ID: 950184617

View in Genome Browser
Species Human (GRCh38)
Location 3:10937530-10937552
Sequence ACTCCAGGCTGGGATCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 355}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950184617_950184635 25 Left 950184617 3:10937530-10937552 CCCCCCAGATCCCAGCCTGGAGT 0: 1
1: 0
2: 2
3: 42
4: 355
Right 950184635 3:10937578-10937600 CAGATGAAGCTGAGGGATAGGGG 0: 1
1: 0
2: 3
3: 30
4: 310
950184617_950184634 24 Left 950184617 3:10937530-10937552 CCCCCCAGATCCCAGCCTGGAGT 0: 1
1: 0
2: 2
3: 42
4: 355
Right 950184634 3:10937577-10937599 GCAGATGAAGCTGAGGGATAGGG 0: 1
1: 0
2: 2
3: 27
4: 272
950184617_950184632 18 Left 950184617 3:10937530-10937552 CCCCCCAGATCCCAGCCTGGAGT 0: 1
1: 0
2: 2
3: 42
4: 355
Right 950184632 3:10937571-10937593 GGGAGTGCAGATGAAGCTGAGGG 0: 1
1: 0
2: 1
3: 38
4: 365
950184617_950184633 23 Left 950184617 3:10937530-10937552 CCCCCCAGATCCCAGCCTGGAGT 0: 1
1: 0
2: 2
3: 42
4: 355
Right 950184633 3:10937576-10937598 TGCAGATGAAGCTGAGGGATAGG 0: 1
1: 0
2: 3
3: 28
4: 309
950184617_950184631 17 Left 950184617 3:10937530-10937552 CCCCCCAGATCCCAGCCTGGAGT 0: 1
1: 0
2: 2
3: 42
4: 355
Right 950184631 3:10937570-10937592 GGGGAGTGCAGATGAAGCTGAGG 0: 1
1: 0
2: 1
3: 46
4: 421
950184617_950184628 -2 Left 950184617 3:10937530-10937552 CCCCCCAGATCCCAGCCTGGAGT 0: 1
1: 0
2: 2
3: 42
4: 355
Right 950184628 3:10937551-10937573 GTCTTCTCCCAGGAAACTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 194
950184617_950184626 -4 Left 950184617 3:10937530-10937552 CCCCCCAGATCCCAGCCTGGAGT 0: 1
1: 0
2: 2
3: 42
4: 355
Right 950184626 3:10937549-10937571 GAGTCTTCTCCCAGGAAACTTGG 0: 1
1: 0
2: 2
3: 19
4: 181
950184617_950184627 -3 Left 950184617 3:10937530-10937552 CCCCCCAGATCCCAGCCTGGAGT 0: 1
1: 0
2: 2
3: 42
4: 355
Right 950184627 3:10937550-10937572 AGTCTTCTCCCAGGAAACTTGGG 0: 1
1: 0
2: 1
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950184617 Original CRISPR ACTCCAGGCTGGGATCTGGG GGG (reversed) Intronic
900114560 1:1022990-1023012 CCACCAGGCTGGGGTCAGGGAGG - Intronic
900122449 1:1054619-1054641 ACTCAAGGGTGGGCGCTGGGGGG - Intronic
900945655 1:5830132-5830154 ACTCCTCACTAGGATCTGGGAGG - Intergenic
901638174 1:10679981-10680003 ACTCCTGGCTGGACTCTAGGGGG + Intronic
901801796 1:11712455-11712477 GCACCAGGCTGGGTACTGGGAGG + Intronic
902176988 1:14657755-14657777 GTTCCAGGCTGTGCTCTGGGGGG - Intronic
902361072 1:15942966-15942988 ACCCGAGGCTGGGGTCTGGGGGG + Intronic
903005270 1:20294059-20294081 ACTTCATGCCGGGCTCTGGGCGG + Intronic
903284349 1:22267761-22267783 ACGTCAGGCTGGGATCTCCGAGG + Intergenic
904424500 1:30414764-30414786 TCTACAGGCTGGGACCTGGGAGG + Intergenic
904485447 1:30821971-30821993 ACTCCAAGTTGGGAGCTGGCAGG + Intergenic
907430270 1:54407018-54407040 GCTCCACGCTGAGAGCTGGGCGG + Intronic
907439664 1:54471431-54471453 ACTCCAGGGAGGGTGCTGGGAGG + Intergenic
907526767 1:55058234-55058256 AGTCCAGGCTGGGGCTTGGGAGG + Intronic
907781725 1:57573118-57573140 ACTCCAGCCTGGGAGATGGAGGG - Intronic
907869657 1:58431877-58431899 ACTCCAGGCTGAGAACTCAGAGG + Intronic
908551985 1:65217605-65217627 ACTCCAGGTTTGGCTCTGGTGGG - Intronic
911591725 1:99755392-99755414 ACTCCAGCCTGGGGTCGGAGGGG + Intronic
911602994 1:99867443-99867465 ACCCCAGGCTGGGAGTTGGGAGG - Intronic
912004213 1:104877370-104877392 ACTCCAAGATGAGATTTGGGTGG - Intergenic
912044139 1:105433951-105433973 TCACCAGGCTGGGAGCTGTGAGG - Intergenic
912521719 1:110250289-110250311 CCTCCAGGCTGCCATCTGGTAGG + Intronic
912870228 1:113297177-113297199 TCTACACGCTGGGACCTGGGGGG + Intergenic
912946523 1:114089324-114089346 ACTCCAGGCTGTGACACGGGTGG + Exonic
916007771 1:160677721-160677743 ACTACAGGCTGGGCTCAGGGTGG + Intergenic
917163062 1:172080014-172080036 ACCCCCGGCTGGCATCTGGTGGG - Intronic
919936005 1:202251484-202251506 GCTCCAGGTTGGGGTATGGGGGG + Intronic
919970312 1:202572542-202572564 ACTCCAATCTAGGATCTGGGTGG - Intronic
920059200 1:203215978-203216000 ACTCCAAGCTGGTTTCTGGTTGG - Intronic
920656032 1:207875813-207875835 GCTGCAGGCAGGGCTCTGGGAGG - Intergenic
921597437 1:217069830-217069852 AATCCAGGCTGGGGCCTGGAGGG - Intronic
922351030 1:224734759-224734781 ATTTCAGGCTGGCCTCTGGGAGG + Intronic
922812188 1:228423282-228423304 ACCCCATGCTGGGATCATGGAGG - Intergenic
922983796 1:229850767-229850789 CCTGCAGCCTTGGATCTGGGTGG + Intergenic
923901418 1:238329810-238329832 ATTGCAGGCTGGGATTTGGAAGG - Intergenic
924816677 1:247448097-247448119 ACTCCAGGCTGGGGTCCTGGGGG + Intronic
1062785554 10:261698-261720 ACTCCAGCCTGGCAACAGGGTGG + Intergenic
1062965493 10:1604406-1604428 TCTCCAGGCTGGGAACAGGCAGG + Intronic
1064239637 10:13614659-13614681 ACTCCTGAATGGGCTCTGGGAGG + Intronic
1064865471 10:19873977-19873999 ACTTCAGGTGTGGATCTGGGTGG + Intronic
1065311100 10:24416701-24416723 GCTGCAGGCTGGGATGTGGGGGG - Intronic
1066608941 10:37214797-37214819 GATCCAGGCTGGGATCTGGCTGG - Intronic
1067461679 10:46462791-46462813 ACCCAAGGCTGGTATCTGGAGGG + Intronic
1067625515 10:47921810-47921832 ACCCAAGGCTGGTATCTGGAGGG - Intergenic
1069775696 10:70925943-70925965 ACTGTAGGCTGGGATGGGGGTGG - Intergenic
1069800906 10:71080897-71080919 AGGCCAGGCTGGGAACAGGGTGG - Intergenic
1069887640 10:71634118-71634140 CCTCCAGGCAGGGAGCAGGGAGG - Intronic
1070179085 10:73997784-73997806 CCTCCCGCCTCGGATCTGGGGGG - Intergenic
1070575257 10:77672632-77672654 AATTCAGTCTGGGCTCTGGGAGG + Intergenic
1071570659 10:86694966-86694988 AATCCCCGCTGGGATTTGGGAGG - Intronic
1071951702 10:90710371-90710393 ACTCCAGCCTGCAATCTGTGAGG - Intergenic
1072267009 10:93740519-93740541 ACTCCAGACAGTGATTTGGGTGG - Intergenic
1072525686 10:96269588-96269610 ACTGGAGGCAGGGATCTGGTGGG - Intronic
1073140168 10:101242070-101242092 GCTTCAGGCTGTGATTTGGGAGG - Intergenic
1073143197 10:101262315-101262337 ACTTGAGGCAGGGATCTGGCAGG + Intergenic
1073151385 10:101313933-101313955 ACTCCAGCCTGGGGGTTGGGGGG - Intergenic
1073154944 10:101338948-101338970 ACTCCAGCCTGGGCGATGGGAGG - Intergenic
1073291742 10:102416647-102416669 AGTCGGAGCTGGGATCTGGGTGG - Exonic
1073703147 10:105953026-105953048 ATTTCAGGCTGGGAACTAGGTGG - Intergenic
1074721286 10:116267431-116267453 ACTCCAGCCTGGGCCCTGGGTGG + Intronic
1075899847 10:126032388-126032410 ACTCCAGGCTGGTGTCTGTCTGG - Intronic
1075959566 10:126556844-126556866 ACTCCAAGCTGTGACCTGTGGGG + Intronic
1076702613 10:132282019-132282041 CCTCCAGGCCGGGATCAGGGAGG - Intronic
1077349296 11:2084842-2084864 ACACCGGGGTGGGAACTGGGAGG + Intergenic
1078971743 11:16421091-16421113 ACTCCAGGTTGAGTTCTGAGAGG - Intronic
1080455678 11:32416597-32416619 ACTGGATTCTGGGATCTGGGGGG - Intronic
1082098341 11:48150225-48150247 AACCCAAGCTGGGATCTGAGGGG + Intronic
1083633858 11:64109647-64109669 CCTCCAGGCTGGGGGCAGGGTGG - Intronic
1083877429 11:65531715-65531737 CCACCAGGTTGGGGTCTGGGTGG - Intronic
1084566136 11:69930175-69930197 ACTCCAAGCTGGGATGGGGGTGG + Intergenic
1084701436 11:70788719-70788741 ACCCCAGGGTTGGATTTGGGAGG + Intronic
1085520579 11:77136927-77136949 ACACCAGGCTGGGAGCTCTGAGG + Intronic
1085990733 11:81840163-81840185 AATTCAAGCTGGGATCTGAGTGG + Intergenic
1086435310 11:86774240-86774262 TTTCCAGGCTGGATTCTGGGAGG - Intergenic
1087539816 11:99502331-99502353 AATCCAAGCTGAGATTTGGGTGG - Intronic
1089162009 11:116445554-116445576 ACACAAGGCTGTGCTCTGGGTGG + Intergenic
1090248705 11:125236312-125236334 TCTCCAGGCTGGGGTGTTGGGGG + Intronic
1091782499 12:3222816-3222838 ATCCCAGGGTGGGACCTGGGGGG - Intronic
1092719325 12:11425219-11425241 ACTGCAAGCTGGGAGGTGGGAGG - Intronic
1093045663 12:14441520-14441542 ACTCCAGCCTGGGAATTGGCAGG - Intronic
1094064729 12:26350660-26350682 AGTCCAGGCTGTTGTCTGGGGGG - Intronic
1096228750 12:49885758-49885780 CCTCCAGGCTTGGAACTGGAGGG - Intronic
1096981108 12:55728666-55728688 TCTCCAGGCTGGGTGTTGGGTGG - Intronic
1097029611 12:56081395-56081417 ACCCCAAGCTGAGATCTGAGGGG - Intronic
1097347560 12:58510990-58511012 CCTCCAGGATGAGATTTGGGTGG - Intergenic
1098224802 12:68310503-68310525 AATCCAGGCTGCCATCTGGAAGG - Intronic
1101038190 12:100725986-100726008 AACCCAGGCTGGGTTCTGAGGGG - Intronic
1101490514 12:105205482-105205504 AGTCCAGGCTGGGAGCAGTGAGG + Intronic
1103226225 12:119290399-119290421 ACTTCAAGATGAGATCTGGGTGG + Intergenic
1103402086 12:120650065-120650087 ACACAAGGCTGGGAGCTGTGCGG + Intronic
1103833192 12:123797204-123797226 TCTCCTGGATGGGATCGGGGAGG - Intronic
1104270508 12:127278636-127278658 ACTCCACTCTGAGCTCTGGGAGG - Intergenic
1104442402 12:128804695-128804717 ACTCCAGCCTGGGTGATGGGAGG + Intronic
1105214542 13:18276665-18276687 ACTTCAGGCTGGGGGCTGGCAGG - Intergenic
1106015228 13:25863124-25863146 ACTCCAGGGTGGGGTCTCTGGGG - Intronic
1107035152 13:35894461-35894483 ACTCCAGCCTGGGAACAGGTGGG + Intronic
1107691191 13:42955260-42955282 CCTCCAGGGTGGGGACTGGGGGG + Intronic
1108096511 13:46907410-46907432 ACTCCAGCCTGGGTGCTGGAGGG - Intergenic
1109681153 13:65755285-65755307 AATTCAGGATGGGATTTGGGTGG - Intergenic
1110516675 13:76420942-76420964 ACTCGAATCTGGAATCTGGGAGG - Intergenic
1110772663 13:79367372-79367394 ACTCCAGCCTGGGGTATAGGGGG + Intronic
1111392050 13:87609121-87609143 AATCAAGGCTGGGATATGGAAGG - Intergenic
1111392481 13:87615227-87615249 ACTTCAGGTTGGGAAGTGGGTGG - Intergenic
1114636152 14:24188128-24188150 GCTCCAGGCTGGGACTTGTGGGG - Intronic
1117092191 14:52262519-52262541 AGTCCTGAATGGGATCTGGGTGG - Intergenic
1118037059 14:61879157-61879179 ATTCCAAGCTGGGATATGGCTGG - Intergenic
1118215037 14:63800804-63800826 ACTTGAGGGTGGAATCTGGGAGG + Intergenic
1118500363 14:66356616-66356638 GCTCCAGCCTGTGCTCTGGGTGG - Intergenic
1118764974 14:68903730-68903752 GCTCCAGGCTGGGGTCAGGCTGG - Intronic
1119214112 14:72855593-72855615 ACTCCAGGCTGGAATGGGGAAGG - Intronic
1119589068 14:75868006-75868028 TCTCCATGCTGGGGTCTGTGAGG + Intronic
1120307340 14:82787339-82787361 AATCCAGGATGAGATTTGGGTGG + Intergenic
1120918033 14:89727357-89727379 GCTCCAGACTGGAGTCTGGGAGG - Intergenic
1121471289 14:94156346-94156368 ACTACAGGTTGAGATTTGGGTGG - Intronic
1121671004 14:95710753-95710775 CCACCACGCTGGGGTCTGGGAGG - Exonic
1122035301 14:98944832-98944854 TCTCCAGGTTGGGAACAGGGTGG - Intergenic
1122632688 14:103114193-103114215 AGGCCAGGCTGAGATTTGGGTGG - Intergenic
1122859950 14:104578034-104578056 ACTCCAGCCTGGGCTCTGCAGGG - Intronic
1123176494 14:106423887-106423909 CCTTCAGGGTGGGAGCTGGGTGG - Intergenic
1202848777 14_GL000225v1_random:2376-2398 ACTCCATGGTGGCAGCTGGGAGG - Intergenic
1202947183 14_KI270726v1_random:39680-39702 CCTTCAGGGTGGGAGCTGGGTGG + Intergenic
1126110787 15:45173585-45173607 CCTCCAGGCTGGGCTCAGGGAGG + Exonic
1126666935 15:51083808-51083830 ACCCCAGGCAGGGGGCTGGGCGG + Intronic
1126677471 15:51172916-51172938 ACTCCAGCCTGGAGCCTGGGCGG + Intergenic
1126859509 15:52870409-52870431 ACCTCAGTTTGGGATCTGGGCGG + Intergenic
1127387908 15:58482206-58482228 TCTCTAGGCTGGAAACTGGGTGG - Intronic
1127622596 15:60748663-60748685 AAACCAGGCTGAGACCTGGGAGG - Intronic
1128771905 15:70289197-70289219 ATTCCAGGCAGGGATCTATGGGG - Intergenic
1130380193 15:83365411-83365433 ACTCAAGCTGGGGATCTGGGCGG - Intergenic
1130967630 15:88709002-88709024 ACTCCAGTCTAGTAACTGGGAGG - Intergenic
1131207179 15:90460314-90460336 ATTCCTGGATGGGATCTAGGAGG - Intronic
1132637605 16:960084-960106 ACTTCAGTCTGGGCACTGGGAGG - Intronic
1132760476 16:1506399-1506421 AGTTCGGGCTGGGATCTGAGTGG + Intronic
1133013756 16:2929544-2929566 ACTCTAGACGTGGATCTGGGAGG - Intronic
1135322148 16:21504116-21504138 ACTCCAGGCTGGGCTGCGGAGGG + Intergenic
1136248698 16:28989766-28989788 ACTCCCGGCTGCCATCTGTGGGG - Exonic
1138413178 16:56855487-56855509 ACTCCAGGCTGGGGCCATGGTGG - Intergenic
1140230927 16:73116492-73116514 ACTCCAGGCTGGGAAGCTGGAGG + Intergenic
1141797847 16:86286798-86286820 ACCCAAGACGGGGATCTGGGAGG + Intergenic
1141996377 16:87638826-87638848 ACGCCAGGCTGGGGTCAGGAAGG - Intronic
1142237114 16:88927570-88927592 ATGCCAGGCTGGTACCTGGGTGG - Intronic
1142273228 16:89101915-89101937 ACAGCAGGCTGGGCCCTGGGTGG + Intronic
1142552285 17:748230-748252 TCTCCAGCCTGGGAACTGGGAGG + Intronic
1142603803 17:1070699-1070721 ACTCTAACCTGGGCTCTGGGTGG + Intronic
1143117547 17:4589298-4589320 GGTCCAGGCGGGGCTCTGGGGGG - Intronic
1143730809 17:8881698-8881720 CCTCCATGCTGGAATCTGAGGGG + Exonic
1144209404 17:13002037-13002059 ACTCCAGGCTGGGTTGAGGTGGG - Intronic
1144625554 17:16842717-16842739 AGCTCAAGCTGGGATCTGGGGGG - Intergenic
1144880876 17:18430003-18430025 AGCTCAAGCTGGGATCTGGGGGG + Intergenic
1145151358 17:20514384-20514406 AGCTCAAGCTGGGATCTGGGGGG - Intergenic
1146162708 17:30568634-30568656 AGCTCAAGCTGGGATCTGGGGGG - Intergenic
1146176192 17:30667824-30667846 TCTCCAGGCTGGGCGCGGGGAGG + Intergenic
1146349650 17:32083935-32083957 TCTCCAGGCTGGGCGCGGGGAGG + Intergenic
1146417965 17:32654709-32654731 ACTCCAGCCTGGGAGATGGAGGG - Intronic
1147947028 17:44086191-44086213 GCCACAGGCTGGGCTCTGGGGGG - Intronic
1148462249 17:47845519-47845541 AGTGGGGGCTGGGATCTGGGTGG - Exonic
1148655805 17:49282544-49282566 ATTCCAAGGTGGGATGTGGGTGG - Intergenic
1149840918 17:59964510-59964532 ACTCGAGGCTCGGACGTGGGTGG - Intronic
1150065847 17:62108819-62108841 CCTGCAGGCTGCCATCTGGGAGG - Intergenic
1151433670 17:74081353-74081375 AGTCCGGGCTGGGAGCTGGGAGG - Intergenic
1151451929 17:74203383-74203405 AAGCCAGGCTGGGGTCTGAGGGG + Intergenic
1151485802 17:74398758-74398780 ACTCCAGCCTGGGCCCTGGGTGG + Intergenic
1151723743 17:75873146-75873168 ACTCCTGCCTGGGTTCTGTGTGG - Intergenic
1151963353 17:77419001-77419023 GCTTCAGGCTGGGCTTTGGGAGG - Intronic
1151964316 17:77423439-77423461 CCTCCAGGCCGCCATCTGGGTGG - Intronic
1152091483 17:78249989-78250011 CCTCCATGCTGGGCTCTGGGAGG + Intergenic
1152278665 17:79372564-79372586 CATCCTGGCAGGGATCTGGGGGG - Intronic
1152363760 17:79843989-79844011 CCGCGAGGCTGGGAGCTGGGAGG - Intergenic
1152623159 17:81375982-81376004 ACTCCAGGCTGAAAGCTGGCAGG - Intergenic
1154330661 18:13426616-13426638 ACTCAAGGCTGGGATCAAAGTGG - Intronic
1154482505 18:14847330-14847352 GATCCAGGCTGGTATCTGGCTGG - Intronic
1154989320 18:21585375-21585397 ACTATAGGCTGGCATCTGGTTGG - Intronic
1157235309 18:45959611-45959633 ACTCCAGTCTGGGGTGGGGGCGG + Intronic
1158627854 18:59087304-59087326 ACTCCTGGCTGCAAGCTGGGAGG + Intergenic
1159579410 18:70218404-70218426 GCTACAGGATGGGATTTGGGTGG + Intergenic
1159960967 18:74555497-74555519 ACTCCAGACAGGGCTCTGGGGGG + Intronic
1160708993 19:542174-542196 ACGCCAGGTGTGGATCTGGGAGG + Intergenic
1161260557 19:3335543-3335565 CAGCCAGGCTGGGAGCTGGGGGG + Intergenic
1161475094 19:4480332-4480354 ATGCCAGCCTGGGAGCTGGGGGG - Intronic
1162067233 19:8133189-8133211 ACTCCAGGGAGGGATCCTGGGGG - Intronic
1162546468 19:11333724-11333746 ACTCCAGCCTGGGCAATGGGGGG - Intronic
1162639280 19:11995330-11995352 ACTTCAGGCTGTGCTCTGGGAGG - Intergenic
1163148574 19:15398471-15398493 ACTCCAGGCTGCCCTCTGGCAGG - Intronic
1163612588 19:18309031-18309053 ACTCCAGGCAGGGAGCTTTGGGG - Intronic
1165329765 19:35135112-35135134 ACTACAGGCAGGGAGCTGGAAGG - Exonic
1165354016 19:35292566-35292588 CCTGCAGGCTGCAATCTGGGAGG + Intronic
1166056712 19:40294280-40294302 TCTACAGGCAGAGATCTGGGGGG - Intergenic
1166740507 19:45112088-45112110 AATCCCAGCTGGGATTTGGGAGG - Intronic
1167074999 19:47243243-47243265 GCTCCGGGCTGGGGGCTGGGAGG + Intergenic
1168134601 19:54342014-54342036 AATCCAAGGTGGGATTTGGGTGG + Intergenic
1168450946 19:56466249-56466271 ACTACAGGTTGGGTCCTGGGAGG + Intronic
925069094 2:951748-951770 ACTCGAGGCTGTGCTGTGGGTGG - Intronic
925392422 2:3505616-3505638 CCAGCAGGCTGGGATCTGGCTGG - Intronic
925661616 2:6209172-6209194 CCTCCAGGCTGTGATGTGAGGGG - Intergenic
926055094 2:9769714-9769736 GCTCCAGGATGGGAGCGGGGGGG + Intergenic
926177847 2:10612533-10612555 ACTCCAGCCTGGGATACGGATGG - Intronic
926274611 2:11394057-11394079 TTTCCCTGCTGGGATCTGGGTGG + Intergenic
926430385 2:12779431-12779453 AACCCAGGCTGGCATGTGGGGGG - Intergenic
926776950 2:16432295-16432317 TCTTCAGGCTGGGAACTGAGTGG - Intergenic
928712156 2:34019261-34019283 ACTGCAGGCGGGGATCATGGAGG - Intergenic
928981425 2:37139399-37139421 ACTCCAGGCTGGGCTGGGTGTGG - Intronic
930033351 2:47071274-47071296 ACACCAGGCTGGGGTCAGGCTGG - Intronic
930192021 2:48469206-48469228 AATTCAGGCTGAGATTTGGGTGG + Intronic
930525098 2:52519196-52519218 AATTCAGGATGAGATCTGGGTGG - Intergenic
931193598 2:60028768-60028790 ACTGCAGCCTGAGATCTGAGGGG + Intergenic
931431133 2:62209789-62209811 ACTGCAGGCTGTGATGTTGGAGG + Intronic
931484211 2:62673838-62673860 ACTCCAGGGTGTTAACTGGGAGG + Intronic
932278966 2:70473098-70473120 ACTCCAGCCTGGCCTCAGGGTGG - Intronic
934299781 2:91770074-91770096 ACTCCAGGCTGGGGGCTGGCAGG + Intergenic
934765435 2:96877768-96877790 GCTCCTGGCAGGGATATGGGTGG - Intronic
935391525 2:102558244-102558266 ATTCCAGGCTGGGCATTGGGAGG + Intergenic
936912440 2:117606799-117606821 ACTCTAGGCTGGGACATGTGGGG - Intergenic
937320249 2:120956656-120956678 ACCCCAGGCAGGGCTCCGGGAGG - Intronic
938256144 2:129861497-129861519 AATTCAGTTTGGGATCTGGGTGG - Intergenic
938733005 2:134160938-134160960 ACTTCAGGCTAGGATCTGCCAGG + Intronic
939369190 2:141276442-141276464 ACTTGAGGCTGGGAGGTGGGAGG - Intronic
941057529 2:160806100-160806122 ACTACAGGATGAGATTTGGGTGG + Intergenic
941527199 2:166620992-166621014 ACTCCAGCCTGGGAGAGGGGAGG - Intergenic
941993501 2:171579349-171579371 ACTCCAGCCTGGGCTATGAGAGG - Intergenic
944647654 2:201795640-201795662 ACTAGGGGCTGGGAGCTGGGAGG + Intronic
945140413 2:206680370-206680392 AATTCAGGATGGGATTTGGGTGG + Intronic
946195233 2:218028755-218028777 GCACCAGGCTGGGGTCTTGGGGG + Intergenic
947742932 2:232493102-232493124 GCTCCGGGCTGGGCACTGGGGGG - Intergenic
948625003 2:239263363-239263385 TCTCCAGGCAGGGGACTGGGCGG - Intronic
948664599 2:239527061-239527083 GGTCCAGGCTGGTATCAGGGAGG - Intergenic
948811314 2:240479851-240479873 ACTCCAGGATGGGACTTGGTGGG - Intronic
1170206701 20:13806474-13806496 ACTCCAGCCTGGGCGCTGGGTGG + Intronic
1170582573 20:17710322-17710344 GCTGCAGGCTGAGGTCTGGGTGG - Intronic
1171431290 20:25084544-25084566 ACTTGACGCTGGGCTCTGGGTGG - Intergenic
1171463393 20:25311415-25311437 CCCCCAGGCTGGAATCAGGGTGG - Intronic
1171970680 20:31563123-31563145 ACATCAGGCTGGGCCCTGGGTGG + Intronic
1172466179 20:35156445-35156467 ACTTGAGCCTGGGATGTGGGAGG - Intergenic
1172537027 20:35681942-35681964 ACACCAGGCTAGTATCTGGCTGG + Exonic
1172911890 20:38415666-38415688 AATCCAGGGTGAGATTTGGGTGG - Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173479632 20:43388970-43388992 ACTCCAGACTGTGATTTGGGTGG - Intergenic
1173557146 20:43974196-43974218 ACTCTAGGCTGAGATCAGGGAGG + Intronic
1173859529 20:46273805-46273827 ACTCAAGGCTGGAATGTGTGAGG + Intronic
1174619638 20:51864305-51864327 GCTCCAAGCTCAGATCTGGGTGG + Intergenic
1175136531 20:56828497-56828519 ACTCCAGTGTGGGAGGTGGGTGG + Intergenic
1176798096 21:13389294-13389316 GATCCAGGCTGGTATCTGGCTGG + Intergenic
1176971486 21:15271153-15271175 AATTCAGGCTGAGATTTGGGTGG - Intergenic
1177256903 21:18675718-18675740 ACTCAAGGCTAGGATCAGGGAGG + Intergenic
1178283909 21:31308897-31308919 ACTAAAGGCTGGGAGTTGGGGGG + Intronic
1178339983 21:31778103-31778125 AATTCAGGGTGAGATCTGGGTGG - Intergenic
1179035630 21:37756718-37756740 ACTCCGGGCTTGAATCTGTGAGG - Intronic
1179035641 21:37756786-37756808 ACTCCGGGCTGGAATCTGTGAGG - Intronic
1179035660 21:37756931-37756953 ACTCTGGGCTGGAATCTGTGAGG - Intronic
1179035672 21:37756999-37757021 ACTCCAGGCTCGAATCTTTGAGG - Intronic
1179035690 21:37757144-37757166 ACTCCAAGCTGGATTCTGTGAGG - Intronic
1179035747 21:37757584-37757606 ACTCCGGGCTGGAATCTGTGAGG - Intronic
1179035759 21:37757653-37757675 TCTCCAGGCTGGAATCTGTGAGG - Intronic
1179298144 21:40081587-40081609 AATACAGGCTGGGATGTGGCTGG - Intronic
1180092904 21:45542044-45542066 TCTGCAGCCTGGGGTCTGGGGGG - Intronic
1180092929 21:45542104-45542126 TCTGCAGCCTGGGGTCTGGGGGG - Intronic
1180613067 22:17109838-17109860 TCTCAAAGCTGGGATCTGGGCGG - Exonic
1181312421 22:21952540-21952562 ACCCGAGGCTGGGAGTTGGGGGG - Intronic
1181556213 22:23673118-23673140 ACTCCAGGCTGGGGGCTGGCAGG - Intergenic
1181698135 22:24604170-24604192 ACTCCAGGCTGGGGGCTGGCAGG + Intronic
1183107489 22:35625060-35625082 GCTCCGTGCTGGGCTCTGGGGGG + Intronic
1183955468 22:41377878-41377900 GCTCCAGGCTGGGAGATGAGTGG + Intronic
1184101143 22:42342342-42342364 TCTCCAGGGTGGGTACTGGGTGG + Intronic
1184254036 22:43276953-43276975 ACCCCAGGCTGGACACTGGGGGG + Intronic
1184944749 22:47795228-47795250 ACACCAGGCATGGTTCTGGGAGG + Intergenic
1184972689 22:48037797-48037819 CCTCCAGGCTGGTTCCTGGGAGG - Intergenic
1185418240 22:50721318-50721340 AATCCAGGCTGGGCTCCGTGGGG - Intergenic
949873154 3:8606497-8606519 ACTCTAGACTGGGCCCTGGGAGG - Intergenic
949917319 3:8975177-8975199 ACTCCAGGCTGGGATTTGTGGGG - Intergenic
950184617 3:10937530-10937552 ACTCCAGGCTGGGATCTGGGGGG - Intronic
950437242 3:12987263-12987285 ACTGCAGGCTGTGGGCTGGGAGG - Intronic
950502712 3:13374618-13374640 ACTCCAGCCTGAGCTCTGGGAGG - Intronic
951110348 3:18796104-18796126 TATCCAGGCTGGGCTCTGGTAGG + Intergenic
952326684 3:32326454-32326476 ACTCCAGGCCGGGATGAGGCTGG - Intronic
953708517 3:45249456-45249478 ACTCCAGGCTGTAATGTGGAAGG + Intergenic
953890488 3:46748765-46748787 GCTCCAGGCTGGGAACAGAGTGG - Intronic
954155889 3:48684837-48684859 ACTCCAGGCTGGGAACAAGTAGG + Intronic
954315872 3:49801464-49801486 ACTGGAGCCTTGGATCTGGGAGG - Intergenic
954316974 3:49806502-49806524 AGACAAGGCTGGGAGCTGGGGGG + Intronic
954384759 3:50238217-50238239 ACTCCTGGCTGGGCACTGGGAGG - Intronic
954386817 3:50248481-50248503 GCCCCAGGATGGCATCTGGGTGG - Intronic
955349122 3:58180940-58180962 GCCCCAGGCTGGGAGCTGGGAGG - Intergenic
961321883 3:126082582-126082604 ACCCCATGCTGGCAGCTGGGAGG - Intronic
961329184 3:126128842-126128864 ACCCCATGCTGGCAGCTGGGAGG + Intronic
964868590 3:161288983-161289005 ACTCCAGGCAAGGATCTCCGTGG - Intergenic
966328040 3:178779090-178779112 AATCCAGACTTGGGTCTGGGAGG - Intronic
967215562 3:187206999-187207021 CTTCCAGGCTGGGGTCTTGGTGG + Intergenic
967727877 3:192878929-192878951 ACTCCAGCCTGGGCTATGGAGGG + Intronic
968529951 4:1086506-1086528 CCTCCAGGCAGGGTTTTGGGTGG + Intronic
968973561 4:3809623-3809645 AGACCAGGCTGGGCTCTGGATGG + Intergenic
970269004 4:14322918-14322940 AATCCAGGCTGGGGTCTGTGAGG + Intergenic
970571544 4:17388093-17388115 AATCCAAGCTGAGATTTGGGTGG + Intergenic
970803225 4:20001613-20001635 GCTACAAGCTGAGATCTGGGTGG - Intergenic
978045126 4:104115778-104115800 AATTCAGGGTGGGATTTGGGTGG + Intergenic
978368981 4:108011493-108011515 AATTCAGGGTGAGATCTGGGTGG + Intronic
978521443 4:109619672-109619694 ACTCCAGCCTGGTGACTGGGTGG + Intronic
979118226 4:116855788-116855810 ACTGGAGGCAGGGAGCTGGGTGG - Intergenic
981426753 4:144612195-144612217 AATCCATGCAGGTATCTGGGTGG - Intergenic
982254578 4:153439675-153439697 ACTGCAGCCTGGGCACTGGGTGG - Intergenic
985228886 4:187793886-187793908 ACTGCAGCCTGGGCTCTTGGAGG - Intergenic
987425956 5:17772741-17772763 GCTCAAGGCTGGGATCTATGAGG + Intergenic
988133371 5:27136377-27136399 AATCCAAGATGAGATCTGGGTGG + Intergenic
988958778 5:36348304-36348326 ACTTCAGGCTGAGTCCTGGGTGG - Intergenic
994060492 5:95471613-95471635 ACTCTAGCCTGGGAGCTGAGGGG - Intronic
996081711 5:119264952-119264974 TCCCCAGGCTGGGGTCTGGAGGG - Intergenic
996776114 5:127134456-127134478 ACTCAAGGCTGGGCACTTGGTGG + Intergenic
997388385 5:133493534-133493556 ACTTAAGGCTGAGACCTGGGAGG - Intronic
998333886 5:141352953-141352975 ACTCCAGCCTGGGTGATGGGAGG + Intronic
1000740218 5:164959972-164959994 ACTCCAGCCTGGGTGATGGGAGG + Intergenic
1001034099 5:168284629-168284651 ACTCCAGCCTGGGATATGTGAGG - Intergenic
1001034737 5:168289700-168289722 ACTCCAGCCTGGGGGATGGGGGG + Intergenic
1001961056 5:175880552-175880574 TGGCCAGGCTGGGATCTGGGTGG + Exonic
1002089978 5:176798656-176798678 ACTTCAGGGTGGGATCTTGGAGG - Intergenic
1002334625 5:178469365-178469387 AGGCCAGGCTGGGACCAGGGAGG - Intronic
1002334829 5:178470468-178470490 GCTTCTGGCTGGGGTCTGGGTGG - Intronic
1006165395 6:32061676-32061698 CCTCCATGCTGGGTTCTGTGGGG + Intronic
1006166351 6:32067940-32067962 CCTCCATGCTGGGTTCTGTGGGG + Intronic
1006187852 6:32190744-32190766 ACTGCAGACTGGTATCTGGGGGG - Exonic
1006254245 6:32816937-32816959 TCTCCAGAATGGGTTCTGGGTGG - Exonic
1006388010 6:33742826-33742848 GCTCCTGGCTGAGATCAGGGTGG + Intronic
1006633270 6:35444520-35444542 ACTAGAGGCTGGGAGCGGGGAGG - Intergenic
1006731419 6:36239109-36239131 AGCCCATGCAGGGATCTGGGTGG - Intergenic
1007089253 6:39172059-39172081 ACCACACGCTGGGTTCTGGGAGG + Intergenic
1007465074 6:42046047-42046069 AGTCGAGGGTGGGAACTGGGTGG - Intronic
1007923341 6:45630371-45630393 ACTTTAGAGTGGGATCTGGGAGG - Intronic
1007924113 6:45637578-45637600 ACTGCATGCTGGGAGCTGGGGGG - Intronic
1007924982 6:45643202-45643224 ACCCCAGTCTGTGATGTGGGAGG - Intronic
1011031903 6:82932452-82932474 ACTCCATGCTGTGATCTGCTTGG + Intronic
1011597219 6:89027489-89027511 ACTCCAGCCTGGGGTCTAGAAGG - Intergenic
1016886328 6:148963170-148963192 ACTCCAGGCTGGGTTTTGAAAGG + Intronic
1017916564 6:158836135-158836157 AGGGCAGGCTGGGGTCTGGGAGG + Intergenic
1018048883 6:159990249-159990271 ACTACAAGCTGAGATTTGGGTGG - Intronic
1018888387 6:167961838-167961860 AGTCCAGGGTGGGATCTGGAGGG + Intronic
1019152945 6:170021009-170021031 ACTTCAGACTGGGCTCTGAGGGG - Intergenic
1021811327 7:24404374-24404396 ACTCCAGCCTGGGCGCTGGAGGG - Intergenic
1022504799 7:30903304-30903326 ACTCCAGGCTGGCATCACGGGGG - Intergenic
1022610913 7:31872207-31872229 ACTGGAGGCTGGGATGTGTGTGG + Intronic
1022906072 7:34858846-34858868 GCTACAGGATGAGATCTGGGGGG + Intronic
1024278489 7:47698377-47698399 AGGGCAGGCTGGGACCTGGGAGG + Intronic
1024326733 7:48114799-48114821 ACGCCAGGCTGGCCTCTGGAAGG + Intergenic
1025152068 7:56564562-56564584 ACTATAGGCTAGGATGTGGGAGG - Intergenic
1026146052 7:67747675-67747697 ACTCCTGGCTGGGAGCTGGGAGG + Intergenic
1026771953 7:73207798-73207820 TCTCCAGGATGGGTGCTGGGAGG - Intergenic
1027012821 7:74761194-74761216 TCTCCAGGATGGGTGCTGGGAGG - Intergenic
1027075219 7:75184859-75184881 TCTCCAGGATGGGTGCTGGGAGG + Intergenic
1027233834 7:76286511-76286533 TCCCCAGGCTGGGATTTTGGGGG - Exonic
1027268959 7:76510121-76510143 AACCCAGGCTGCGAACTGGGAGG + Intergenic
1032087555 7:128891748-128891770 ACTCCTGGCAGGGGTCTCGGGGG + Exonic
1033385686 7:140872828-140872850 ACTCCAGCCTGGGTGCTTGGAGG + Intronic
1033415360 7:141157004-141157026 ACTGAAAGCTGGGAGCTGGGTGG - Intronic
1033490503 7:141838665-141838687 ACTGCAGGGAGGGACCTGGGAGG - Intronic
1033650450 7:143338752-143338774 ACTCCAGCTTGGGTGCTGGGTGG + Intronic
1035125891 7:156607601-156607623 ACTCCGCGCTGGGAGCTGAGTGG - Intergenic
1035272356 7:157727993-157728015 TCTGCAGGGTGGGAGCTGGGGGG - Intronic
1037295050 8:17390916-17390938 AATCCAAGATGGGATTTGGGTGG + Intronic
1038352195 8:26786730-26786752 ACTCCATGCTGGGTTGGGGGGGG + Intronic
1041574805 8:59381586-59381608 ACCCCTGGCTGGCATCTGGCAGG + Intergenic
1043755979 8:84004726-84004748 ACCACAGGCTGGGAGGTGGGAGG + Intergenic
1048035554 8:130673973-130673995 ACTCCTGGCTGGGATGGGGATGG + Intergenic
1049007364 8:139863940-139863962 AGTCCTGGCTGGGAACTGTGGGG - Intronic
1049846205 8:144803043-144803065 ACTCCATCCTGTGATGTGGGTGG - Intronic
1050377234 9:4985500-4985522 CCTCCAGGCTGGGCCCTCGGGGG - Exonic
1050404559 9:5293759-5293781 ACCTCTGGCTGGCATCTGGGAGG + Intergenic
1050611720 9:7360673-7360695 ACTCCAGGCTGGGATTGGTGGGG + Intergenic
1050711709 9:8472937-8472959 ATACCAGGCTGTGATATGGGGGG + Intronic
1053287265 9:36857964-36857986 ACTCCATGTTGGTAACTGGGAGG + Intronic
1053353104 9:37425998-37426020 ACTGCAGCTTGGGATCTGGAGGG + Intronic
1054452540 9:65410944-65410966 AGTACAGGCTCGGTTCTGGGAGG + Intergenic
1055083330 9:72289651-72289673 ACTACAGTCTGAGATTTGGGTGG + Intergenic
1056149066 9:83766061-83766083 AGTCCAGGGTGGGATCAGGTGGG + Intronic
1056243381 9:84670267-84670289 TCTCCGGGCTGGGGTCGGGGTGG + Intronic
1057791998 9:98130723-98130745 ACTCCAGGCCCAGATGTGGGGGG - Intronic
1059440454 9:114303883-114303905 ACTCCAGGCTAAGATGAGGGAGG - Intronic
1059659628 9:116388198-116388220 ACTGCAGGCAGGTGTCTGGGTGG - Intronic
1060790654 9:126483469-126483491 AATCCAGGGTAGGAGCTGGGGGG - Intronic
1060932628 9:127498354-127498376 TCTCCAGTCTGAGAGCTGGGGGG - Intronic
1062137636 9:134938138-134938160 ACCCCAGGCTGGGGTCGGTGGGG + Intergenic
1062343329 9:136103510-136103532 AGTCCACGATGGAATCTGGGGGG + Intergenic
1062525949 9:136978235-136978257 ATTCCTGGCGGGGATCGGGGCGG - Intronic
1062664012 9:137657085-137657107 GCTCCATGCTGTGGTCTGGGGGG + Intronic
1062676389 9:137747758-137747780 ATTCAAGGCTTTGATCTGGGTGG - Intronic
1062726363 9:138076227-138076249 GCTCCAGGCAGAGGTCTGGGAGG + Intronic
1203736864 Un_GL000216v2:145000-145022 ACTCCATGGTGGTAGCTGGGAGG - Intergenic
1203739963 Un_GL000216v2:170714-170736 ACTCCATGGTGGCAGCTGGGAGG + Intergenic
1188091221 X:25967952-25967974 GCTCCAGGCTTGGATGTGTGTGG - Intergenic
1188758709 X:33998442-33998464 AATCCAAGATGAGATCTGGGTGG + Intergenic
1189306487 X:39990645-39990667 GCTCCCGGCTAAGATCTGGGGGG + Intergenic
1190327857 X:49217854-49217876 ATGCCAGGCAGGGGTCTGGGCGG - Intronic
1190640371 X:52478351-52478373 TCTCCAGGCTGGGACATAGGAGG + Intergenic
1190647301 X:52534514-52534536 TCTCCAGGCTGGGACATAGGAGG - Intergenic
1193044994 X:77043534-77043556 ACTTGAGGCTGGAATGTGGGGGG + Intergenic
1195704091 X:107726082-107726104 GTTCCAGGCTTGGATCAGGGTGG - Intronic
1195959357 X:110369645-110369667 CCTCCAGGAAGGGATCTTGGTGG - Intronic
1196021894 X:110999435-110999457 ACTCCAGGCTGGCACATAGGAGG + Intronic
1196892962 X:120308510-120308532 ACTCAAGGCTGGGATATCCGGGG - Intronic
1198857052 X:141030278-141030300 ACTTCAGGATGAGATTTGGGTGG - Intergenic
1198905643 X:141557089-141557111 ACTTCAGGATGAGATTTGGGTGG + Intergenic
1198921354 X:141731937-141731959 AATCCAAGATGAGATCTGGGTGG - Intergenic
1199905459 X:152224632-152224654 AATCCGGGCTGGTATCAGGGTGG - Intronic
1199977430 X:152902651-152902673 CCGCCAGGCTGGGTGCTGGGGGG - Intergenic
1201178432 Y:11323343-11323365 ACTCCATGGTGGGAGCTGGGAGG - Intergenic