ID: 950194297

View in Genome Browser
Species Human (GRCh38)
Location 3:10998419-10998441
Sequence GGGGGGTCCCAGCAGTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950194285_950194297 24 Left 950194285 3:10998372-10998394 CCTTGGTTATGCGCAGAGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 950194297 3:10998419-10998441 GGGGGGTCCCAGCAGTAACCAGG 0: 1
1: 0
2: 2
3: 16
4: 133
950194290_950194297 -2 Left 950194290 3:10998398-10998420 CCAAAGTGTGATCATTTGGCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
Right 950194297 3:10998419-10998441 GGGGGGTCCCAGCAGTAACCAGG 0: 1
1: 0
2: 2
3: 16
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950194297 Original CRISPR GGGGGGTCCCAGCAGTAACC AGG Intronic
900578066 1:3394079-3394101 GTGGGGTCCCAGGAGACACCGGG + Intronic
901328070 1:8381042-8381064 GGGGTGGGCCAGCAGCAACCAGG - Intronic
901783642 1:11610489-11610511 TGGGGGTCCCTGCAGGGACCAGG - Intergenic
902783393 1:18718274-18718296 GCGGGGTGCCAGCAGAATCCAGG + Intronic
904459716 1:30669018-30669040 AGGAGGCCACAGCAGTAACCTGG - Intergenic
905297219 1:36961850-36961872 CGGGGGACTCAGCAGTAATCAGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
908007285 1:59739906-59739928 GGGCAGCCCCAGCAGGAACCTGG + Intronic
909662889 1:78103852-78103874 GGCAGGTCCCACCAGTAACAGGG + Intronic
910857582 1:91711018-91711040 GGGGAGACCTAGCAGTTACCAGG - Intronic
918007572 1:180556359-180556381 GGGGGGACCCAGCAGCCACCTGG + Intergenic
920696835 1:208187244-208187266 GAAGGGTCCCAGCAGTCTCCAGG + Intronic
922616866 1:226965809-226965831 GTGGGGACCCAGCAATATCCCGG + Intronic
1063434889 10:6021675-6021697 GGAGGTTCCCTGCAGTGACCTGG + Exonic
1066568662 10:36748314-36748336 GAGAGGTGCCAGCAGGAACCAGG + Intergenic
1077188080 11:1244341-1244363 GTGGGGTGCCAGCAGTTGCCTGG - Exonic
1077189035 11:1248112-1248134 GTGGGGTGCCAGCAGTTGCCTGG - Exonic
1077189598 11:1250296-1250318 GTGGGGTGCCAGCAGTTGCCTGG - Exonic
1079082672 11:17424773-17424795 TGGGGGCCCCAGCAGTGACCAGG + Intronic
1081832804 11:46128260-46128282 GGAGGGTCCAAGCAGTTAACGGG + Intergenic
1081910109 11:46695075-46695097 GGGGGGACCCAGAAGAAACCAGG - Intronic
1083304002 11:61753435-61753457 GGGGGGTCCCAGCCCCAAACAGG - Intronic
1090243880 11:125202257-125202279 GGAGGGTCCCAGCTGCAGCCTGG - Intronic
1091749273 12:3012446-3012468 GGGGGATCCCAGCAGGAGCCTGG - Intronic
1091749704 12:3014730-3014752 GGGGAGTGACAGCAGTAGCCGGG - Intronic
1096069786 12:48768587-48768609 TGGGGGCCCCAGCAGTTAACAGG - Exonic
1102255663 12:111413491-111413513 GGGGGTTCCCAGCCGTTGCCTGG + Intronic
1104294113 12:127496108-127496130 GTGGAATCCCTGCAGTAACCAGG + Intergenic
1105858089 13:24388881-24388903 GGTGGAACCCAGCAGGAACCTGG + Intergenic
1106484016 13:30156928-30156950 AGGGAGTCCAAGCAGAAACCTGG - Intergenic
1113432370 13:110261955-110261977 GGTGGGTCCCAGCTGTGACCGGG + Intronic
1115770513 14:36661234-36661256 GGGGGGTCGCCGCAGGAAGCTGG + Intronic
1117332586 14:54727868-54727890 AGGGGGAACCAGCAGTAAACAGG + Intronic
1118042286 14:61930388-61930410 GAGGGGTCACAGCTGTCACCTGG + Intergenic
1119543491 14:75455839-75455861 AGGGGATCCCAGCAGGAAACAGG - Intronic
1122901169 14:104782890-104782912 GGGGGGTGCCAGCTGCAGCCAGG + Intronic
1123121826 14:105920297-105920319 TGAGGGTCCCAGCAGGAGCCAGG + Intronic
1202841352 14_GL000009v2_random:124569-124591 GTGGGGTCCCAGCAGTGAAGCGG - Intergenic
1202910741 14_GL000194v1_random:114800-114822 GTGGGGTCCCAGCAGTGAAGCGG - Intergenic
1126301237 15:47198618-47198640 GGGTGGTCCAAGCAGGGACCTGG + Intronic
1126775576 15:52097518-52097540 GGGGGGTCCCATCAGCAATGTGG - Intergenic
1126954617 15:53918665-53918687 TGTGGGACCCAGCAGTCACCAGG - Intergenic
1127051459 15:55088541-55088563 TGGGGCTCCCATCAGGAACCTGG - Intergenic
1130205261 15:81869704-81869726 GGAGAGTCCCAGCAGAAAGCTGG + Intergenic
1130435996 15:83900600-83900622 AAGGGGTCTCAGCAGTAATCTGG + Intronic
1131061668 15:89408394-89408416 GGTGGGCCCCAGCTGTACCCTGG + Intergenic
1132621165 16:868878-868900 GTGGGATCCCAGCAGACACCTGG + Intronic
1134051660 16:11141671-11141693 CTGGGGTCCCACCAGAAACCAGG + Intronic
1134241408 16:12509546-12509568 GGGGTGTCCTGGCAGTAAACAGG + Intronic
1138553110 16:57757836-57757858 GGTGGTGCCCAGCAGTAACCTGG + Intergenic
1138590746 16:57998473-57998495 GGAGGGTCCCAGCAGTGCCGGGG + Exonic
1138633417 16:58317569-58317591 AGGGGGTCCCAGGAGGAACTGGG - Intronic
1146127332 17:30239431-30239453 TGGGGGTCCCAGGAAAAACCAGG - Intergenic
1146184614 17:30716875-30716897 GGGGCTTCCCAGCTGCAACCTGG + Intergenic
1147403398 17:40194194-40194216 TGGGGGTCCCAGCCCTGACCAGG - Exonic
1148590374 17:48812048-48812070 GGGGGGTCCCAGCATCACCTGGG - Intronic
1148802547 17:50240476-50240498 GGGGGGTCCCTCCTGTAACTAGG + Intergenic
1152647667 17:81477232-81477254 GGGGGGTCCCAGCAGAACGGCGG - Intergenic
1154353252 18:13604881-13604903 GGGGCGTGCCAGCAGCCACCAGG + Intronic
1155191330 18:23433520-23433542 GGGAGGTTCCAGCTGTAATCAGG - Intronic
1157912045 18:51625416-51625438 TGGTGGTCCCAGCATTAACCAGG - Intergenic
1160012321 18:75115552-75115574 GCTGGGTCCCAGCAGCAACAGGG - Intergenic
1161027756 19:2044484-2044506 GGAGGGTCCCAGCAGGTGCCAGG - Intronic
1161485002 19:4530626-4530648 GAGGGGCCCCACCAGTAAACAGG + Intronic
1162974170 19:14198797-14198819 GGGGCTTCCCAGCTGCAACCTGG - Intronic
1165773650 19:38392255-38392277 AGGGGGTCTCTGCAGTATCCTGG - Exonic
1167109203 19:47448923-47448945 CTGGGGACACAGCAGTAACCAGG + Intronic
1168685532 19:58347228-58347250 GGGGAGACCCAGCGCTAACCAGG + Intronic
924995607 2:357934-357956 GGTCAGTCCCAGCAGTACCCAGG + Intergenic
928366256 2:30705745-30705767 GGGTGGTCCCAGCAGTGCCCAGG - Intergenic
929574627 2:43043966-43043988 GGGGGGTCCCACATGTAACCTGG - Intergenic
932359558 2:71092846-71092868 GAGAGGTGCCAGCAGGAACCAGG - Intergenic
933651134 2:84851161-84851183 GGAGGGTCCCAGCAAAATCCAGG + Intronic
933796210 2:85921933-85921955 GGGGTTTCTCAGCTGTAACCTGG + Intergenic
936370557 2:111898832-111898854 GGGGGCTCCCAGGAGGAAGCAGG + Intronic
939038381 2:137159765-137159787 GGGGAGTCGCAGCAGTAAATTGG + Intronic
946966308 2:225041752-225041774 GGGGGGCCCCAGCTCTAACCAGG + Intronic
947742157 2:232489590-232489612 GGGGGGTCCCAGAGCTGACCCGG - Intergenic
947800564 2:232927020-232927042 TGGGTGTCTCCGCAGTAACCGGG - Intronic
1170382717 20:15779115-15779137 TGGGGATCCCAGGAGTTACCTGG + Intronic
1173077725 20:39835669-39835691 CGGAGGTCCCGACAGTAACCAGG + Intergenic
1173396574 20:42686023-42686045 AGGGGGTCCCAGAGGTAGCCAGG - Intronic
1174045399 20:47729440-47729462 GGGGGATCCCAGGAGAAACCTGG + Intronic
1175901951 20:62363481-62363503 GGAGGCTCCCAGCAGAATCCTGG + Intronic
1176597361 21:8759302-8759324 GTGGGGTCCCAGCAGTGAAGCGG + Intergenic
1176630094 21:9129497-9129519 GTGGGGTCCCAGCAGTGAAGCGG - Intergenic
1180421083 22:12815532-12815554 GTGGGGGCCCAGCAGTGACGCGG - Intergenic
1181619376 22:24078151-24078173 GGGGGTCCCCAGCAGTAGACAGG - Intronic
1181801468 22:25350598-25350620 GGGGGGTCCCAGCGGCCACCAGG - Intergenic
1184806337 22:46796963-46796985 GTGGGGACACAGCAGGAACCAGG - Intronic
1184962840 22:47944053-47944075 GGGAGAGCCCAGCAGTAACACGG - Intergenic
950194297 3:10998419-10998441 GGGGGGTCCCAGCAGTAACCAGG + Intronic
951016367 3:17736672-17736694 GAGGTGTCCCAGCAGCTACCTGG - Intronic
952593596 3:34988365-34988387 GAGAGGTGCCAGCAGCAACCGGG + Intergenic
952866889 3:37861077-37861099 GAGGGGTCCCAGGAGTGAGCGGG - Intergenic
953852911 3:46479464-46479486 GGGAGGCTCCAGCAGTGACCTGG + Intronic
958844278 3:99246752-99246774 CAGAGGTCCCAGCAGGAACCTGG + Intergenic
961745085 3:129059528-129059550 GGGGACCCCCAGCAGCAACCAGG + Intergenic
962283788 3:134070618-134070640 GAGAGGTGCCAGCAGGAACCGGG - Intronic
963975937 3:151480757-151480779 GGGAGGATCCAGCAGTAACTGGG - Intergenic
965774641 3:172215731-172215753 GGGAGGTCTCAGCAGGAACGGGG - Intronic
973360656 4:49161521-49161543 GTGGGGTCCCAGCAGTGACGCGG + Intergenic
976053172 4:81031641-81031663 GGGGGGTCCCGGGAGAAAGCTGG - Intronic
985186142 4:187318009-187318031 GGGGGGTACCAGCAGTAACAGGG - Intergenic
986861467 5:11931668-11931690 CGGTGGTGCCAGCAGGAACCGGG + Intergenic
997271640 5:132544426-132544448 GTGGGGTCCCAGTAGTAAGGGGG + Intronic
997901851 5:137774054-137774076 GGGTGGTGACAGCAGAAACCTGG - Intergenic
1001984078 5:176058904-176058926 GGGTGGCCACAGCTGTAACCTGG + Intronic
1002233398 5:177785162-177785184 GGGTGGCCACAGCTGTAACCTGG - Intronic
1002262584 5:178004611-178004633 GGGTGGCCACAGCTGTAACCTGG + Intergenic
1002618379 5:180469309-180469331 GGGGGTTCCCAGCAGCAACCTGG + Intergenic
1007270148 6:40630201-40630223 TGTGTGTCCCAGCAGTATCCTGG + Intergenic
1007556539 6:42771043-42771065 GGAGGGACCCAGCAGTCCCCAGG - Intronic
1007814384 6:44510142-44510164 GTGGGGGCCCAGCTGTCACCAGG + Intergenic
1010784047 6:79979109-79979131 GGGCAGTCCCAGAACTAACCTGG - Intergenic
1018450490 6:163902831-163902853 GGGTGGTCCCAGCTGTACTCAGG - Intergenic
1019060165 6:169251814-169251836 GGGGGGTCCCAGCAGCAGATGGG - Intronic
1019187155 6:170227456-170227478 GGAGTGTCCCAGCAGTCCCCCGG - Intergenic
1019356415 7:582285-582307 GCGGGGTCCCAGGAGCATCCAGG + Intronic
1020237551 7:6368059-6368081 GGGGTTTCCCAGCAGTTACAAGG - Intergenic
1021903478 7:25310693-25310715 GGCGGGGCACAGCAGTGACCTGG + Intergenic
1023435063 7:40134263-40134285 GCGGGGTCCCAGCAGCAATTCGG - Exonic
1024113831 7:46173557-46173579 GGGGGGTGCCATCAGTAGCATGG + Intergenic
1026674431 7:72417111-72417133 GGGCGGTCCCAGCCGTGATCTGG + Intronic
1029409177 7:100397909-100397931 GGGGAGGCCCAGCACTCACCTGG - Exonic
1029483640 7:100826929-100826951 GGGAGGTCCCAGGAGTGACGGGG + Intronic
1032591946 7:133199901-133199923 GGGGACTCCCAGGAGGAACCAGG - Intergenic
1034555913 7:151850233-151850255 GGGTGGGCCCAGGAGAAACCTGG + Intronic
1034912574 7:155009469-155009491 GGGGAGTCCCAGCAGAAAGCTGG + Intergenic
1035479034 7:159167366-159167388 GCAGGGTCCCAGCAGTGGCCTGG - Intergenic
1036528407 8:9556460-9556482 CAGGGGTCCCAGCAGTGAGCGGG + Exonic
1036665655 8:10735537-10735559 GGGGGGCCGCTGTAGTAACCAGG - Intronic
1043515336 8:80990246-80990268 TGGGGGTCCCAGGAGGAACGGGG + Intronic
1044611641 8:94097888-94097910 GGGGGCTCCCAGGGGTAAACTGG - Intergenic
1047623686 8:126634271-126634293 GGGGAATCCCAGCAATAACTGGG + Intergenic
1047623719 8:126634576-126634598 GGGGAATCCCAGCAATAACTGGG - Intergenic
1047904136 8:129454709-129454731 GGGGGATCCCATCAGAACCCCGG + Intergenic
1049386207 8:142344350-142344372 GGCGGGGCCCAGCACTACCCGGG - Exonic
1050596023 9:7205471-7205493 GTGGGATCCCAACAGTAAACAGG - Intergenic
1053149903 9:35736741-35736763 GGGGGGTCTCAGCAGGAGCCTGG + Exonic
1056968067 9:91180583-91180605 GGGGGGTGGCAGCAGTCACTGGG - Intergenic
1057802294 9:98197858-98197880 TGGGGGTCCCAGCTGCACCCTGG - Intergenic
1061552760 9:131347565-131347587 GGGGTGTCTCAGCAGAAGCCTGG - Intergenic
1061708200 9:132469124-132469146 GGGGGGACCCAGCACTTGCCAGG + Intronic
1062171295 9:135136292-135136314 GGGGGCTCTCAGCAGCAGCCAGG + Intergenic
1062234641 9:135502001-135502023 GGCGGTTCCCAGGAGGAACCTGG + Intronic
1062557003 9:137117575-137117597 TGGGTGTCCCAGCAGGAATCGGG - Intergenic
1203752929 Un_GL000218v1:97182-97204 GTGGGGTCCCAGCAGTGAAGCGG - Intergenic
1203555938 Un_KI270743v1:208055-208077 GTGGGGTCCCAGCAGTGACGCGG - Intergenic
1187483669 X:19681769-19681791 AGGAAGTCCCAGCAGTAACGAGG + Intronic
1195706072 X:107738804-107738826 GGGGGGACCCCACAGTGACCGGG - Intronic
1201166571 Y:11214752-11214774 GTGGGGTCCCAGCAGTGAAGCGG - Intergenic