ID: 950185890

View in Genome Browser
Species Human (GRCh38)
Location 3:10945332-10945354
Sequence CTTGTAGCCCAGGCTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950185888_950185890 -6 Left 950185888 3:10945315-10945337 CCTGAAGTGAGGAGGCTCTTGTA No data
Right 950185890 3:10945332-10945354 CTTGTAGCCCAGGCTGAGCCAGG No data
950185887_950185890 -1 Left 950185887 3:10945310-10945332 CCATTCCTGAAGTGAGGAGGCTC No data
Right 950185890 3:10945332-10945354 CTTGTAGCCCAGGCTGAGCCAGG No data
950185883_950185890 18 Left 950185883 3:10945291-10945313 CCGTTCTTTTCAAAGCCAACCAT No data
Right 950185890 3:10945332-10945354 CTTGTAGCCCAGGCTGAGCCAGG No data
950185885_950185890 3 Left 950185885 3:10945306-10945328 CCAACCATTCCTGAAGTGAGGAG No data
Right 950185890 3:10945332-10945354 CTTGTAGCCCAGGCTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950185890 Original CRISPR CTTGTAGCCCAGGCTGAGCC AGG Intergenic
No off target data available for this crispr