ID: 950187986

View in Genome Browser
Species Human (GRCh38)
Location 3:10957235-10957257
Sequence CAGCAGATGCAGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950187981_950187986 10 Left 950187981 3:10957202-10957224 CCGCGACTGAGGGTGTCAGGCAC No data
Right 950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950187986 Original CRISPR CAGCAGATGCAGAAGCAGGA GGG Intergenic
No off target data available for this crispr