ID: 950189741

View in Genome Browser
Species Human (GRCh38)
Location 3:10968409-10968431
Sequence TGTCTCTCCATTAAAGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950189741_950189745 -4 Left 950189741 3:10968409-10968431 CCACTTACTTTAATGGAGAGACA No data
Right 950189745 3:10968428-10968450 GACAAGGGGCAAGAGTTTAAAGG No data
950189741_950189746 -3 Left 950189741 3:10968409-10968431 CCACTTACTTTAATGGAGAGACA No data
Right 950189746 3:10968429-10968451 ACAAGGGGCAAGAGTTTAAAGGG No data
950189741_950189747 24 Left 950189741 3:10968409-10968431 CCACTTACTTTAATGGAGAGACA No data
Right 950189747 3:10968456-10968478 TAGTGAAGCCCACACTGCAAAGG No data
950189741_950189748 25 Left 950189741 3:10968409-10968431 CCACTTACTTTAATGGAGAGACA No data
Right 950189748 3:10968457-10968479 AGTGAAGCCCACACTGCAAAGGG No data
950189741_950189749 28 Left 950189741 3:10968409-10968431 CCACTTACTTTAATGGAGAGACA No data
Right 950189749 3:10968460-10968482 GAAGCCCACACTGCAAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950189741 Original CRISPR TGTCTCTCCATTAAAGTAAG TGG (reversed) Intergenic
No off target data available for this crispr