ID: 950187981

View in Genome Browser
Species Human (GRCh38)
Location 3:10957202-10957224
Sequence GTGCCTGACACCCTCAGTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950187981_950187986 10 Left 950187981 3:10957202-10957224 CCGCGACTGAGGGTGTCAGGCAC No data
Right 950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG No data
950187981_950187982 6 Left 950187981 3:10957202-10957224 CCGCGACTGAGGGTGTCAGGCAC No data
Right 950187982 3:10957231-10957253 TGCCCAGCAGATGCAGAAGCAGG No data
950187981_950187985 9 Left 950187981 3:10957202-10957224 CCGCGACTGAGGGTGTCAGGCAC No data
Right 950187985 3:10957234-10957256 CCAGCAGATGCAGAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950187981 Original CRISPR GTGCCTGACACCCTCAGTCG CGG (reversed) Intergenic
No off target data available for this crispr