ID: 950183985

View in Genome Browser
Species Human (GRCh38)
Location 3:10933876-10933898
Sequence CAGAATAAAGAGCAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 543}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950183985_950183988 2 Left 950183985 3:10933876-10933898 CCCTCCTGCTGCTCTTTATTCTG 0: 1
1: 0
2: 2
3: 55
4: 543
Right 950183988 3:10933901-10933923 ACCTCACACATGTAACATCTCGG 0: 1
1: 0
2: 1
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950183985 Original CRISPR CAGAATAAAGAGCAGCAGGA GGG (reversed) Intronic
900191573 1:1354397-1354419 CAGGATGAAGAGCAGCAGCGTGG + Exonic
900320654 1:2081840-2081862 CAGCACAGAGGGCAGCAGGAAGG - Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904720931 1:32508058-32508080 CAGAAGAAAGAACAGTAGGCTGG - Intronic
905180919 1:36166083-36166105 CAAAATAAAGACCTGAAGGAGGG + Intronic
905969713 1:42132240-42132262 CACCAAAAAAAGCAGCAGGAGGG + Intergenic
906683325 1:47745902-47745924 CACACTGAAGAGCAGCTGGATGG - Intergenic
906722688 1:48020520-48020542 CAGAGTAAAGAGCTCCAGGAGGG + Intergenic
907321691 1:53606640-53606662 CTGAAAGAGGAGCAGCAGGAAGG + Intronic
907372911 1:54014520-54014542 CAGAACAAAGAGCATCAAGGAGG - Intronic
907667329 1:56444881-56444903 CAGTATAAATTGCAACAGGAAGG + Intergenic
908267466 1:62393551-62393573 CAGGATCCAGAGCAGAAGGAAGG - Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909194819 1:72605540-72605562 CCAAATAAACAGTAGCAGGAAGG - Intergenic
909374393 1:74923686-74923708 CAGAATGAAGAAAAGCAGGGTGG + Intergenic
910020243 1:82579821-82579843 AAGAATGAAGAACAGCAGTAAGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910209705 1:84780355-84780377 CAGAAGAAAGAACAGCAGGTTGG + Intergenic
911519329 1:98909306-98909328 AAGAATAAAGAACAGAAAGAAGG - Intronic
912141988 1:106741391-106741413 CTTAATAAAAAGCAGCAGAAAGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
913214778 1:116611037-116611059 AAGAATAAAGAGCAAGTGGAAGG - Intronic
913551078 1:119917313-119917335 CAGAAAAAAAAGCAGCCGGAGGG + Intronic
913672129 1:121106970-121106992 TAGAATAATGAGCAGGAGAAAGG - Intergenic
914023893 1:143894327-143894349 TAGAATAATGAGCAGGAGAAAGG - Intergenic
914662383 1:149802366-149802388 TAGAATAATGAGCAGGAGAAAGG - Intronic
914741559 1:150470293-150470315 CACAATAAAAGGCAACAGGAAGG - Intronic
914980606 1:152411317-152411339 CAGCACAAAGAGCAGCAGGTTGG + Intronic
915321136 1:155057098-155057120 CAGAGTAAGTAGCTGCAGGATGG + Exonic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915843831 1:159240940-159240962 CAGGATGATGGGCAGCAGGAAGG - Intergenic
915886726 1:159730398-159730420 CACAATAAAAAGCAGCAGTTTGG + Intergenic
917705736 1:177632695-177632717 CAGTATAAAGAGCCCCATGAAGG - Intergenic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
918079165 1:181192389-181192411 CAGAGAAAAGAGCTGCAGGGAGG + Intergenic
918670944 1:187216054-187216076 TAGAATAAAAGGCAGCAGAAGGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
920018965 1:202939067-202939089 CAGAAATAAGATCGGCAGGAAGG - Intergenic
920528902 1:206687222-206687244 CAGAATACAGAGCAGAAGTTGGG - Intronic
921093899 1:211870338-211870360 AACAATAAAGATCAGAAGGAAGG + Intergenic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921354926 1:214276912-214276934 CTGAACAAAGTGCAGTAGGAAGG - Intergenic
921778370 1:219129805-219129827 AAGTATATAGAGCAGCAGGGAGG - Intergenic
921918557 1:220641599-220641621 CAAAATAAAGGGAAGAAGGAAGG + Intronic
922118214 1:222635060-222635082 CAGGAGAAAGACCACCAGGATGG + Intronic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922438490 1:225629770-225629792 TAGAATAAAGAGCAATAGGGAGG - Intronic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924478959 1:244409756-244409778 CAGAATAGAGAACAGCAAAAAGG - Intronic
924570053 1:245229572-245229594 CAGATTAATGAACAACAGGATGG - Intronic
1062974184 10:1671585-1671607 CAGAATCCAGAGAAGCACGAGGG - Intronic
1063220002 10:3958309-3958331 GAGAAGTGAGAGCAGCAGGATGG + Intergenic
1063273811 10:4541587-4541609 CAGGCTCAAGAGCAGCAAGAGGG - Intergenic
1063372909 10:5533355-5533377 CAGGATCAAGGGCATCAGGATGG - Intergenic
1063817864 10:9797014-9797036 CAAAATAAAAACCAGAAGGAAGG + Intergenic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065271943 10:24042142-24042164 CAGTATGAAGTGCAGCTGGACGG - Intronic
1065337259 10:24665604-24665626 CAGAATAAAAAGGAGCACAAGGG + Intronic
1065510720 10:26475786-26475808 CAGAATGAAAAGCAGTAGCAGGG - Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066356457 10:34688974-34688996 GAGCCTAAATAGCAGCAGGAGGG + Intronic
1066638017 10:37526327-37526349 AAGTTTAAAGAGCAGAAGGATGG + Intergenic
1067327095 10:45279848-45279870 GAAAATAATGAGCAGGAGGAAGG + Intergenic
1068219083 10:54020456-54020478 CAAAATAAAGAAATGCAGGAAGG + Intronic
1068861912 10:61855984-61856006 CTGCATGAAGAGCAGCAAGAAGG + Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070320215 10:75348977-75348999 GAGAAAAAAGAGAAACAGGAAGG - Intergenic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1071468504 10:85961995-85962017 AAGCAAAAAGAGCAGAAGGAAGG + Intronic
1071984140 10:91033886-91033908 CAGAATAGTTAGCAGCAGCATGG - Intergenic
1072563592 10:96599127-96599149 CAGCTGAAAGAGCAGCAGAACGG + Intronic
1072626430 10:97115315-97115337 CAGGATAAGTACCAGCAGGAAGG - Intronic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1074899105 10:117801518-117801540 CAGAGGAAAGGGCAGCAGGGGGG - Intergenic
1074906612 10:117869703-117869725 AAGAAGAAAGGGGAGCAGGACGG + Intergenic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1076464374 10:130668266-130668288 CAGAAATAAAAGCAGCAGAAAGG + Intergenic
1076467921 10:130697734-130697756 TAGAATGAAGAGCAGAAGGTGGG + Intergenic
1078374596 11:10782986-10783008 CAGAATAAAGAACAGCAAAAGGG - Intergenic
1079090096 11:17474921-17474943 CAGGACGAAGAGCAGCATGAAGG + Exonic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080783906 11:35457251-35457273 TAGAATAAAAAGGTGCAGGAAGG + Intronic
1080798969 11:35591624-35591646 CAGAAGCAACAGCAGCAGCATGG - Intergenic
1081569879 11:44283542-44283564 CAGAATAAAGACTATCAGGAAGG - Intronic
1081720451 11:45285243-45285265 CATTGTAAAGAGCAGCAGAAGGG - Intronic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082574190 11:54782604-54782626 CAGAATAAAAACTAGAAGGAAGG + Intergenic
1082952686 11:58834264-58834286 AAGAATACAGAGGAGAAGGAAGG + Exonic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083331188 11:61899107-61899129 CAGGAGAAAGACCAGCCGGACGG + Intronic
1084014200 11:66369139-66369161 CAGGGCAAAGAGCAGCAGTATGG + Exonic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084716558 11:70878006-70878028 AAGAATGCAGAGAAGCAGGAGGG + Intronic
1084800182 11:71538506-71538528 CAGCCTGAAGAGCAGCAGCAGGG - Exonic
1085698227 11:78723655-78723677 CAGACTAAAAAGAAACAGGATGG - Intronic
1086176356 11:83895673-83895695 AAGAATGAATAGCAGCAGGCTGG - Intronic
1086329645 11:85740869-85740891 AAGAATAAATAACATCAGGAAGG + Intronic
1086399604 11:86449773-86449795 CAGAATAGAGAGCAAAATGAGGG - Intronic
1087195638 11:95301786-95301808 CAGAAGAATGAGGAGCAGGGAGG + Intergenic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087355292 11:97085564-97085586 CAGTTTAAATAGCAGCAGGGGGG + Intergenic
1088217112 11:107523414-107523436 CAGAATAGAGAGTAGTAGAATGG + Intronic
1088548320 11:110984636-110984658 CAGAATGAATAGCAGCTAGATGG + Intergenic
1089336016 11:117724507-117724529 ATGAATAAAGAGTAGCAAGAGGG - Intronic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093333742 12:17875125-17875147 CAAAATAAAGAAAAGCAGTAGGG - Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1093710480 12:22323862-22323884 GGGAAGAAAGAGCATCAGGAAGG + Intronic
1093870066 12:24280234-24280256 CATACTAAAGTGCAGCACGAGGG + Intergenic
1093942958 12:25074668-25074690 CAGAATTATCAGCAGCATGAAGG + Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094864583 12:34515724-34515746 CAGGATAAAAACTAGCAGGAAGG - Intergenic
1096256110 12:50063327-50063349 CAGAATGCTGAGCAGCAGCAAGG + Intronic
1096837906 12:54362829-54362851 CAGAATGTTGAGCAGCAAGAAGG + Exonic
1096871191 12:54593351-54593373 CAGAATCAGGGGCATCAGGAAGG + Intergenic
1097172797 12:57127180-57127202 CAGAAACAGGAGCAGCACGAAGG - Intronic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1098197464 12:68017131-68017153 CAGAAGGAACAGCAGCAGGTAGG + Intergenic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098473331 12:70870423-70870445 CAGAATAAAGAGTAGCAGTAGGG - Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098698249 12:73587208-73587230 TAGAAGAAAGAGCAGCAAGTAGG + Intergenic
1099775550 12:87123367-87123389 CAGAATAAAGAGCCACAAAAAGG - Intergenic
1100350265 12:93774460-93774482 CAGAATAAACAGCAGCATTTGGG - Intronic
1100746058 12:97647076-97647098 CAGAATCAAGATCAGTAGGATGG + Intergenic
1101795462 12:107969056-107969078 CACAATAAAGGGTAGGAGGAAGG + Intergenic
1103635986 12:122305765-122305787 CAGAATAAAAAGCAGTCAGATGG + Intronic
1104040525 12:125127245-125127267 CAGCAGAGTGAGCAGCAGGAAGG + Intronic
1104355283 12:128079734-128079756 CAGAATGATGGGGAGCAGGAGGG + Intergenic
1104386180 12:128353585-128353607 CCCAATAAAAAGCTGCAGGAGGG - Intronic
1104631958 12:130410320-130410342 CAGAATAAAAAGCCACAGGCTGG - Intronic
1105042266 12:132969787-132969809 CAGAATAAAAAGCAGGCAGAGGG + Intergenic
1105303919 13:19156290-19156312 CAGGATGAAGAGCAGGTGGAAGG - Intergenic
1105567874 13:21569283-21569305 TAGACTATAGAGTAGCAGGAAGG - Intronic
1105943266 13:25170073-25170095 CCGGAGAAGGAGCAGCAGGAAGG - Exonic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106279821 13:28256613-28256635 CACAATAAAAAGCTGCAGGAGGG - Intronic
1106538357 13:30667893-30667915 AAGAAAAAAGACCAGGAGGAAGG + Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106786504 13:33113200-33113222 CAGAATACAGAAAACCAGGATGG - Intronic
1107162302 13:37244923-37244945 CAGAATGAAGGACAGCAAGAAGG - Intergenic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1108319210 13:49271277-49271299 GGGAAAAAAGAGCAGGAGGAAGG + Intronic
1110408598 13:75178952-75178974 TAGAATCATGAACAGCAGGAAGG + Intergenic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1111368539 13:87284557-87284579 GAAAATAAAGAGAAGAAGGAAGG + Intergenic
1111373797 13:87352485-87352507 CAGAATAAACAGCCAAAGGATGG - Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1112184804 13:97117368-97117390 CAGAAGACAGAGTTGCAGGAAGG + Intergenic
1113185942 13:107685731-107685753 CCTAATAAAGAGCAGCAACATGG + Intronic
1113954328 13:114089130-114089152 TAGCAGAAAGTGCAGCAGGAAGG - Intronic
1114495369 14:23128134-23128156 CAGGCTGAAGACCAGCAGGAAGG + Exonic
1116211091 14:41945709-41945731 CAGAAGGAAGAGGAGAAGGAAGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1117500866 14:56350087-56350109 CAAAATAAAGACCTGCAGGAAGG - Intergenic
1117521107 14:56552212-56552234 GAGAAAAAATAGCATCAGGAAGG + Intronic
1117760509 14:59022373-59022395 CAGAATTAGGATCAGCAGGTCGG + Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119364092 14:74076989-74077011 CAGAGTATAGAGCTGCATGAAGG + Intronic
1119631096 14:76232875-76232897 GAGACTAAAGAGCAGCTGCACGG - Intronic
1119706381 14:76785102-76785124 GAGAATGAAGAGCAGGTGGATGG + Intergenic
1119937248 14:78603202-78603224 CAGGAAAGAGAGCAGCAGGTGGG - Intronic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120397913 14:83991776-83991798 GAGAAGAAAGAGCAGCAAGCTGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120649872 14:87119212-87119234 GAGAATACAGTGCACCAGGAAGG - Intergenic
1120990931 14:90376792-90376814 CTGTAAAAAGAGGAGCAGGAAGG - Intergenic
1121659209 14:95622295-95622317 AAGAATAAGAAGCAGCAGCAAGG + Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125150258 15:36522784-36522806 GACAATATAGAGTAGCAGGAAGG - Intergenic
1125433536 15:39622841-39622863 CAGAAAAATGAGCAGCAGTTGGG - Intronic
1126346246 15:47697256-47697278 CAGAACAGAGAACTGCAGGAAGG + Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1127210787 15:56772482-56772504 TTAAATAAAGAGCAGGAGGAAGG + Intronic
1127882805 15:63173005-63173027 CAGACAACAGAGGAGCAGGAAGG - Intergenic
1127955643 15:63850400-63850422 CAGAATTGAGAGCTACAGGATGG - Intergenic
1128658956 15:69483891-69483913 CAGAATCAAAAGCAGATGGAGGG - Intergenic
1128886386 15:71292175-71292197 CAAAACAAAGAGCATCAGGATGG - Intronic
1129175604 15:73837763-73837785 CAGGATAGAGACCAGAAGGATGG + Intergenic
1130779141 15:87016684-87016706 GAGAATGAAGAAAAGCAGGATGG + Intronic
1130937315 15:88481432-88481454 AAGAATAAAGTCCAGCAGGAAGG - Intergenic
1132043068 15:98541480-98541502 CAGATTAAAGATCTGGAGGATGG - Intergenic
1132420114 15:101658537-101658559 GGGAAAAAAGGGCAGCAGGAGGG + Intronic
1132823893 16:1893120-1893142 CAGAACAAAAAGCAGCATCAAGG - Intergenic
1133433710 16:5761181-5761203 CAAAATAAACAGCAGCGAGAGGG - Intergenic
1133598190 16:7313043-7313065 CAGAAGGAAGAGCAGCAGTGGGG - Intronic
1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG + Exonic
1136403766 16:30031618-30031640 CAGAAGGAAGAGCTGAAGGAGGG + Intronic
1136740526 16:32518850-32518872 CAGGATAAAAACCAGAAGGAAGG - Intergenic
1136901076 16:34038655-34038677 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1136968338 16:34942061-34942083 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1138538137 16:57670774-57670796 CTGAATAAAGAGTAACAGCAGGG - Intronic
1138953655 16:61944643-61944665 CACAATAAATAGGAGCAGGCGGG + Intronic
1139072893 16:63404371-63404393 TAGAATAAAGACTAGGAGGAGGG - Intergenic
1139707955 16:68754867-68754889 AAGAATAAAACTCAGCAGGAAGG + Intronic
1140102989 16:71934495-71934517 CAGAAAACAGACCAGCAGCATGG - Intronic
1140269195 16:73447802-73447824 CAAAATAAATAACAGCATGAAGG + Intergenic
1140492090 16:75346280-75346302 CAGTGTAAAGAGCACCAGGTAGG + Intronic
1141236055 16:82217569-82217591 GGGAATAAGGAGCAGCAGGTTGG + Intergenic
1141265189 16:82490106-82490128 CAGAATAAAAAGCAGGCAGAAGG + Intergenic
1141331776 16:83117480-83117502 GAGAAAAAAGATCAGCAGGGAGG - Intronic
1141337813 16:83173831-83173853 CAGAATGAAGGACAGCAAGATGG - Intronic
1141454826 16:84134195-84134217 CAGCATATCCAGCAGCAGGAGGG - Intronic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1142431349 16:90029631-90029653 AACAAGAAGGAGCAGCAGGAGGG - Intronic
1203029080 16_KI270728v1_random:556384-556406 CAGGATAAAAACCAGAAGGAAGG + Intergenic
1203042641 16_KI270728v1_random:778047-778069 CAGGATAAAAACCAGAAGGAAGG - Intergenic
1142525379 17:536639-536661 CAGAACAAACCGCAGCTGGATGG + Intronic
1142765262 17:2060846-2060868 CAGGAAGAGGAGCAGCAGGAAGG + Exonic
1143015979 17:3891558-3891580 CAGTATGAAGAACAGCAGGGAGG + Intronic
1143307741 17:5960985-5961007 CAGAATGCAGATCACCAGGAAGG + Intronic
1143379131 17:6484870-6484892 CAGAACAAAGTGCTGCAGGGAGG + Intronic
1143384837 17:6522891-6522913 GGGAATAAAGACAAGCAGGATGG - Intronic
1143714188 17:8755408-8755430 CAGAGTAAAGAGGAGAAGTAGGG + Intronic
1143791748 17:9301962-9301984 CAGAATACAGAAAAGAAGGAAGG - Intronic
1143795144 17:9330237-9330259 GAGAATAAAGAACAGTTGGAAGG - Intronic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1146243287 17:31251229-31251251 CAGAACACAGAAGAGCAGGAAGG - Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1148068139 17:44888679-44888701 GAGAAAAAAGAGAAGCAGTAAGG + Intronic
1148237045 17:45975987-45976009 CAGAATCCAGCGCAGCAGAAGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149145525 17:53487681-53487703 CTGAATTGAGAGCAGCTGGAGGG - Intergenic
1149180012 17:53924670-53924692 CTGAAAGAAGAGCAGCAGGCTGG - Intergenic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150589248 17:66547832-66547854 CAGAATAAAAAGCCGTAAGATGG - Intronic
1150645751 17:66976529-66976551 AAGAATAAAGAGAGGAAGGAGGG - Intronic
1151360582 17:73586276-73586298 ATAAATAAAGAGCAACAGGAGGG - Intronic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151654232 17:75488273-75488295 CAAAAAAAAGAACAGCAGGGTGG - Intronic
1151817958 17:76480790-76480812 CAGAAGACACAGCAGCAGGCAGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152099241 17:78291529-78291551 GAGACTGAAGAGCAGCAGGGAGG + Intergenic
1152810724 17:82380874-82380896 CAAAAAAAAAAGCAGCAGAAAGG + Intergenic
1154975432 18:21452819-21452841 CAGAAAAAAGAACAGGAGAAAGG + Intronic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1155996542 18:32336538-32336560 CAGAAGAAAGTACAGCATGAGGG - Intronic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156575443 18:38309855-38309877 CAGAATAAAGAAAAGCAGTAAGG + Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1159174843 18:64819103-64819125 TACAATAAAGATCAGTAGGAAGG + Intergenic
1160110795 18:76028064-76028086 AAAAACAAAGAGGAGCAGGAGGG + Intergenic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1162000161 19:7739433-7739455 AAGAATGAAGAGGAGCAGGTAGG + Intergenic
1162527169 19:11213053-11213075 GAGCATAATGAGCAGGAGGAGGG - Intronic
1163851694 19:19668092-19668114 AAAAAAAAAAAGCAGCAGGAAGG + Intergenic
1164074319 19:21800258-21800280 GAGAAAAAAAAGTAGCAGGAGGG + Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164692356 19:30220711-30220733 CAGATTTAAAAGCAGCAGGGAGG - Intergenic
1164734945 19:30534081-30534103 CATAACAAATAACAGCAGGAAGG + Intronic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166235462 19:41452645-41452667 CATACTCAAGAGGAGCAGGAAGG - Intergenic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167806214 19:51787698-51787720 CAGAATGAAGACGAGAAGGATGG + Intronic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
925926638 2:8675967-8675989 AAGAAAAAAGAGCAACACGAAGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
927149852 2:20189237-20189259 CAGTATAAAGAACAGGTGGAGGG - Intergenic
927932760 2:27055841-27055863 CAGAAACAGGAGCATCAGGAGGG - Exonic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928697061 2:33859994-33860016 CACAATACACAGCCGCAGGAGGG - Intergenic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
928704497 2:33933378-33933400 CAGGCAAAAGAGCAGCAAGATGG - Intergenic
928785645 2:34883254-34883276 AGTAATAAAGAACAGCAGGAGGG - Intergenic
928970383 2:37021984-37022006 AAGAAGAAAGAACAGCAGGAAGG - Intronic
929670762 2:43875237-43875259 CAGCAGGAAGTGCAGCAGGAAGG - Exonic
930580300 2:53203124-53203146 CAGAATGAAGAACAGATGGAAGG - Intergenic
930601863 2:53453051-53453073 CAGAAAGGAGAGCAGCAGGATGG + Intergenic
931829753 2:66038532-66038554 GAGGATGAAGAGCAGCAGGCTGG - Intergenic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
932796553 2:74700799-74700821 CAGAACAAAGGACAGAAGGAAGG + Intergenic
933188753 2:79308990-79309012 GACAATATAGGGCAGCAGGAAGG - Intronic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
934046566 2:88177723-88177745 TAAAAAAAAGAGCAACAGGAAGG - Intronic
934140449 2:89041880-89041902 CAGCTTAAAAAACAGCAGGAAGG - Intergenic
934146680 2:89101529-89101551 CAGCTTATAAAGCAGCAGGAAGG - Intergenic
934222587 2:90099063-90099085 CAGCTTATAAAGCAGCAGGAAGG + Intergenic
934228789 2:90158656-90158678 CAGCTTAAAAAACAGCAGGAAGG + Intergenic
935490002 2:103707459-103707481 CAGAAAAAATAGCAACAGAATGG + Intergenic
935855322 2:107267151-107267173 AAGAATGAAGAGCCGCTGGATGG + Intergenic
936026967 2:109039213-109039235 CACAAGAAAGACCAGCAGGCTGG - Intergenic
936062126 2:109301797-109301819 CAGAATGAAGACAAGAAGGATGG - Intronic
936289281 2:111207438-111207460 GAGAATAAAGGGCTTCAGGAAGG - Intergenic
938115235 2:128597979-128598001 CAGAATAATGAGCTGCTGCAGGG - Intergenic
938519150 2:132048838-132048860 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
940736788 2:157462645-157462667 AAGAAGAAAAAGTAGCAGGAGGG + Intronic
940801086 2:158133355-158133377 CAGAGTATAGGGGAGCAGGATGG + Intronic
942058367 2:172205959-172205981 CTGAATTAAGAGGAGAAGGAAGG + Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
944173166 2:196801158-196801180 GAGAATAAACAGCAAAAGGATGG + Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947161187 2:227216425-227216447 CAGAATAAAGAGATGCGGTAAGG - Intronic
949077898 2:242072922-242072944 CAGAAGGAAGATTAGCAGGAAGG + Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1173194440 20:40902733-40902755 CAGAATTAAAAGAAACAGGAGGG + Intergenic
1173447289 20:43130345-43130367 CAGAATAAAGTGCACCAGGTAGG + Intronic
1173525775 20:43731485-43731507 CAGGATGAAGATCAGCAGGGAGG - Intergenic
1173830482 20:46082527-46082549 CAGAATAAAGTATAGCAGAAGGG - Intronic
1173853764 20:46236330-46236352 CTGAATAAAGATCTGAAGGAAGG - Intronic
1174130478 20:48340561-48340583 CAGGCTACAGAGCAGCAGGGAGG + Intergenic
1174699597 20:52594618-52594640 TGGAAAACAGAGCAGCAGGATGG - Intergenic
1175073396 20:56353622-56353644 GAGAAGCAGGAGCAGCAGGAGGG - Intergenic
1175161467 20:57011126-57011148 CACAATAAAGAGTAGAAGCAAGG - Intergenic
1175374708 20:58516043-58516065 CAGAAAAAAGAGAACCAGGAAGG + Intergenic
1176742564 21:10617389-10617411 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1176970023 21:15254175-15254197 CAGAACACAGAGCAGCACCAAGG + Intergenic
1176986831 21:15446743-15446765 CAGTATAAAACGCAGCAAGAAGG + Intergenic
1177015788 21:15784946-15784968 AAAAATATAGAGCAGCTGGATGG + Intronic
1178156182 21:29856803-29856825 CAGCACAAAGAACAGGAGGATGG + Intronic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1180866359 22:19122159-19122181 GAGCAGGAAGAGCAGCAGGAAGG + Exonic
1180946394 22:19696109-19696131 CAGGATACAGGGCAGCAGGGCGG + Intergenic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1182214987 22:28708476-28708498 CAGAAGAAAGCCAAGCAGGAAGG + Intronic
1182707352 22:32293688-32293710 AGGAATAAAGAGCAACAGGAAGG - Intergenic
1182756443 22:32683397-32683419 CAGAAGAAATGGCACCAGGAAGG - Intronic
1183277884 22:36912594-36912616 CAGGAGAAAGGGCAGCAGGCAGG - Intergenic
1184395693 22:44237077-44237099 AGGAATAAAGAGCAACAGGAAGG - Intergenic
1184877583 22:47285260-47285282 GAGGAAAAAGAGGAGCAGGAGGG - Intergenic
1203237720 22_KI270732v1_random:21962-21984 GAAAATAAAGAGGAGAAGGAGGG + Intergenic
949190624 3:1244549-1244571 AGGAACAAAGAGCAGGAGGACGG + Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
953389184 3:42524713-42524735 CCAGATAAAGAGCTGCAGGAGGG - Intronic
954777023 3:53028711-53028733 CAGAATAAATGGCAGAAAGAAGG + Intronic
955847109 3:63177169-63177191 CATAATAGAGATCAGTAGGATGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
958105046 3:89061116-89061138 CAAAATAAAGAGTATTAGGAAGG - Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960499829 3:118423480-118423502 CACAAGAAACAGCAGCAGGCAGG + Intergenic
960610504 3:119550942-119550964 GAGACTAAAGAGTAGCAGGATGG - Intronic
961040690 3:123676041-123676063 CAGGACACAGAGCATCAGGATGG + Intronic
961430081 3:126875205-126875227 CAGAATCCAGAGCAGGAAGAGGG + Intronic
961462564 3:127061834-127061856 CCCAATACAGGGCAGCAGGAAGG - Intergenic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963819098 3:149868534-149868556 CGGAATAAAGAGGAGCAGAAAGG - Intronic
964130842 3:153284724-153284746 AAGAATAAAGAGTAGCAGAGAGG - Intergenic
964674842 3:159266424-159266446 CAAATTAAAGAGCAACAGAAGGG + Intronic
964945548 3:162219313-162219335 TAGAGTACAGAGCAGCAGCAAGG - Intergenic
965641607 3:170834735-170834757 CAGAATAAAGAGGAGGACAATGG + Intronic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967691497 3:192479297-192479319 CAAAAGACAGAGCAGTAGGATGG + Intronic
968488023 4:873586-873608 CAGCACAAAGGGCAGAAGGAGGG - Intronic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970103544 4:12554305-12554327 CACAGTAAAGAGCAGTAGAAAGG - Intergenic
971178095 4:24300952-24300974 CAGATGAGAGAGCAGAAGGATGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
972092244 4:35301659-35301681 CAGACAAAAGAGCAGCAGCAGGG - Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972930451 4:44065673-44065695 CAGAATAAGTGGCAGAAGGAAGG - Intergenic
974104065 4:57447759-57447781 CAAAAGAAAGAGTAACAGGAGGG + Intergenic
974335524 4:60539539-60539561 CAGAATTAAGAGACTCAGGAAGG + Intergenic
974340175 4:60604198-60604220 GAGAATGAAGAAAAGCAGGATGG - Intergenic
975350912 4:73345135-73345157 CAAAATAAAGAAAAGAAGGATGG + Intergenic
975420820 4:74162259-74162281 GACAATAAAAAGCAGCAAGATGG - Intronic
975435547 4:74346646-74346668 CAGCTAAAAGAGCAGCTGGAAGG + Intergenic
975469303 4:74747002-74747024 CAGAATAGTGAGCAGAAAGAGGG + Intronic
976267596 4:83198939-83198961 AAGAATAAAGAACAGTAGGAGGG + Intergenic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
978506665 4:109465021-109465043 CAGAATTAAAAGCACCAAGAAGG + Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979179413 4:117707162-117707184 GAGAACAAAGAAAAGCAGGAGGG + Intergenic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
979341054 4:119524796-119524818 AAGAATAAGAAGCAGCAGAAAGG - Intronic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981399818 4:144301149-144301171 GAGAATGAAGAGCTGCTGGAAGG - Intergenic
981735213 4:147942608-147942630 GAGAATAAAGAGGATAAGGAGGG - Intronic
981954229 4:150449902-150449924 TAGAATAAAAAACAGCAAGAAGG + Intronic
982039985 4:151387777-151387799 CAAAATAAAGAACAAAAGGAAGG + Intergenic
982346617 4:154367279-154367301 CAGACCGAAGAGCAGCAGGGTGG + Intronic
982529422 4:156520635-156520657 GAAAACAAAGAGGAGCAGGATGG + Intergenic
983067055 4:163223277-163223299 CAGATAAAAAAGCTGCAGGAAGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984189579 4:176589354-176589376 AAGAGTACAGAGCAGAAGGAAGG + Intergenic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
985847169 5:2358958-2358980 CAAAATAAACACCAGTAGGAAGG + Intergenic
986796766 5:11220227-11220249 AAGAATAAAGAACAGCTGGGAGG + Intronic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987416197 5:17663995-17664017 GAGAATGAAGAAAAGCAGGATGG - Intergenic
988885117 5:35548097-35548119 CAGAATAGAGTGCAGGAAGAAGG - Intergenic
988955621 5:36314595-36314617 GGAAATAAAGAGCAGCAGAAAGG - Intergenic
989786262 5:45334998-45335020 CAAATTAAAGGTCAGCAGGATGG + Intronic
990115537 5:52385829-52385851 CACCAGAAAGAGCAGCAGGGAGG + Intergenic
990773939 5:59284163-59284185 CAGATTGCAGAGCAGCAGGATGG - Intronic
991592596 5:68269151-68269173 AAGGATAAAGATCAGCAGAAAGG - Intronic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992381259 5:76240025-76240047 CAGAATAAAAAGCATAAGAAAGG - Intronic
992913605 5:81424127-81424149 CAGAAAAAAGAGCAACTGGCCGG + Intronic
993186413 5:84627331-84627353 CAGATAAAAGAACAGCAGAATGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
993852077 5:93023180-93023202 CCCAATGGAGAGCAGCAGGAAGG - Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994748352 5:103707236-103707258 AAGAAGAAAGCGCAGCAGGCGGG + Intergenic
994864677 5:105251881-105251903 AAGAATAAAAAGCATCAGAAAGG + Intergenic
994869812 5:105333365-105333387 CAAGATAGAGAGCAGAAGGATGG - Intergenic
995470602 5:112498088-112498110 CAGAAGAAAGGGGAGAAGGAAGG - Intergenic
995565947 5:113433398-113433420 GAGCAGGAAGAGCAGCAGGAAGG - Exonic
995749494 5:115439172-115439194 CAGACAAAAGAGCACCAGGAGGG - Intergenic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996075053 5:119182912-119182934 CAGAATAAAAAGCAAAAGTATGG - Intronic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996366262 5:122704132-122704154 CTAGATAAAGAGCAGTAGGATGG - Intergenic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
997372147 5:133368893-133368915 CTGAATAAAGATCAGCTGGCAGG + Intronic
997732628 5:136192342-136192364 CAGGAAGAAGAGCAGCAGGTAGG + Intergenic
998723163 5:144976784-144976806 CAGAGTAGACAGCAGCAGAATGG - Intergenic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999094107 5:148962921-148962943 AGGAAGAAAGAGCAGCAGGTGGG + Intronic
999585856 5:153088820-153088842 CAGAGCAAAGGGCACCAGGAAGG + Intergenic
999700337 5:154221814-154221836 CAGCATAAAGAGTGGCAGGAAGG - Intronic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000907460 5:166979592-166979614 CAGAATGAGGAGCAACAGAAAGG - Intergenic
1001344117 5:170875241-170875263 AAACATAAAGAGCAGCAGGAGGG - Intronic
1001825203 5:174739289-174739311 CAGGATCAGGAACAGCAGGATGG + Intergenic
1002848415 6:969204-969226 CAGAAGGATGAGCTGCAGGAAGG - Intergenic
1005333847 6:24774173-24774195 AAAAATAAAAAGCAGAAGGAAGG - Intergenic
1005929101 6:30467637-30467659 CAGAATAAAGAAGAGTAGAAAGG + Intergenic
1006756337 6:36418888-36418910 CAGAGTAAAGAGTGGCAGGGGGG + Intronic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1009339379 6:62534294-62534316 GAGAATAAAAAGGAGCAAGAAGG - Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1011882951 6:92053485-92053507 GAGAAGAAAAAGAAGCAGGAGGG + Intergenic
1011920896 6:92576764-92576786 CAGAATAAAGAAAAGCAAGGTGG + Intergenic
1012150764 6:95748422-95748444 CAGAAAACAGAGCAGGAGTAAGG - Intergenic
1012453943 6:99383693-99383715 CAGAATAAAGAGTTTCAGGTGGG - Exonic
1013199707 6:107881507-107881529 TAGAATAAAAAGCACAAGGAGGG - Intronic
1013564274 6:111341842-111341864 CTGAATAAAGAGCAGCTCGCTGG + Intronic
1013871728 6:114770664-114770686 CAAAGTAAAGAGCTCCAGGAGGG + Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1014188513 6:118463700-118463722 CAGAAGTAAGAAGAGCAGGAAGG + Exonic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015507607 6:134005700-134005722 AAGGATAGAGAGCAGCAGAAGGG - Intronic
1015566965 6:134583302-134583324 CATAGTAAAGAGGAGCAGAAGGG - Intergenic
1015675330 6:135739888-135739910 TAGGATGAAGAGCAGAAGGAGGG + Intergenic
1015868445 6:137751804-137751826 AAGAATAAGCAGCAGCAGAAGGG + Intergenic
1016270588 6:142284307-142284329 AATAATAAAGAGCAACAGAAAGG - Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016722249 6:147313971-147313993 CAGAATAAAGTGCAGGAATAAGG - Exonic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017149193 6:151262863-151262885 TTGAAAAAAGAACAGCAGGAGGG - Intronic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1021083071 7:16386292-16386314 CAGACAAAAGAGCAGCAGAATGG - Intronic
1021609786 7:22445685-22445707 CAGATGCAAGAGCAGCAGGGAGG + Intronic
1022340109 7:29459885-29459907 AAGAGGAAAGAGGAGCAGGACGG + Intronic
1022448232 7:30487916-30487938 TAGTATAAAGAGCAACATGAAGG - Intergenic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023126160 7:36956270-36956292 CAGAATAAATAACATAAGGAAGG - Intronic
1023404708 7:39820617-39820639 AAGAGCAAAGAGCAGCAGGTCGG + Intergenic
1023549701 7:41356746-41356768 CAGAAAAGGGAACAGCAGGATGG - Intergenic
1024722616 7:52154592-52154614 CATAGTATAGACCAGCAGGAGGG - Intergenic
1024805257 7:53132004-53132026 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1024871684 7:53970640-53970662 TAGAACAAAAAGCAGGAGGAAGG - Intergenic
1025530414 7:61874267-61874289 CAGGATAAAAAACAGAAGGAAGG - Intergenic
1025804919 7:64821830-64821852 CCAAATAAAGAGCAGCATGATGG - Intronic
1025879348 7:65520015-65520037 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1025885147 7:65582916-65582938 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1026401827 7:70021682-70021704 CAGATTGAGGAGCAGCAGGAAGG - Intronic
1026702629 7:72660398-72660420 CAAAAAAAGGAGCAGCAGCATGG + Intronic
1028198521 7:87934494-87934516 CAGGACACAGAGCAGCAAGAAGG - Exonic
1028522312 7:91745791-91745813 TAGCATAAAGGGCAGGAGGAAGG - Intronic
1028828619 7:95302889-95302911 GAGAATAAACAGCAGAAGAACGG - Intronic
1029362776 7:100099428-100099450 AAAAAAAAAGAGCAACAGGATGG + Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031399639 7:121315869-121315891 CGGAGCAAAGAGCAGAAGGACGG - Intergenic
1031877866 7:127162416-127162438 CAGAAGAGAAAGCAGCAGAAAGG + Intronic
1032814335 7:135456283-135456305 CACAAAAACAAGCAGCAGGAAGG + Intronic
1032814558 7:135459313-135459335 CACAAAAACAAGCAGCAGGAAGG + Intronic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034859063 7:154580871-154580893 CAGAAGAAAGAGCAGCAAAAAGG + Intronic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1036005206 8:4654379-4654401 CAGAATAGAGAGCATCAGAGGGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036917736 8:12821027-12821049 CAGAATAAACAGCAGAATAAGGG - Intergenic
1037081654 8:14795106-14795128 CAGAATAAAGGTAAGTAGGAGGG + Intronic
1037423683 8:18731343-18731365 AAAAATAAAGACCAGAAGGATGG + Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037712509 8:21366515-21366537 CAGAATAAAGATCAAGAGTACGG + Intergenic
1038260558 8:25989834-25989856 CAGAAGCAACAGCAGCAGCAAGG + Intronic
1039376371 8:37038345-37038367 CAAAATAAATAACAACAGGAGGG + Intergenic
1040576263 8:48654109-48654131 CAGAGTGAGGGGCAGCAGGATGG + Intergenic
1041269117 8:56093676-56093698 CAGCAGAAAGAGCAGATGGAGGG - Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1042408861 8:68438894-68438916 CTCAAAAAAGAGCAGAAGGAAGG + Intronic
1042579152 8:70257513-70257535 AAGGAGAAAGAGCAGCAGGCAGG + Intronic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1043909289 8:85842036-85842058 AAGAATAAATAGCAGCGTGAAGG - Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1046102768 8:109633634-109633656 CAGAATAAAAACCACCTGGAGGG + Intronic
1046696436 8:117345125-117345147 CAGACAAAAGAGCACCAGCAGGG + Intergenic
1046957150 8:120073436-120073458 CACAATCACAAGCAGCAGGAGGG + Intronic
1046990706 8:120449693-120449715 AAGAATAAGGAGCAGCCAGAAGG + Intronic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049524506 8:143115904-143115926 CAGAAGAAAGAGGAGCTTGAAGG - Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1050862421 9:10450720-10450742 AAGAACAAAGGCCAGCAGGATGG - Intronic
1050892747 9:10845519-10845541 TAGAATAAAGAGCAAAAGAATGG - Intergenic
1050963212 9:11764892-11764914 GAAAATAGAGAGCAGAAGGATGG + Intergenic
1051004801 9:12330366-12330388 AAGAAACAAGAGCACCAGGAAGG + Intergenic
1051682121 9:19617957-19617979 TGGAATAAAGTGCTGCAGGAGGG + Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052882564 9:33612694-33612716 CAGGAAGAAAAGCAGCAGGAAGG - Intergenic
1055195115 9:73581554-73581576 GAGAAAAAGGAGGAGCAGGAGGG - Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1056094076 9:83233025-83233047 CAGAGTATGGAACAGCAGGAGGG - Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1059463734 9:114452178-114452200 CAGAAGATACAGCAGCATGAGGG - Intronic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059855485 9:118392775-118392797 CACAATAAAGGGCAGCACAAGGG - Intergenic
1060474548 9:123976859-123976881 CAGATTAGAGACCAGCAGAAGGG - Intergenic
1060476815 9:123993264-123993286 CAGATTAGAGACCAGCAGAAGGG + Intergenic
1060668052 9:125444966-125444988 CAGATAAATGAGCAACAGGAAGG + Intronic
1061597695 9:131642811-131642833 CAGACTGAAGAGCACCAGCAGGG - Intronic
1061764614 9:132873956-132873978 CAGAGTAAACTGCACCAGGAAGG + Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062128689 9:134880859-134880881 CAGGAAAGAGAGCAGCAGGGTGG - Exonic
1062536691 9:137024186-137024208 CAGGATAAAGAACAGCACCAGGG + Exonic
1062541728 9:137044555-137044577 CAGGAACAAGAGCAGCTGGACGG + Intronic
1203581732 Un_KI270746v1:13098-13120 GAAAATAAAGAGGAGAAGGACGG + Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1187221327 X:17328981-17329003 GACAATAGATAGCAGCAGGAAGG - Intergenic
1187823311 X:23311136-23311158 GAGAACAAATAGCAGCAAGAGGG - Intergenic
1189088991 X:38058396-38058418 AAGAATAAAGAGCAGTGGAAAGG - Intronic
1189118357 X:38367307-38367329 CAAAATAAAGTGCAGCTGAAGGG + Exonic
1189567864 X:42261956-42261978 GAGAATAAATGGCAGAAGGAAGG - Intergenic
1189896561 X:45662994-45663016 CAGAATAAAGGGAAGCTGGCTGG - Intergenic
1190093753 X:47462532-47462554 CAGAACAAGGATCAGCTGGAGGG - Intronic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190942975 X:55061386-55061408 GAGAGTAGAGAGCAGGAGGAGGG - Intergenic
1191832576 X:65430853-65430875 GAGAATGAAGAAAAGCAGGATGG - Intronic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192292666 X:69814693-69814715 GAGAATGAAGAAAAGCAGGATGG + Intronic
1192598416 X:72436611-72436633 GAAAAAAAAGAGCATCAGGAAGG + Intronic
1194491538 X:94555949-94555971 CAGAATAAAAAGCAGGCAGAAGG + Intergenic
1194950146 X:100116013-100116035 CAGAAGAAAAAGCAGCTGAAAGG + Intergenic
1195640470 X:107169255-107169277 AAGAATAAGGTACAGCAGGAAGG + Intronic
1196235903 X:113279281-113279303 CAGAATAAAGAAAGGAAGGAAGG + Intergenic
1197023730 X:121721583-121721605 CAAAATGAAGAGCAGCAGAAAGG - Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197882470 X:131181349-131181371 CAGAAGGAAGAGAAACAGGAAGG - Intergenic
1199201090 X:145089765-145089787 AAGAATACAGAGCAGCAAGATGG + Intergenic
1199548837 X:149036052-149036074 CAGAATGATGAGTAACAGGATGG - Intergenic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic