227660 7:57178635-57178657 ACTGCCTGTCACAGGGAGGAAGG + Intergenic
1025929098 7:65980717-65980739 ACTGCCTGTCACAGGGAGGAAGG + Intronic
1026634502 7:72069600-72069622 CCTCCCTTGCAGAGGGATACAGG + Intronic
1027173133 7:75886894-75886916 TCTGCCTGTCACAGTGAGGCAGG - Intronic
1027588394 7:80087174-80087196 CTGGCCTGGCAGAGGCAGTCAGG - Intergenic
1028143021 7:87292117-87292139 CCTGTCTGGCTGTGGGAGGTAGG - Intergenic
1028477531 7:91267012-91267034 CCCGACTGCCAGAGGGAGGATGG + Exonic
1028928674 7:96388838-96388860 CCTGCCTGGCTGAGTCAGGAAGG - Intergenic
1029212015 7:98916882-98916904 CCTGCACGGCACAGGAAGGCAGG - Intronic
1029415940 7:100443275-100443297 CCTGCCTCCCAGAGTGAGGGTGG - Intergenic
1029444034 7:100603107-100603129 ACTGCCAGGCAGAGTGAGGCGGG + Intronic
1029749704 7:102536298-102536320 CCAGGCTGGGAGAGGCAGGCAGG - Intergenic
1029767654 7:102635403-102635425 CCAGGCTGGGAGAGGCAGGCAGG - Intronic
1030064995 7:105652681-105652703 CCTTCCTGGCAGGGGGATGGAGG - Intronic
1031275833 7:119722341-119722363 AGTGCCTGGGAAAGGGAGGCAGG - Intergenic
1031970594 7:128062271-128062293 TCTGCTTGGCACATGGAGGCAGG + Intronic
1032193486 7:129777454-129777476 CCATCCTGGTGGAGGGAGGCTGG + Intergenic
1032432368 7:131872346-131872368 CTTGACTGGCAGAGAGGGGCTGG + Intergenic
1033025703 7:137770309-137770331 CCTGTCTGGGGGTGGGAGGCAGG + Intronic
1033137762 7:138798789-138798811 CCGGCCTGGCAGGGCAAGGCAGG - Intronic
1033303828 7:140209818-140209840 CCTAGCTGGCACAGGGATGCCGG + Intergenic
1033657206 7:143381973-143381995 CCCGCCTGGGAGTGGGAGTCGGG + Intronic
1034867074 7:154650851-154650873 CCTACCTAGTAGAGGGAGGTTGG + Intronic
1035356896 7:158281175-158281197 GCTGCTTGGGAGAGTGAGGCAGG + Intronic
1035634101 8:1130690-1130712 CCTGCCTGGGAGGAAGAGGCTGG - Intergenic
1035678859 8:1473040-1473062 GCTGCCTGGGAGACTGAGGCAGG - Intergenic
1036057915 8:5280376-5280398 CCTGAATGTCAGAGGGAGGAGGG - Intergenic
1036523337 8:9512674-9512696 GCTACCTGGGAGACGGAGGCAGG - Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037820471 8:22132539-22132561 CCAGCCTGGGAGTGGGAGGCCGG - Intronic
1038286375 8:26209568-26209590 CCTGTCTGGGTGATGGAGGCTGG - Intergenic
1039045011 8:33441894-33441916 TCTGGCTGGCATTGGGAGGCAGG - Intronic
1039301492 8:36214208-36214230 ACTGCCTAGCAGAGGTAGGAAGG - Intergenic
1039840578 8:41290310-41290332 CTTCCCTGAAAGAGGGAGGCAGG - Intronic
1040462125 8:47659227-47659249 CCAGCCTGGGAGACGGAGGGTGG + Intronic
1040511767 8:48102297-48102319 CCAGCCTGGCTGTGGGAGGCAGG + Intergenic
1041249639 8:55921718-55921740 CCAGCCTGGGAGAGGCAGGGAGG + Intronic
1041259883 8:56012224-56012246 CCTGTCTGTCACAGGGAGGCTGG - Intergenic
1043578577 8:81686409-81686431 CCGGCCTGGCAGAGGCTCGCAGG - Intronic
1045224640 8:100232502-100232524 GCTGACTGGAAGAGGGAGGTAGG - Intronic
1047511544 8:125519811-125519833 GCTGCCTGGCAGTGTGGGGCAGG - Intergenic
1047615940 8:126562571-126562593 CATCCCAGGCAGATGGAGGCTGG + Intergenic
1047779277 8:128098356-128098378 CAGGCCTGGCAGAGGGGTGCAGG + Intergenic
1048276329 8:133068713-133068735 GCTGTCTGGCATACGGAGGCGGG + Intronic
1048869433 8:138785070-138785092 TCTACATGGCAGAGTGAGGCAGG + Intronic
1048986472 8:139737619-139737641 CCCGCCTGGGAGAGGGAAGGAGG - Intronic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049107737 8:140624228-140624250 GCTGCCTCCCAGAGTGAGGCAGG - Intronic
1049182115 8:141228280-141228302 GGTGCCTGGCACAGGGCGGCAGG - Exonic
1049242515 8:141545244-141545266 GCAGCCTGGCTGTGGGAGGCAGG - Intergenic
1049306041 8:141904828-141904850 CCTGCCAGGCAGGGAGGGGCAGG + Intergenic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049423371 8:142526520-142526542 CCTGCCGGGCAGAGAGTGGTGGG - Exonic
1049423632 8:142527591-142527613 CTGGCCTGGGAGATGGAGGCTGG + Intronic
1049545669 8:143229476-143229498 TCTGTGTGGAAGAGGGAGGCAGG - Intergenic
1049618961 8:143589266-143589288 CCGGCCTGGCCGAGGGTGCCCGG - Exonic
1049743426 8:144251969-144251991 ACTGCCCGGCAGAGGAAGGATGG - Intronic
1050538110 9:6647411-6647433 TCTGTATGGCAGACGGAGGCGGG + Intergenic
1051257839 9:15233078-15233100 CCAGCCGGGCAGTTGGAGGCGGG + Intronic
1051891379 9:21945669-21945691 CCTGTCTGGCTATGGGAGGCAGG - Intronic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1052656460 9:31369019-31369041 ACTACCTGGGAGAGTGAGGCAGG + Intergenic
1052973937 9:34398512-34398534 CATGTGTGGCAGAGAGAGGCAGG - Exonic
1053089244 9:35258708-35258730 GCTGCCTGGCAGAGCTAGGTGGG + Intronic
1053105501 9:35404748-35404770 CCTGCCTAGAGGAGTGAGGCAGG - Exonic
1053416784 9:37951846-37951868 CCAGCCTGTCAGCAGGAGGCTGG + Intronic
1055935213 9:81598359-81598381 CGTGGCAGGCAGAGGGAGGGAGG - Intronic
1056764086 9:89434177-89434199 CCTGGCTGGCAGCGGGTGACTGG - Intronic
1057744631 9:97741406-97741428 CCTGCCCGGCAGAGGCGGGCGGG - Intergenic
1057949250 9:99356731-99356753 CCTGCCAGGGAGAGGGCAGCAGG + Intergenic
1057996746 9:99825860-99825882 CCTCCCTGGCTGAGGGAAGTGGG + Intronic
1058120732 9:101135837-101135859 CCTGCTGGGCAGACAGAGGCAGG - Intronic
1058674617 9:107389733-107389755 CCTCACTGGCAGAGGGAGAGTGG - Intergenic
1059247547 9:112861646-112861668 CAAGACTGGCAGAGGGTGGCAGG - Intronic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059427490 9:114230333-114230355 CCTTCCTTGCAGAGGAAGGAAGG + Intronic
1059573771 9:115468373-115468395 CCTCACTGGTAGAGGGAAGCTGG - Intergenic
1060395593 9:123314241-123314263 GCAGGGTGGCAGAGGGAGGCTGG - Intergenic
1060551986 9:124489994-124490016 CATGCCTGCCAGAGAGAGGGAGG - Intronic
1061181543 9:129027803-129027825 CCTGCCTGGCTGAGGAGGGGAGG - Intronic
1061326831 9:129869263-129869285 CCGGCCAGGCAGGTGGAGGCTGG + Intronic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061509169 9:131049976-131049998 CCTCTCTGGCAGAGGGAGGGAGG - Intronic
1061868658 9:133508333-133508355 GCTGCCTGGAAGAGGCAGGTTGG - Intergenic
1061901403 9:133674043-133674065 CCTGCCAAAGAGAGGGAGGCTGG + Intronic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062077351 9:134598100-134598122 CCTGCCTGAAAGAGGGGGGACGG - Intergenic
1062161709 9:135083956-135083978 GCTGCCAGGCACAGGGAGCCGGG + Intronic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062262707 9:135670870-135670892 CATGGCTGGCAGAGGCAGGTGGG - Intergenic
1062323942 9:136003721-136003743 CCTGCCTGGGAGAGGGGCCCTGG + Intergenic
1062377271 9:136267840-136267862 CCTGGGTGACAGAGGGGGGCAGG - Intergenic
1062427025 9:136510805-136510827 CCTGCGGGGCAGGAGGAGGCCGG + Exonic
1062447879 9:136603288-136603310 CCTGGGGGGCAGAGGGAGGTTGG + Intergenic
1062635377 9:137487803-137487825 CCTGACAGGCAGGTGGAGGCTGG - Intronic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1185878075 X:3715298-3715320 CCTGCCTGGCCGAGGGGTTCAGG + Intergenic
1186077339 X:5895013-5895035 CCTGCATGGCAGAAGGCTGCAGG + Intronic
1187405557 X:19000752-19000774 CCTGGGTGACAGAGGGGGGCCGG - Intronic
1187940484 X:24376008-24376030 CCTGCCTGGGTGAGGGAAGCTGG + Intergenic
1188283014 X:28293385-28293407 CCTGGGTGACAGAGTGAGGCTGG + Intergenic
1189104001 X:38219032-38219054 GCAGGCTGGCAGAGGGAGCCAGG + Intronic
1189351833 X:40281328-40281350 GCTGCCAGACAGAGGGAGGGAGG - Intergenic
1189703290 X:43733860-43733882 CCTGCCTTTCTCAGGGAGGCTGG - Intronic
1190140621 X:47840581-47840603 CCTGCCTGGGAGGCGGAGGTTGG - Intronic
1190244680 X:48683536-48683558 GCTGCCAGCCAGAGGGAGGAGGG + Intronic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1192236825 X:69301464-69301486 CCTGCCTGCCAAAGGGACGGTGG + Intergenic
1192361242 X:70441324-70441346 CCTGCTTGGGAGACTGAGGCAGG + Intergenic
1193948521 X:87767395-87767417 CTTGCCTGCAAGATGGAGGCAGG - Intergenic
1194065513 X:89255871-89255893 AATGCCTGTCAGAGGGAGGATGG - Intergenic
1194330709 X:92580573-92580595 CCGGCCTGTGAGAGGGAGACTGG - Intronic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic
1199512918 X:148642723-148642745 CCTGCCTGCCCTAGTGAGGCAGG - Intronic
1199976857 X:152899257-152899279 CCTGGCTGGGGGCGGGAGGCAGG + Intergenic
1199977320 X:152902037-152902059 CCTGCCTGGAGCAGGGAGGTGGG + Intergenic
1200093519 X:153646951-153646973 CCAGCCTGGCCTCGGGAGGCAGG - Intronic
1200639416 Y:5699643-5699665 CCTGCCAGTGAGAGGGAGACTGG - Intronic
1200719682 Y:6589966-6589988 AATGCCTGTCAGAGGGAGGATGG - Intergenic
1200787312 Y:7272496-7272518 CCTGCCTGGCCGAGGGGTTCAGG - Intergenic
1202113224 Y:21446243-21446265 CCTGCCAGGCAGTGTGGGGCTGG - Intergenic