ID: 950187981 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:10957202-10957224 |
Sequence | GTGCCTGACACCCTCAGTCG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950187981_950187986 | 10 | Left | 950187981 | 3:10957202-10957224 | CCGCGACTGAGGGTGTCAGGCAC | No data | ||
Right | 950187986 | 3:10957235-10957257 | CAGCAGATGCAGAAGCAGGAGGG | No data | ||||
950187981_950187982 | 6 | Left | 950187981 | 3:10957202-10957224 | CCGCGACTGAGGGTGTCAGGCAC | No data | ||
Right | 950187982 | 3:10957231-10957253 | TGCCCAGCAGATGCAGAAGCAGG | No data | ||||
950187981_950187985 | 9 | Left | 950187981 | 3:10957202-10957224 | CCGCGACTGAGGGTGTCAGGCAC | No data | ||
Right | 950187985 | 3:10957234-10957256 | CCAGCAGATGCAGAAGCAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950187981 | Original CRISPR | GTGCCTGACACCCTCAGTCG CGG (reversed) | Intergenic | ||
No off target data available for this crispr |