ID: 950187800

View in Genome Browser
Species Human (GRCh38)
Location 3:10956145-10956167
Sequence GCCATTCCTGCACTTTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950187795_950187800 13 Left 950187795 3:10956109-10956131 CCACAGGGGAGTCAGTTTCTGCC No data
Right 950187800 3:10956145-10956167 GCCATTCCTGCACTTTGTTGAGG No data
950187799_950187800 -8 Left 950187799 3:10956130-10956152 CCTTGGGCACTGCAGGCCATTCC No data
Right 950187800 3:10956145-10956167 GCCATTCCTGCACTTTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950187800 Original CRISPR GCCATTCCTGCACTTTGTTG AGG Intergenic
No off target data available for this crispr