ID: 950195045

View in Genome Browser
Species Human (GRCh38)
Location 3:11003300-11003322
Sequence TATAATAAACCACCTGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950195045 Original CRISPR TATAATAAACCACCTGATCA GGG (reversed) Intronic
903939244 1:26917595-26917617 TAAAAGAAACCACCTGGGCATGG + Intronic
908274515 1:62456374-62456396 TAAAAGAAACCAACTGATAATGG - Intronic
908963931 1:69735134-69735156 TATAGAAAACCACCTGATAATGG - Intronic
909046574 1:70717815-70717837 TTTTATAAACCAACTAATCAGGG + Intergenic
910551898 1:88484896-88484918 TATAATAAACTACATCATAATGG - Intergenic
911483378 1:98473826-98473848 TATAAAGAACTACCTGATAATGG - Intergenic
912267480 1:108173505-108173527 TATAAAGAACCACCTGAGAATGG - Intronic
916743452 1:167666198-167666220 TTTAATAAACCAACTGAGCATGG + Intronic
916748961 1:167706827-167706849 GCAAATAAAACACCTGATCATGG - Intergenic
918299122 1:183186230-183186252 TCGATAAAACCACCTGATCAAGG + Intronic
919251916 1:195066808-195066830 TATATTAATCCATCTGATAAGGG + Intergenic
919408535 1:197214988-197215010 GATAAAATACCACTTGATCAAGG - Intergenic
921461697 1:215434738-215434760 CAGAATAAACCACCTGGACAAGG + Intergenic
923261111 1:232268745-232268767 TATGATAAACATCCTGCTCATGG - Intergenic
923903599 1:238357110-238357132 GATAATACACCACCTGAAAATGG - Intergenic
1064340293 10:14479514-14479536 TATAAAAAACCATCAGATCTTGG + Intergenic
1065952845 10:30667625-30667647 AATAATAAATCAGCTGAGCATGG - Intergenic
1068183891 10:53560167-53560189 TATAATAAACAAATTGATAAAGG + Intergenic
1068596712 10:58909857-58909879 TAGAAGAAACCTCCAGATCAGGG + Intergenic
1069202422 10:65637340-65637362 TATTATAAACCATCTGATATAGG - Intergenic
1071650791 10:87391537-87391559 TTTCATAAACCACCTGCCCAGGG - Intergenic
1073082818 10:100870797-100870819 TATATTTAACCATCTCATCATGG - Intergenic
1073762649 10:106646945-106646967 TATCATAAACAAGCTGAACAAGG - Intronic
1078996638 11:16707874-16707896 TATAGTAACCCATCTGATGAAGG - Intronic
1080843179 11:36003728-36003750 TATAAAGAACCACCTGAGCCTGG + Intronic
1081300588 11:41446294-41446316 TGTAATAAACCACCTCAATACGG + Intronic
1082087101 11:48059042-48059064 TATTATAAAACAGCTGATCAGGG - Intronic
1084347298 11:68562612-68562634 TGTTAAAAACCGCCTGATCATGG - Intronic
1086668237 11:89512271-89512293 TATAATAAAACACTTGATATAGG + Intergenic
1087895886 11:103585794-103585816 TATAAAAAACTACCTGAGAATGG + Intergenic
1097091510 12:56508893-56508915 TTTAATAAAGCAGTTGATCAAGG + Intergenic
1099373758 12:81870987-81871009 TAAAATAAATAACCTGAACAGGG + Intergenic
1099695013 12:86007442-86007464 TATGATACACTACCAGATCATGG - Intronic
1101158440 12:101950000-101950022 GATAGTAAACCACCTGCTGATGG - Intronic
1110507373 13:76303356-76303378 TATATTTAACCACTTCATCAAGG + Intergenic
1111021028 13:82452613-82452635 TATGTTACACCACCTGAACATGG - Intergenic
1112113125 13:96324439-96324461 TTTAATATACCACATGGTCAGGG - Intronic
1112394879 13:99020338-99020360 TATACTAAACCACATTAACATGG + Intronic
1112524108 13:100127504-100127526 TATGAAAAAGCACCTAATCATGG + Intronic
1113335943 13:109375999-109376021 AATAATAAAATACCTGAGCATGG - Intergenic
1113405282 13:110033044-110033066 TTACATAAACCATCTGATCAGGG + Intergenic
1113544815 13:111140101-111140123 TCTAATAAATCACTTGATTATGG - Intronic
1114076372 14:19163414-19163436 TATAAAAAACTACCTGATATTGG + Intergenic
1114085796 14:19236155-19236177 TATAAAAAACTACCTGATATTGG - Intergenic
1117847353 14:59925237-59925259 TATAATAAAATACCTGAAAATGG + Intronic
1120108989 14:80530668-80530690 TTTAACATACCACCTTATCAGGG - Intronic
1121237776 14:92405503-92405525 TATAATGAACCACCTGAGACTGG + Intronic
1127254764 15:57280200-57280222 TATAAAAAACAAACTGATGAAGG + Intronic
1127528465 15:59817583-59817605 TATAGTAAACCAACAGTTCATGG - Intergenic
1129102554 15:73279711-73279733 AATAACAAACTACCTGATAAAGG + Intronic
1133889994 16:9869770-9869792 TATAATAAAACACCTAATCCTGG - Intronic
1140723635 16:77792401-77792423 TTCAATAAACCACCTGAAAAAGG - Intronic
1143443310 17:6992414-6992436 TATAATCAATCACCTGAACCTGG + Intronic
1143889203 17:10089426-10089448 TAAAATAAACCACCTGCTCCGGG + Intronic
1144410473 17:14995693-14995715 TAAAATATACCACATGACCAAGG - Intergenic
1144468871 17:15519137-15519159 TATAAAAAACCACCTGAGACTGG - Intronic
1158216356 18:55104370-55104392 TATAAAAAACTACCTGAGCCTGG + Intergenic
1158956569 18:62546014-62546036 TATAATAAACCACAGGAAGATGG - Intronic
1159304849 18:66627349-66627371 TCTTATAAAACATCTGATCATGG + Intergenic
1164859096 19:31548217-31548239 TAGAATAACCCACCTGCTTATGG - Intergenic
926324779 2:11775186-11775208 TATAATAAACCACCAGCTACAGG - Intronic
927406999 2:22781884-22781906 TATTATTGACCACCTGACCAAGG + Intergenic
928559909 2:32471029-32471051 CATAACAACCCAACTGATCATGG - Exonic
931687972 2:64810806-64810828 TATAATAAAATACCTGAGAATGG - Intergenic
938178115 2:129154912-129154934 TTTAAAAAACCACTTTATCAAGG + Intergenic
938490964 2:131760929-131760951 TATAAAAAACTACCTGATTTTGG + Intronic
939184030 2:138839716-138839738 AGAAATAAACCACCTGAACATGG - Intergenic
940748040 2:157592963-157592985 TCTAATAAACCTCCTTATTATGG - Intronic
942919326 2:181352149-181352171 TATAATAATTCACCTAATCATGG + Intergenic
943137730 2:183936904-183936926 AATAATAAACAAGTTGATCAGGG - Intergenic
943471373 2:188298192-188298214 TATAATAACACACATCATCAAGG - Intronic
944480216 2:200149517-200149539 TACAATAAACCACAGTATCAGGG + Intergenic
944901136 2:204217552-204217574 TTTAATGAACCACCTCATCTTGG + Intergenic
1173714526 20:45190882-45190904 TTTAATAAACCACATGTTCATGG + Intergenic
1176296144 21:5074435-5074457 TAAAATAAACCACCTGCTTGGGG - Intergenic
1176617037 21:9033857-9033879 TATAAAAAACTACCTGATATTGG - Intergenic
1176708100 21:10129804-10129826 TATAAAAAACTACCTGATATTGG + Intergenic
1178150160 21:29785406-29785428 TACAAAAAATTACCTGATCATGG + Intronic
1179860905 21:44187686-44187708 TAAAATAAACCACCTGCTTGGGG + Intergenic
1180292177 22:10857038-10857060 TATAAAAAACTACCTGATATTGG + Intergenic
1180494982 22:15886460-15886482 TATAAAAAACTACCTGATATTGG + Intergenic
1182021262 22:27083589-27083611 TATAATAAAGAACGTGGTCAGGG - Intergenic
949229524 3:1734284-1734306 TATAATAAAACACAAGAGCAGGG - Intergenic
950195045 3:11003300-11003322 TATAATAAACCACCTGATCAGGG - Intronic
957773044 3:84719118-84719140 TATAATAAACCATGAGACCAAGG - Intergenic
957853079 3:85836420-85836442 TTTTAGAAACAACCTGATCAAGG + Intronic
958524558 3:95239108-95239130 CATATTAAACCATATGATCAAGG - Intergenic
963589502 3:147239486-147239508 TAGAAGAAATCACCTGTTCATGG - Intergenic
963611230 3:147471308-147471330 AATAATAGACCACCTGAAAAAGG - Intronic
963878075 3:150499363-150499385 AATAATAAACCACTTCTTCATGG + Intergenic
965093041 3:164185609-164185631 TATAAATAACCACCTGATACTGG - Intergenic
965756928 3:172037108-172037130 TTTAATAAACCTTCTGGTCAAGG - Intergenic
971116519 4:23652829-23652851 TAGAATAAGCCACCTGACTATGG - Intergenic
971902230 4:32676461-32676483 TATAAAAAACCACCTGAGGCTGG + Intergenic
976225538 4:82792923-82792945 TAAAACAAACAAACTGATCAAGG - Intronic
978519934 4:109604862-109604884 GATAAAAACCCACCTGGTCATGG + Intronic
980062500 4:128146903-128146925 TATTATAAAACATCTGATCTAGG + Intronic
980346643 4:131631108-131631130 TATAATAAATCCCATGATCATGG - Intergenic
985961012 5:3303179-3303201 TATTCTAAAACACATGATCAAGG + Intergenic
986884963 5:12222751-12222773 TCAAATAAACCACCTAATGATGG - Intergenic
988096416 5:26617369-26617391 GATAATATACCACATTATCATGG + Intergenic
988879597 5:35486612-35486634 TGTAATAAACTACCTGGTAAAGG - Intergenic
989797043 5:45488132-45488154 AATAATAAACCAGGTGGTCAAGG - Intronic
993668252 5:90727717-90727739 TATAATTAATCACCTAAACAGGG - Intronic
993710040 5:91215626-91215648 TGTCATAAATCACCAGATCAAGG - Intergenic
993969678 5:94403396-94403418 TACTATGAACCACATGATCAAGG - Intronic
996397033 5:123023674-123023696 TTTAGTAAACCACCTGCTTAGGG - Exonic
996423544 5:123288562-123288584 TATAATAAAATATCTTATCAAGG - Intergenic
996565249 5:124873200-124873222 TTTCATAAACCACCTGAATAAGG - Intergenic
996632130 5:125646024-125646046 TATGATAAACCAGTTGATTATGG - Intergenic
996684121 5:126261479-126261501 TATCAAAAACTACATGATCAAGG + Intergenic
998948664 5:147368720-147368742 TTTAATAAACCAACAGGTCATGG + Intronic
999023172 5:148193115-148193137 TAAAGTAAATCACCTGATCTGGG + Intergenic
999207006 5:149856230-149856252 GAAAATAAATCACCTGAACAAGG - Intergenic
999900444 5:156080989-156081011 TATAAATAAATACCTGATCATGG + Intronic
1000857374 5:166415897-166415919 AATAATAAACTAGCTGAGCATGG - Intergenic
1003856237 6:10279197-10279219 TATAAAGAACTACCTGATCCTGG + Intergenic
1007356894 6:41326758-41326780 CATAATAAACCACATGACTAGGG + Intergenic
1009317323 6:62237402-62237424 TTTAATAAATCACCTACTCAAGG + Intronic
1009554977 6:65150933-65150955 TTTAATAAATCATATGATCAGGG + Intronic
1011772316 6:90688344-90688366 TCTAATAAAGCACATGATCTTGG + Intergenic
1013319640 6:108974782-108974804 TAGAATAAACCAGCTGGGCATGG + Intergenic
1013459499 6:110361330-110361352 TATAAATAACCACTTGATGAAGG - Intergenic
1014804184 6:125811107-125811129 TAAAATAAACCACCTGACCCAGG + Intronic
1014855853 6:126399762-126399784 TGTAATTATCAACCTGATCATGG + Intergenic
1015329797 6:131963603-131963625 TGTAATAAAGCTCCTGACCATGG + Intergenic
1015330745 6:131975948-131975970 TATAATAACCCAGCTTCTCAGGG + Intergenic
1015521024 6:134131261-134131283 TATAAAAAACCACCTGAAATTGG - Intergenic
1015898246 6:138037698-138037720 TACATTAAACTACCTGAACAGGG + Intergenic
1023217083 7:37874248-37874270 TATAATATAACAGCTGATGAAGG + Intronic
1030964104 7:115967707-115967729 TATTATAAACCAGCTCACCAAGG - Intronic
1032915607 7:136485822-136485844 AATAATAAACCAGCTGAGGATGG - Intergenic
1035516920 8:241753-241775 TATAAAAAACTACCTGATAGTGG + Intronic
1038711664 8:29952535-29952557 AAAAATAAATCACCTGAGCATGG + Intergenic
1042995931 8:74698678-74698700 TATGTTAAACCACCTTTTCATGG - Intronic
1043711642 8:83426120-83426142 TTTTATATACGACCTGATCAAGG - Intergenic
1045007667 8:97930363-97930385 TGTAACCAAACACCTGATCAGGG - Intronic
1045798804 8:106078035-106078057 TCTAAAAAACCACATGAACAGGG - Intergenic
1047552463 8:125889926-125889948 TAGACTAATCCACATGATCATGG - Intergenic
1047819569 8:128503848-128503870 TATTATTAACCACCTGATCCTGG - Intergenic
1048651700 8:136485398-136485420 TATAATGAACTACCTGAGCCCGG + Intergenic
1050688424 9:8198276-8198298 TTTAATCAATCTCCTGATCAAGG - Intergenic
1052172261 9:25414242-25414264 TATCATCAACCACTTGATGACGG + Intergenic
1052454177 9:28673296-28673318 TCTAATAAATCACATGATCTAGG - Intergenic
1053645060 9:40115303-40115325 TATAAAAAACTACCTGATATTGG + Intergenic
1054326083 9:63713201-63713223 TATAAAAAACTACCTGATATTGG + Intergenic
1054539513 9:66260668-66260690 TATAAAAAACTACCTGATATTGG - Intergenic
1055737338 9:79345413-79345435 TATAATAATCCACATTTTCAAGG - Intergenic
1056477239 9:86964529-86964551 TATAATATACCAAGTGATAAGGG - Intergenic
1056625660 9:88251048-88251070 TATAAAAAACTACCTGAGAATGG - Intergenic
1057576280 9:96245163-96245185 TAGAATAAAGCACCTGCTCTGGG - Intronic
1058309353 9:103482487-103482509 TATAATAAAGCATCTGTGCAGGG - Intergenic
1059680702 9:116582742-116582764 TTTTCTAAACCTCCTGATCACGG - Intronic
1060747455 9:126146849-126146871 TATAACAAACCATCTTTTCAAGG + Intergenic
1202792863 9_KI270719v1_random:98773-98795 TATAAAAAACTACCTGATATTGG + Intergenic
1188821667 X:34783189-34783211 TATAATAAACCACGTTAAAATGG - Intergenic
1189577117 X:42365789-42365811 TATAATAGTCCACCTTATCTGGG + Intergenic
1190655228 X:52606336-52606358 TATAAAAAACCACATGATTTGGG - Intergenic
1192829449 X:74735910-74735932 TATAATATAGCACCTAACCAGGG + Exonic
1193706355 X:84824538-84824560 TATAATGAACCACCTGAGACTGG + Intergenic
1197283533 X:124566723-124566745 TATAATAAAACTCATAATCATGG - Intronic
1198506003 X:137302130-137302152 AAGAATAAGCCACCTGCTCATGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199440803 X:147865838-147865860 TATAAAGAACTACCTGATAATGG - Intergenic
1201150434 Y:11092708-11092730 TATAAAAAACTACCTGATATTGG - Intergenic