ID: 950190780

View in Genome Browser
Species Human (GRCh38)
Location 3:10974776-10974798
Sequence CCGTGCAAAGCTCTGAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950190773_950190780 4 Left 950190773 3:10974749-10974771 CCCGAACGATGAAGGGAGCCATC No data
Right 950190780 3:10974776-10974798 CCGTGCAAAGCTCTGAGAGGAGG No data
950190774_950190780 3 Left 950190774 3:10974750-10974772 CCGAACGATGAAGGGAGCCATCC No data
Right 950190780 3:10974776-10974798 CCGTGCAAAGCTCTGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950190780 Original CRISPR CCGTGCAAAGCTCTGAGAGG AGG Intergenic
No off target data available for this crispr