ID: 950187522

View in Genome Browser
Species Human (GRCh38)
Location 3:10954184-10954206
Sequence GTGTGGGTAGCTGGTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950187517_950187522 5 Left 950187517 3:10954156-10954178 CCTGACACACAGTAGATGCTTTT No data
Right 950187522 3:10954184-10954206 GTGTGGGTAGCTGGTGCTCAGGG No data
950187515_950187522 27 Left 950187515 3:10954134-10954156 CCGCTTAGGTGTCTCCGTTCAAC No data
Right 950187522 3:10954184-10954206 GTGTGGGTAGCTGGTGCTCAGGG No data
950187516_950187522 13 Left 950187516 3:10954148-10954170 CCGTTCAACCTGACACACAGTAG No data
Right 950187522 3:10954184-10954206 GTGTGGGTAGCTGGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950187522 Original CRISPR GTGTGGGTAGCTGGTGCTCA GGG Intergenic