ID: 950195060

View in Genome Browser
Species Human (GRCh38)
Location 3:11003480-11003502
Sequence CAGAGCTGAAACTCAAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 1, 2: 5, 3: 87, 4: 563}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950195057_950195060 0 Left 950195057 3:11003457-11003479 CCTACAGTCACACAGCATTGAAC 0: 1
1: 0
2: 2
3: 29
4: 276
Right 950195060 3:11003480-11003502 CAGAGCTGAAACTCAAAACTGGG 0: 1
1: 1
2: 5
3: 87
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950195060 Original CRISPR CAGAGCTGAAACTCAAAACT GGG Intronic
902275179 1:15334497-15334519 CACAGCTGAAATTCAAGCCTTGG - Intronic
902557044 1:17253064-17253086 CAGAGCTAAAACTAGAAACTAGG + Intronic
903518582 1:23929755-23929777 CAGAGCTGGGATTCAACACTAGG + Intergenic
903772821 1:25774721-25774743 CAGAGCTGAGATTCAAACCCAGG + Intronic
904420571 1:30388420-30388442 CAGAGCTGAAGCTGAAACCCAGG - Intergenic
904494971 1:30881459-30881481 CAGACATGAACCTCACAACTCGG + Intronic
904875308 1:33650309-33650331 CAGAGCAGAAACACAAAGCAAGG + Intronic
905256846 1:36690285-36690307 CAGAGCTGGGATTCAAACCTAGG - Intergenic
905343458 1:37295236-37295258 CAGAGCCTGAACTCAAAGCTGGG - Intergenic
905592820 1:39179423-39179445 CAGAGCTGGAATTCAAACCCAGG - Intronic
905774715 1:40661116-40661138 CAGAGCTGGGATTCAAAACCAGG - Intronic
906252765 1:44323815-44323837 CAGAGCTGGAACTCCAAAATGGG + Intronic
906482885 1:46211702-46211724 CAAAACTGGAACTCAAATCTAGG + Intronic
906508265 1:46395742-46395764 CAGAGCTGGAACTAGAACCTAGG + Intronic
906534085 1:46542019-46542041 CAGAGCTGTGATTCAAACCTAGG + Intergenic
906546578 1:46623589-46623611 CAGAGCTGAGACTCAAAAACAGG + Intergenic
906736776 1:48137403-48137425 CAGAGCTCAAACTCCATGCTGGG + Intergenic
907075189 1:51571801-51571823 CAGAATAGAGACTCAAAACTTGG - Intergenic
907181053 1:52570504-52570526 AAGAGCTGAAAGTCACTACTGGG - Intergenic
907289035 1:53401087-53401109 CAGAGCTGAGAGACAAAAATGGG + Intergenic
907760267 1:57351181-57351203 CAGAACTGGAACTCAAATCTAGG + Intronic
907820236 1:57960228-57960250 CTGAGCTGGGACTCAAACCTAGG - Intronic
908009853 1:59764905-59764927 CAGAGCTGACCTTCATAACTGGG - Intronic
908408155 1:63835145-63835167 CAGAGCTGAGATTTAAAACCAGG - Intronic
908468702 1:64420786-64420808 CAGAGCTGCAACTGAAATCCAGG + Intergenic
908698077 1:66867326-66867348 CAGACTTGAAAGTCAAAAGTTGG - Intronic
909324209 1:74329167-74329189 CAGAAGTGAAATTCAAAACCAGG - Intronic
909924168 1:81419062-81419084 CAGAACTAAAGCTCAAAAGTAGG + Intronic
910516923 1:88072410-88072432 CAGAGCAGAAATTCAAACCCAGG - Intergenic
910553335 1:88501227-88501249 CTGAGCTGAGACTCAAAAGATGG + Intergenic
910575360 1:88756989-88757011 CAAAACTGAGACTCAAACCTGGG + Intronic
910834355 1:91493426-91493448 CAGAGCTGAAATTGGAATCTAGG - Intergenic
910954932 1:92692504-92692526 AAAAGCTGAAGCTCAAAAATCGG + Intronic
911323111 1:96438945-96438967 CAGATCTCAAACTCCATACTGGG + Intergenic
912125723 1:106535497-106535519 CAGAGCTGAAAAGGAAAACGTGG + Intergenic
912544569 1:110441494-110441516 CAGAGCTGGGACTCAAACCCAGG + Intergenic
912546144 1:110453134-110453156 CTGAGCTGAAATGCAAAGCTGGG - Intronic
913986067 1:143567253-143567275 CAGAGATTATACTCAAGACTTGG + Intergenic
914830595 1:151168191-151168213 CAGAGGTCAAACTCCAAAGTGGG + Exonic
916078420 1:161216955-161216977 CAGAGCTGGAACTCAAATGCAGG - Intronic
916145256 1:161732917-161732939 TAGAGCTGAGACTAAAAAATTGG + Intergenic
917123515 1:171665188-171665210 CAGAGCTGTGACTCACAGCTAGG - Intergenic
917162223 1:172070646-172070668 CAGAGCTGAAATTCAAATTCAGG - Intronic
917207142 1:172588308-172588330 CAGAGCTAAAACTAGAATCTAGG - Intronic
917482329 1:175423072-175423094 CAGATCTGAAAATTGAAACTTGG - Intronic
918075876 1:181171145-181171167 AAGAGCTGAAGATCAACACTGGG + Intergenic
918141635 1:181724846-181724868 CAGAGGTGGAACTTAAAACCAGG - Intronic
918421417 1:184367753-184367775 CAAAGCTGGAATTCAAAACATGG - Intergenic
918437808 1:184534395-184534417 TAGAGCTAAAACTCAAATCTGGG + Intronic
918487114 1:185041392-185041414 CAGAGCTGAGGCTCAGACCTTGG - Intergenic
918518194 1:185385658-185385680 CAGAGCTGGGATTAAAAACTAGG + Intergenic
920087171 1:203426057-203426079 CAGAACTGGAACTGAAACCTAGG - Intergenic
920225842 1:204438440-204438462 CAAGGCTGTAACTCAAAGCTAGG - Intronic
920456991 1:206109173-206109195 CAGAGCTGAGATTCAAACCCGGG + Intergenic
921602962 1:217126095-217126117 CAGAGCTGAGACTCAAAGCTAGG - Intronic
921696063 1:218212269-218212291 CAGAGCTAAGACTCAAAGTTAGG + Intergenic
921769296 1:219016390-219016412 CAGTGCTGCAAGTCCAAACTAGG - Intergenic
921877659 1:220217109-220217131 CAGAGCCCAAACTAAAATCTAGG + Intronic
922132191 1:222790887-222790909 CAGAGCTAAAGCTCAGACCTTGG + Intergenic
922195949 1:223360825-223360847 CAGAGCTGAAAATCAGCCCTCGG - Intronic
923959936 1:239068606-239068628 TAGAGCTAAAATTCAAAACCAGG - Intergenic
1063604986 10:7515276-7515298 CAGGGCTGGAACTGAAATCTAGG - Intergenic
1064458067 10:15507278-15507300 CAGAACTGACATTCAAATCTAGG - Intergenic
1065116828 10:22491414-22491436 CAGAGCTGAAGGTCAAAGCCAGG - Intergenic
1066499132 10:35973012-35973034 TGCAGCTGAATCTCAAAACTTGG - Intergenic
1066499136 10:35973056-35973078 TACAGCTGAACCTCAAAACTTGG - Intergenic
1066530976 10:36338602-36338624 CAGAGTTGAGAGTCAAACCTGGG - Intergenic
1066626968 10:37416913-37416935 TGCAGCTGAACCTCAAAACTTGG - Intergenic
1066626970 10:37416957-37416979 TACAGCTGAACCTCAAAACTTGG - Intergenic
1067279313 10:44859359-44859381 CAGAGAGAAAAGTCAAAACTTGG + Intergenic
1067544031 10:47179029-47179051 CAAAGCTGAGACTCAAACCTAGG - Intergenic
1067769534 10:49113553-49113575 CAGAGCTGGAATTCGAACCTAGG + Intronic
1068009803 10:51434018-51434040 CTGAGCTGTAACTCAAAGCCTGG + Intronic
1068169110 10:53370734-53370756 CAGAGCTCAAACACCATACTGGG - Intergenic
1068576201 10:58687351-58687373 CAGATCTGAAACTCCATGCTGGG + Intronic
1069486428 10:68827062-68827084 CAGAACTGAGACTCAAACCTAGG + Intergenic
1069528381 10:69194880-69194902 CAGAGATGAAATTCAAACCCAGG - Intronic
1070837093 10:79455352-79455374 CAGAGTTGAAACACAAAAGTAGG - Intergenic
1071302855 10:84269923-84269945 CAAAGCTGGAACTCCAAAGTGGG - Intergenic
1071789150 10:88936250-88936272 CAGATCTGATATTCAAACCTGGG + Intronic
1072068242 10:91891034-91891056 CAGAGCTGAAACTTGAACCAAGG - Intergenic
1072270113 10:93768236-93768258 CAGAGCTGATACTAAAAAGAGGG + Intronic
1073128017 10:101164309-101164331 GAGAGCTGAAACTCCACCCTGGG - Intergenic
1073487321 10:103827809-103827831 CAGAGCCGGAATTCAAATCTAGG - Intronic
1073639485 10:105236252-105236274 CAGAGCCAGACCTCAAAACTGGG + Intronic
1073815229 10:107199092-107199114 TGGAGCTGAAACTCAAACCATGG - Intergenic
1074878274 10:117631605-117631627 CAGAGCTGTAGCTCAAATCCAGG + Intergenic
1074905318 10:117857516-117857538 CAGAGCTGCAATGCAAACCTAGG - Intergenic
1074916908 10:117965832-117965854 TAGTGCTTAAACTTAAAACTTGG - Intergenic
1075380073 10:122011862-122011884 CAGAGCTGAGATCCAAACCTAGG - Intronic
1075426170 10:122343309-122343331 CAGCGCTGAGACTCAAACCCAGG - Intergenic
1075427870 10:122355956-122355978 CAGAGCTTGAACTCAAAACTGGG + Intergenic
1075797780 10:125133469-125133491 CAGGCCAGAAACTCAAAACCAGG + Intronic
1076773005 10:132677276-132677298 CAGAGCTGAACCTCCCCACTGGG + Intronic
1077943594 11:6870713-6870735 CAGAGAGGAATCTCAAATCTGGG - Exonic
1078443794 11:11389061-11389083 CAGAGCTGAAAAGCAAACCCAGG + Intronic
1078469259 11:11573992-11574014 AAGAGCTGACATTCAAATCTAGG + Intronic
1078826574 11:14935731-14935753 CAGAGCAGAATCTGAAACCTTGG - Intronic
1078982951 11:16559438-16559460 CAAATCTGAAACTGAAAAGTGGG + Intronic
1079056507 11:17210768-17210790 CAGAGCTGGGATCCAAAACTGGG + Intronic
1079243542 11:18737462-18737484 CAGAGCTGAATTTCAGACCTGGG - Intronic
1079244264 11:18741479-18741501 CAGAGCTGAAATAAAAAGCTAGG + Intronic
1079355678 11:19728527-19728549 CAGAGCTGAAATCCAAACCCTGG - Intronic
1079495817 11:21042788-21042810 CAGAGCTGGAACACACAGCTTGG - Intronic
1079612296 11:22447976-22447998 CAGAGCTCAAAATGGAAACTGGG + Intergenic
1080156688 11:29119411-29119433 CAGAGCTGAGATTCAAACCCTGG + Intergenic
1080448556 11:32359545-32359567 CAGAGCTGAAAGTCAAAAGGTGG + Intergenic
1080559721 11:33451986-33452008 CAGAGCTGAAATTTAGACCTGGG + Intergenic
1080688040 11:34531997-34532019 CAGAGCTGGAATTCAAACCCAGG + Intergenic
1080709592 11:34734212-34734234 CAGAGCTGAGACTCAGACCCAGG + Intergenic
1080799685 11:35598671-35598693 CAGAGCTGGCACTCAAACCTGGG + Intergenic
1080815376 11:35751098-35751120 CAGAGTAGACACTCAAATCTTGG + Intronic
1080967968 11:37235916-37235938 CAGAGCTGTGACTGAAACCTAGG - Intergenic
1081074744 11:38657129-38657151 CAGAGCTGAAATTAGAAACCAGG + Intergenic
1082258718 11:50061275-50061297 CAGAGGTGCCACTCAAAACACGG + Intergenic
1082945142 11:58750252-58750274 CAGAGCTCAAACTCCATGCTGGG - Intergenic
1083165890 11:60887423-60887445 CAGAGCTGGGATTCAAACCTGGG + Intergenic
1084612733 11:70213917-70213939 AAGAGCTGAGACTCAAAACCAGG - Intergenic
1085136409 11:74093032-74093054 CAAAGTTGTAACTCAAACCTAGG + Intronic
1085587284 11:77721495-77721517 CAGACCTAATATTCAAAACTAGG - Intronic
1085718758 11:78895492-78895514 CAGAGCTGAAACTAAAACCCAGG + Intronic
1085898457 11:80667713-80667735 CAGAGTTAAAATACAAAACTTGG - Intergenic
1086067050 11:82756660-82756682 CAGAGCTGAGATTCAAACCTGGG + Intergenic
1086124598 11:83337303-83337325 GAGAGCTGAAACTCAACCATTGG - Intergenic
1086912476 11:92488823-92488845 CAGAGCTGAAATTCAAACCCAGG - Intronic
1087059107 11:93961262-93961284 CAGAACTGACACTCAAATGTAGG + Intergenic
1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG + Intergenic
1087192264 11:95267549-95267571 CACAGCTTATACTCAAAACCAGG + Intergenic
1087290050 11:96311137-96311159 CAGGGCTTAGACTCAAATCTAGG + Intronic
1088381023 11:109192851-109192873 CAGAGCTCAAACTCCATGCTGGG + Intergenic
1088621702 11:111691481-111691503 CAGACCTGGAATTCAAACCTAGG + Intronic
1088700782 11:112409410-112409432 CAGAGCTGGAATTCAATACCAGG + Intergenic
1088837017 11:113586421-113586443 CAGAGCTGAGATTCAAACCCAGG + Intergenic
1089004567 11:115080523-115080545 CAGAGGTGGAACCCATAACTTGG - Intergenic
1089091837 11:115884883-115884905 CAGAGCTGTAACTTAAATCCAGG + Intergenic
1089192894 11:116667347-116667369 CAGAGCTCAAACTCCATGCTAGG - Intergenic
1089514218 11:119021521-119021543 CAGAGCTAGAACTCAAAGCCTGG + Intronic
1089890473 11:121875522-121875544 CAGCACTGAAACTCAAAACAGGG - Intergenic
1089967266 11:122663771-122663793 CAGAGCTGGAATTCAAAGCCAGG - Intronic
1090173561 11:124626455-124626477 CAGAACTGAAACGCAAATCTGGG - Exonic
1091092832 11:132788788-132788810 CAGAGCTGAGATTCAAATCCAGG + Intronic
1091161103 11:133421567-133421589 CAGAGATAAAATTGAAAACTGGG + Intronic
1091806146 12:3357454-3357476 CAGAGCTGAGATTCAAACCCAGG - Intergenic
1091983186 12:4883198-4883220 CAGAGCTGAGATTCAAATCCAGG - Intergenic
1093087139 12:14878643-14878665 CAGAGCTGGCATTAAAAACTAGG + Intronic
1093113241 12:15178535-15178557 TAAACCTGAAACTCAAATCTAGG - Intronic
1093160452 12:15740708-15740730 CAGAGCTGAAATTTAAACTTGGG - Intronic
1093199426 12:16169272-16169294 AAGAGCTGGTACTCAAAACAAGG + Intergenic
1093566959 12:20618303-20618325 CAGGGCTAAAACTCAAAAGAAGG - Intronic
1093649528 12:21627072-21627094 CAGAGCTCAAACACCATACTGGG + Intergenic
1093937250 12:25014328-25014350 AAGAGCAGAAACTCAGAAATGGG + Intergenic
1094697687 12:32837290-32837312 CAGAGTTGAAACTCAAATGCCGG - Intronic
1094750422 12:33399934-33399956 CAGAGATGAAACAGAAAACTAGG + Intronic
1095333325 12:40995967-40995989 CAGAGCTGGGATTCAAATCTAGG + Intronic
1096036872 12:48479819-48479841 CAGACATGAAACTCAAAGTTTGG - Intergenic
1096489399 12:52005592-52005614 CAGAGCTGAGATTCAAAGCCAGG - Intergenic
1096882528 12:54684563-54684585 CAGGGCTGGAATTCAAACCTGGG - Intergenic
1098145761 12:67496480-67496502 CAGAGCTGAGATTCAAACCCAGG + Intergenic
1098227755 12:68342280-68342302 CAGAGCTAAAAGTCAAACCCAGG + Intergenic
1098444306 12:70550613-70550635 CAGAGCTGGAACTCAAATGCAGG + Intronic
1098726468 12:73974284-73974306 CAGAAGTCAAACTCCAAACTTGG + Intergenic
1099032740 12:77548067-77548089 CAAAGCTGAAACTGGAAGCTAGG - Intergenic
1099055939 12:77840775-77840797 CAGAGCTGGAATTCCAACCTAGG + Intronic
1099425331 12:82517172-82517194 CAGAGCTGGAATTCAAACCCAGG + Intergenic
1099479976 12:83153567-83153589 CCAAGCTGAAGCTCAAAATTAGG + Intergenic
1099598199 12:84696209-84696231 CAGAAGTGAAAATCAAAAATGGG + Intergenic
1099885420 12:88524055-88524077 CAGAGTTGGGACTAAAAACTGGG - Intronic
1100669757 12:96798605-96798627 CAGAGATGAGATTCAAACCTAGG - Intronic
1100676312 12:96872139-96872161 CAGTTCTGAAAATCAAAAATAGG + Intronic
1100800368 12:98224419-98224441 CAGAACTGGAACTCCAACCTGGG + Intergenic
1100988002 12:100222737-100222759 CAGATTTGAAACTCTAAACTGGG + Intronic
1101002882 12:100374181-100374203 CAGAGCTGGAAATCAAATCCAGG + Intronic
1101828413 12:108238850-108238872 CAGAGCCGAAATACAAACCTGGG - Intronic
1101828798 12:108241234-108241256 CAGAGCTGAATCTCAAACCCAGG - Intronic
1102008759 12:109605523-109605545 CAGAGCTGGGACTCAAACCCAGG + Intergenic
1102051365 12:109864396-109864418 CAGAGCTGAGATTCAAACCCAGG - Intronic
1102077469 12:110071318-110071340 CAGATCTCAAATTCCAAACTTGG + Intronic
1103347616 12:120261909-120261931 CAGAGCTGGGATTCAAACCTTGG - Intronic
1103888220 12:124218816-124218838 GAGAACTGTAACTCAAAGCTGGG - Intronic
1104127139 12:125858584-125858606 CAGAGCAGGAAATCAAACCTGGG - Intergenic
1104235270 12:126929242-126929264 CAGAGCTGAGACACAAACCTAGG + Intergenic
1105489367 13:20872729-20872751 CAGAGCTGAAAATTAAACCCAGG + Intronic
1105765077 13:23551308-23551330 CAGAGCAGAGACTAAAACCTAGG + Intergenic
1107214730 13:37903094-37903116 CAGAGCAGAAACGAAAATCTTGG + Intergenic
1107268628 13:38587895-38587917 CAGAGCTGGAACTCACTTCTAGG - Intergenic
1107631300 13:42345218-42345240 CAGAGCTGAGATTTAAACCTAGG - Intergenic
1108261002 13:48656498-48656520 CAGAGTTGAAACTTAAACCCAGG + Intronic
1108353147 13:49605692-49605714 CAGAACTCAAACTCAAACCTAGG + Intergenic
1108376767 13:49821285-49821307 CAGAGCTGGGATTCAAACCTAGG - Intergenic
1108505474 13:51108750-51108772 CAGAACTAAAATTCAAATCTTGG + Intergenic
1108813592 13:54262799-54262821 ATGAGCTGCAATTCAAAACTTGG - Intergenic
1109031961 13:57202365-57202387 TTGAGCTGAAACTTAAATCTAGG + Intergenic
1109669462 13:65585797-65585819 CAGAGCTCAAACTCCATGCTGGG - Intergenic
1111688399 13:91529420-91529442 GACAGCTGAAACTGAAATCTAGG - Intronic
1113591421 13:111503886-111503908 CAGAGCTGGAAGTCAAAAACAGG - Intergenic
1113699111 13:112370641-112370663 CAAAACTGTAACTCGAAACTTGG + Intergenic
1114179616 14:20354773-20354795 CAGAGATCAGACTCCAAACTAGG - Intronic
1114849967 14:26372103-26372125 CAGAGCTGGAAATCCAATCTTGG + Intergenic
1114863847 14:26562625-26562647 CAGAGAGGAAGCTGAAAACTAGG + Intronic
1115411687 14:33082699-33082721 CAGAGCTGAGATTCTAAACTTGG - Intronic
1115800837 14:36991672-36991694 CAGAGCTCACATTAAAAACTGGG + Intronic
1117055946 14:51912123-51912145 CAGAACTGAGACTCAAACTTGGG + Intronic
1117546335 14:56797470-56797492 CAAAGCTGTAACCCAAAACCAGG - Intergenic
1117576685 14:57105971-57105993 CAGATCTCAAACTCCATACTGGG + Intergenic
1117588976 14:57245465-57245487 CAGAGCTGAAACTCAAACTCAGG + Intronic
1118016007 14:61661711-61661733 CAGCTCTGAAACGCAAAGCTAGG + Intergenic
1118150599 14:63185304-63185326 AAGAGCTGACATTCAAAACCAGG - Intergenic
1119040201 14:71267867-71267889 CAAAACTGAAACTGAAACCTAGG - Intergenic
1119205861 14:72792944-72792966 CACTGCTGAAACACAGAACTGGG + Intronic
1119273352 14:73329741-73329763 GTGAGCTGAGAGTCAAAACTTGG - Intronic
1119291312 14:73497529-73497551 CAGAGCTGGAATTCAAACCCTGG + Intronic
1119667880 14:76498024-76498046 CAGAGCTGGGACTCAAACCCAGG - Intronic
1120120069 14:80668224-80668246 AAGAGCTGGAATTCAAACCTAGG + Intronic
1120702944 14:87718037-87718059 CAGAGCCCAAACTCAAACCATGG + Intergenic
1120709731 14:87780933-87780955 CAGATCTGAAACTCCATGCTGGG + Intergenic
1121052331 14:90827715-90827737 CAGAGATGAAAATCAAATCCAGG - Intergenic
1121199118 14:92102813-92102835 CAGAGCTGAGACTCAAACCCAGG + Intronic
1121907756 14:97762818-97762840 CAGAGCTGAGACTCAAAAGAGGG - Exonic
1123414398 15:20084426-20084448 CAGAGTCGAGACTCAAACCTAGG + Intergenic
1123523740 15:21091537-21091559 CAGAGTCGAGACTCAAACCTAGG + Intergenic
1123949433 15:25256233-25256255 CAGATCTGAAACTCTGTACTGGG - Intergenic
1124106471 15:26742329-26742351 CAGAGTTTAAACTAAAAATTGGG - Intronic
1125024402 15:35016159-35016181 CAGAGCTCAGCCCCAAAACTTGG + Intergenic
1125484252 15:40101428-40101450 CAGAGCTGGTATTCAAACCTGGG + Intronic
1125764130 15:42121806-42121828 CAGAGCTCAAGCTCAGGACTAGG - Intergenic
1126484762 15:49168060-49168082 CAGAGCTAGAACTAAAACCTAGG - Intronic
1126574913 15:50186919-50186941 CTGGGCTGAAACTCAAAATATGG - Intronic
1127152152 15:56086968-56086990 CAGAGCTGAGACTTAAACCTAGG + Intergenic
1127342058 15:58057175-58057197 AAGAGCAGAAACTAAAAATTAGG + Intronic
1127839570 15:62819398-62819420 CAGAGATGCAACTTAAAACCAGG + Intronic
1127864180 15:63018413-63018435 CAGGGCTGGGACTCAAACCTAGG - Intergenic
1128263709 15:66251099-66251121 CAGAGCTCAAGCTCAGAACCTGG - Intronic
1128386315 15:67151199-67151221 TAGAACTGAAACACAAATCTGGG - Intronic
1128854125 15:70992864-70992886 CAGATCTCAAACTCCATACTGGG + Intronic
1128910509 15:71509601-71509623 CAGAGCTAGAAATCAAACCTGGG + Intronic
1129528650 15:76242296-76242318 CAGAGCTGCCACCCAAACCTAGG + Intronic
1129616632 15:77104111-77104133 TAGAGCTGAGATTCAAACCTAGG - Exonic
1129631565 15:77266366-77266388 CGAAGCTGAAACTCCCAACTCGG + Intronic
1129952691 15:79606073-79606095 TAGAGCAGGAACTCAAACCTGGG - Intergenic
1130977895 15:88791250-88791272 CAGAGCTGAGACTCAACACCAGG - Intergenic
1131143402 15:89996416-89996438 TAGAGCTGAAATTCAAAGGTAGG - Intergenic
1131199325 15:90383544-90383566 CAGAGCTGGAACTCAAACCCAGG - Intergenic
1131301234 15:91201466-91201488 CAGAGCTGAGACTCAACTCTGGG + Intronic
1131774777 15:95782910-95782932 GTGAGCTGGAACTCAAACCTAGG - Intergenic
1131922831 15:97349014-97349036 CAGAGCTGGAATTCAAACATAGG + Intergenic
1132081353 15:98868617-98868639 CAGAGCTGGAATTCCAACCTGGG - Intronic
1133441249 16:5822811-5822833 CAGAGCTGGAACTTAAACCTGGG - Intergenic
1133747163 16:8696113-8696135 CAGAGCTGGGACTCAAACCCAGG + Intronic
1134017091 16:10896316-10896338 CAGATCTGAAATTCTAACCTAGG + Intronic
1134054635 16:11162015-11162037 CAGAGCTTGGACTCAAACCTGGG + Intronic
1134197748 16:12171849-12171871 CAGAACTGATGATCAAAACTAGG - Intronic
1134335427 16:13295073-13295095 CAGAGCTGAGATTCTAAACCAGG + Intergenic
1134537602 16:15039001-15039023 CAGAGCTGGACCTCAAACCCAGG + Intronic
1134597917 16:15510613-15510635 CAGAACTGGAACTCAAACCCAGG + Intronic
1134638610 16:15811425-15811447 CAGAACTGAGAGTCAAACCTGGG - Intronic
1134643227 16:15846115-15846137 CAGAGCTGGGACCCAAACCTGGG + Intronic
1135559426 16:23464516-23464538 CAGAGCTGTTACTCAGAATTGGG + Exonic
1135909863 16:26550007-26550029 CAGAACTGAAACTCAAAGTCAGG + Intergenic
1136247162 16:28982630-28982652 CAGAGCTGTGATTCAAAACCAGG - Intronic
1137339322 16:47584401-47584423 CAGAGCTGAGACTCAAACCCAGG - Intronic
1138125769 16:54437382-54437404 CAGAGCAGGAACCCAAAACTTGG - Intergenic
1138149853 16:54646699-54646721 CAGAGCTGGAGTTCAAATCTCGG + Intergenic
1138249197 16:55489374-55489396 CAGAGCTGCAATTCAAACCCAGG - Intronic
1138260412 16:55616073-55616095 CAGAGCTCAAACTCCATGCTGGG - Intergenic
1138487643 16:57357076-57357098 CAGGCCTGGAACTCAGAACTTGG - Intergenic
1139775189 16:69312133-69312155 CAGAGCTGAGATTCAAACCCCGG - Intronic
1140071415 16:71653607-71653629 CAGAGCTGAGATTTGAAACTAGG - Intronic
1140734083 16:77882620-77882642 CAAAGCTGAGATTCAAAACTAGG + Intronic
1141207301 16:81942742-81942764 CAGAGCTGAGATTCAAACCCAGG + Intronic
1141402884 16:83766148-83766170 CAGAGCTGGGACTCAGAACAGGG - Intronic
1141564974 16:84895237-84895259 CAGAGCTGGGACTCAAACCTAGG + Intronic
1141936634 16:87243647-87243669 CAGAGCTGCCACTCAAATCAAGG + Intronic
1143969437 17:10784574-10784596 CAGAGCTGAAACAGAAACCCGGG + Intergenic
1144105927 17:11985203-11985225 CAGACTGGAGACTCAAAACTGGG + Intronic
1144112299 17:12047486-12047508 CAGAGTTGAGCTTCAAAACTAGG + Intronic
1144239558 17:13296858-13296880 CAGAGCTGAAGCTGAATCCTAGG + Intergenic
1144596994 17:16578295-16578317 CAGAACTGGAACTCAAATCATGG - Intergenic
1145787785 17:27605296-27605318 CAGAGCTGCAACTACAACCTGGG + Intronic
1146724906 17:35148774-35148796 CAGAGCCGAGATTCAAACCTGGG + Intronic
1147157174 17:38549817-38549839 CAGAGCTGAGGCTGAAAGCTTGG - Intronic
1148993095 17:51683312-51683334 CAGAGCTGTAACTCAGTCCTTGG - Intronic
1149153489 17:53597327-53597349 GATAGCTGAAACTGAAAAATAGG - Intergenic
1149359501 17:55878803-55878825 CAGAGCTCAAACTCCATGCTGGG + Intergenic
1149419167 17:56491782-56491804 CAGACATGAAAACCAAAACTAGG + Intronic
1149496757 17:57123290-57123312 CAGAGCTGAAACTAAAAACCAGG + Intergenic
1150235376 17:63588770-63588792 CAGAGCCAGAACTCAAATCTAGG - Intronic
1150725430 17:67647763-67647785 TGGAGCTGAAATTCAAACCTGGG + Intronic
1151524736 17:74657016-74657038 CATAGCTGAGGATCAAAACTAGG - Intergenic
1155397042 18:25397668-25397690 TAGAGCTGAAATTCAAACCCAGG - Intergenic
1155518051 18:26642476-26642498 CAGAACTAAAAATCAAAATTGGG - Intronic
1155569815 18:27180645-27180667 CAGAGCAGAAACTAGAAACCTGG - Intronic
1156109015 18:33700821-33700843 AAAAGCTGAACTTCAAAACTAGG + Intronic
1156283660 18:35668179-35668201 AAGAGTGGAAACTTAAAACTTGG + Intronic
1156659155 18:39326234-39326256 CCAAGCTGAAAATCAAACCTAGG - Intergenic
1156755830 18:40523988-40524010 GAGAGCTGAACTTAAAAACTTGG - Intergenic
1156837035 18:41566947-41566969 GTGAGCTGAAACTGAACACTAGG - Intergenic
1156872087 18:41956769-41956791 CAGAGCTGAGAATAAACACTAGG - Intronic
1157368748 18:47090747-47090769 CTGAGTAGAAACTCAGAACTAGG + Intronic
1157638528 18:49187320-49187342 CAGAGTTGATACTCAGAATTGGG - Intronic
1159150179 18:64512591-64512613 CAGAGCTGAAATTTAAATTTAGG + Intergenic
1160234312 18:77074054-77074076 CAGAGATGAGACTGAAACCTTGG + Intronic
1160873694 19:1287793-1287815 CGCAGCTGAAACCAAAAACTTGG - Intronic
1161486850 19:4540571-4540593 CAGAGCTGGAATTCAGAACCAGG - Intergenic
1161734108 19:5979808-5979830 CAGAGCTGGGACTCCAACCTAGG - Intergenic
1162568552 19:11457589-11457611 CAGAGCAGAGACTCAAACCCAGG - Intronic
1162958707 19:14113852-14113874 CTGAGCTGAACCCCAACACTGGG + Intronic
1163187428 19:15648936-15648958 CAGAGCTGGAACTTGAACCTAGG + Intronic
1163380277 19:16961669-16961691 CAGAGCTGAAACGCCATGCTGGG - Intronic
1163526739 19:17825948-17825970 AAGACAGGAAACTCAAAACTAGG + Exonic
1163618187 19:18341766-18341788 CTGAGCTGAGACTCAAACTTTGG + Intronic
1163773150 19:19202851-19202873 CAGTGCTGAATCGCAACACTCGG - Exonic
1163893563 19:20038052-20038074 CAGTTCTGAAACTCAAAACCAGG + Intronic
1164612026 19:29638954-29638976 CAGAGCTGACACTCGCATCTGGG - Intergenic
1164795996 19:31030749-31030771 CAGAGCTGACATTCAAACCCAGG - Intergenic
1164848182 19:31452348-31452370 CAGATCTGAAACTGAAAGATGGG - Intergenic
1165418923 19:35713120-35713142 CAGAGATGAAACTCAAAGGCAGG + Intronic
1166039978 19:40196162-40196184 CAGGGCTGAGACTCAAACCCAGG + Intronic
1166160084 19:40946181-40946203 CACTGATGAAACTCAAGACTAGG - Intergenic
1166169027 19:41014135-41014157 CACTGATGAAACTCAAGACTGGG - Intronic
1167739412 19:51315290-51315312 CAGTGCTGGGACTCAAATCTGGG - Intronic
925363017 2:3292620-3292642 CAGAGCCGGAACTCAAATCCAGG + Intronic
925726715 2:6879870-6879892 TAGAGCAGAAACTCAAACCCTGG - Intronic
927085614 2:19671851-19671873 CAGAGCTAAGACTCAAAGCCAGG - Intergenic
927811107 2:26180583-26180605 CAGAGCTGTTAACCAAAACTGGG - Intronic
927872848 2:26634645-26634667 CAGAGCTGAGCCTCAAACCCAGG + Intronic
928412487 2:31065836-31065858 CTGAGCTGGAACTCAAACCCAGG - Intronic
928908811 2:36397479-36397501 CAGAGCTGAGACCCAAACCCAGG - Intronic
929237973 2:39626517-39626539 GGGAGCTGAAACTGAAAACATGG + Intergenic
929843935 2:45501949-45501971 CAGATCTCAAACTCCATACTGGG - Intronic
930056362 2:47255091-47255113 CAGAGCTGGAATTCAAACCCAGG - Intergenic
930573400 2:53114721-53114743 CAGAGATGAATATCAACACTTGG + Intergenic
931490496 2:62740783-62740805 GATAGCTGTACCTCAAAACTTGG - Intronic
932132546 2:69200963-69200985 CAGACTTGAAAGTCAACACTAGG + Intronic
932950056 2:76282222-76282244 CAGAGCTGAGACCTAAACCTAGG + Intergenic
933147770 2:78876042-78876064 TAGAGATGAGATTCAAAACTAGG + Intergenic
933291546 2:80443744-80443766 AAGAGCTTAAAGTTAAAACTTGG + Intronic
933386775 2:81620862-81620884 CAGAGCTGGAACTAAATAGTTGG + Intergenic
933612711 2:84453913-84453935 CAGAGCATAAACTCAAGACCAGG - Intronic
933668952 2:84988511-84988533 TAGAGCTGGAATTCAAACCTGGG + Intronic
935872116 2:107462297-107462319 CAGCGATGAAGCTCAAGACTGGG - Intergenic
936937514 2:117852407-117852429 AAAAGCTGAATCTCAAAAGTAGG + Intergenic
936968421 2:118150271-118150293 TACAGCTGAAAGCCAAAACTAGG + Intergenic
937535484 2:122881501-122881523 CAGAGCCAGAACTCAAACCTAGG + Intergenic
937606151 2:123804061-123804083 CAGAGCTCAAACACCATACTGGG + Intergenic
938083443 2:128382523-128382545 CAGAGCTGAGCCTCAACTCTCGG + Intergenic
938937176 2:136137367-136137389 TAAAGCTTGAACTCAAAACTTGG - Intergenic
939587068 2:144019014-144019036 CAGAGATAAAAATCAAAACATGG + Intronic
940186211 2:150986831-150986853 CAGAGCTGCAACTCAGCCCTGGG + Intergenic
940455858 2:153899164-153899186 CAGAGCAGAGATTGAAAACTGGG - Intronic
940545273 2:155075506-155075528 CAGAGCTGAAAGGCAGATCTTGG - Intergenic
941109151 2:161398391-161398413 CAGACTTGAAACTGAAAACTTGG - Intronic
941347557 2:164389045-164389067 CAGAGATGTAATTCTAAACTGGG - Intergenic
941995687 2:171600071-171600093 CAGAGCTGATATTCAAATCCAGG - Intergenic
942434678 2:175958215-175958237 CAGAGCTCAAACTCCATGCTGGG - Intronic
942903303 2:181149289-181149311 CAGAGCAGGAACTCAAACCCAGG - Intergenic
943308405 2:186296455-186296477 CAGAGCTGAAATTAGAAACTAGG - Intergenic
944163870 2:196696103-196696125 CACAGCCAAAACTCAAAAGTAGG - Intronic
944841653 2:203629774-203629796 CAGAGCTGGAATTCAAACCCAGG + Intergenic
945029261 2:205648562-205648584 CAGAGCTGCTCCTCAAATCTGGG - Intergenic
945074075 2:206020182-206020204 GAGAGCTGAGATTCAAAACCAGG - Intronic
945454354 2:210033012-210033034 CACAGCTGAAAATCAAAATCAGG + Intronic
945892229 2:215442358-215442380 CAGAGCTGAAATTGAAATCACGG + Intergenic
946115586 2:217459186-217459208 GAGGGCTGAAACTCAAATATAGG + Intronic
946142723 2:217705393-217705415 CAGAGCTCAAATTCAAGACCTGG + Intronic
946953293 2:224900614-224900636 CAGAACCAAAATTCAAAACTAGG - Intronic
948619080 2:239222428-239222450 AAGAGCTGAAAATAAAAACCTGG + Intronic
1168852970 20:989264-989286 CAGAGCTGGGACTCAAACCTGGG - Intronic
1169492419 20:6082389-6082411 CAGAGGTGAGACTGAAAGCTGGG + Intronic
1169612980 20:7404067-7404089 CTTAGCTGAAGCACAAAACTGGG + Intergenic
1170036658 20:11996804-11996826 TAGAGCAGGAACTCACAACTTGG + Intergenic
1170196669 20:13695906-13695928 CAGAGCTGGGATTCAAAACCAGG + Intergenic
1170296371 20:14831102-14831124 CAGTGGTGAAACACAACACTTGG - Intronic
1170474255 20:16699405-16699427 CAGCCCTAAAACTCAAGACTCGG + Intergenic
1170897512 20:20429202-20429224 CAGGGCTGAAACTCAAACCCAGG + Intronic
1171390546 20:24798975-24798997 CAGAGCTGGAATTCAAACCTGGG - Intergenic
1172023877 20:31934948-31934970 CAGAGCTGGGATTCAAACCTGGG - Intronic
1172478990 20:35260004-35260026 CAGAGCTGGGATTCAAAACCAGG + Intronic
1172871090 20:38136009-38136031 CAGAGCTGAGATTCAAAGCCAGG + Intronic
1173120922 20:40288163-40288185 CTGACCTGAAATTCAAAACCTGG + Intergenic
1173344966 20:42190872-42190894 CAGAGCTGGAACTCAAACCTAGG - Intronic
1173830608 20:46084254-46084276 CAGAGCTGAGACTCAGACCCAGG + Intronic
1173968034 20:47128667-47128689 CAGAGCTGGGATTCAAATCTAGG - Intronic
1173990899 20:47302661-47302683 CAGAGCAAAGACTCAAACCTGGG + Intronic
1174441928 20:50562452-50562474 CAGAGCTGACACACAAAACCAGG - Intronic
1174524143 20:51157849-51157871 CAGAGCTGGAACTCGAACCTAGG + Intergenic
1175105425 20:56611390-56611412 CAGAGCCAAACCTCAAACCTTGG - Intergenic
1175202081 20:57285013-57285035 CAGAGCTGGGACTCAAACCTTGG - Intergenic
1177590896 21:23165425-23165447 AAGAGCTGCAACTCAACCCTTGG - Intergenic
1177666827 21:24170549-24170571 AAAAGCTGAAAATAAAAACTGGG - Intergenic
1177765026 21:25448342-25448364 CAGAGCAGAGATTCAAACCTAGG + Intergenic
1178027612 21:28486156-28486178 AAGAGGTGACACTCTAAACTTGG + Intergenic
1178083903 21:29093799-29093821 CAGAGATGGAACTTAAACCTAGG - Intronic
1178678659 21:34653101-34653123 CAATGCTGATACTCAAAACAGGG - Intergenic
1178776537 21:35556830-35556852 CAGTAATGAAACTTAAAACTTGG + Intronic
1178898216 21:36577952-36577974 CAGAGCTGAGACTCAAACCCTGG - Intergenic
1179308026 21:40172573-40172595 CAGAGCTGAGACTCAAGCCTCGG + Intronic
1179766108 21:43574330-43574352 AAGGGCTGAAACTCAAAAAAAGG - Intronic
1179900879 21:44393383-44393405 CCAAGCTGAAATTCAAAACAGGG - Intronic
1181735726 22:24880077-24880099 TAGAGCTGAGACTCAAACCTTGG + Intronic
1182028597 22:27139522-27139544 CAGAGCTGAAATTCAAACTCAGG - Intergenic
1182305505 22:29365155-29365177 CAGGGCTGAAACTGAAAACCAGG + Intronic
1182312783 22:29421094-29421116 TAGGACTGAAACTCAAAACCAGG + Intronic
1182332695 22:29562059-29562081 CAGAGCTGGAGCTCAAATCCAGG - Intronic
1182432484 22:30308172-30308194 CAGAGCTGGGACTCAAACCCAGG + Intronic
1182545715 22:31075140-31075162 CAGAGTCGAGACTCAAACCTAGG - Intronic
1183290792 22:37000512-37000534 CAGAACTGGAACTCAAACCTAGG - Intronic
1183770495 22:39921214-39921236 TAGAGCTGAAATTCAAATCCAGG - Intronic
1183907999 22:41057330-41057352 ATGAGCTGAAAGGCAAAACTGGG + Intergenic
1184487597 22:44790293-44790315 CCTAGCTGAAACCAAAAACTGGG + Intronic
1184900441 22:47443520-47443542 CAGAGCTGGGACTCAAAACAGGG - Intergenic
1185200077 22:49496526-49496548 CTGAGCTAAAATTCAAAACTAGG + Intronic
949155068 3:817124-817146 CAGAGCTGAAACTCTGTGCTGGG - Intergenic
949517699 3:4822040-4822062 CAGAGCGGAAACTCTCACCTTGG - Intronic
949577594 3:5353662-5353684 CAGAGCTGAAATTCAAATGTAGG - Intergenic
949716585 3:6938857-6938879 CACATCTGAACCCCAAAACTTGG + Intronic
949781985 3:7700045-7700067 CATAGCTGATACTCAGAAATTGG + Intronic
950137945 3:10595583-10595605 CAGAGCTGAAACTTAAACCCTGG + Intronic
950195060 3:11003480-11003502 CAGAGCTGAAACTCAAAACTGGG + Intronic
950399399 3:12759059-12759081 CAGAGCTGGGACTCAAACCCAGG + Intronic
950585353 3:13888335-13888357 CTGAGCCGAGACTCAAAGCTGGG - Intergenic
950649739 3:14399807-14399829 TAGAGCTGGAATTCAAACCTAGG - Intergenic
950811025 3:15649862-15649884 CAGAGCTGTCACTCACTACTAGG - Intergenic
950915122 3:16637028-16637050 CAGAGCTGACAATAATAACTAGG + Intronic
950942649 3:16909198-16909220 AAGAACTGAAACTCAAAACAAGG - Intronic
952277835 3:31894699-31894721 CAGAGCTGAAATTCAGATCCTGG - Intronic
952469406 3:33630341-33630363 CAGAGCTGGGATTCAAACCTAGG + Intronic
952933691 3:38379126-38379148 CAGATTTGAAACTCATAGCTGGG - Intronic
953126264 3:40094339-40094361 CTGAGCTGGAACTCAGAGCTTGG + Intronic
953460573 3:43078708-43078730 AAGTGCAGAAACTCATAACTGGG + Intergenic
953878555 3:46679929-46679951 CAGAGCTGACACTCACACCCTGG - Intronic
954500954 3:51013661-51013683 CAGAGCTGAAACGCCATGCTGGG + Intronic
954827983 3:53391776-53391798 CAGAGCTCAAACTCCATGCTGGG - Intergenic
955616897 3:60818941-60818963 GGGAGCTGAAATTCAAAACTTGG - Intronic
955895414 3:63694555-63694577 CAGAGCTCAAACACCAAGCTGGG - Intergenic
956027605 3:65000235-65000257 CAGAGCTGAAATTGAAACCCAGG + Intergenic
956294526 3:67697248-67697270 CAGAGCAGATACTCAATACAGGG - Intergenic
956319312 3:67978661-67978683 CATAACTGAAACTCAAATCACGG + Intergenic
956805207 3:72803112-72803134 TAGAGCAGAGACTGAAAACTGGG + Intronic
957245774 3:77713825-77713847 TAAAGCTGAAACTTAAAAATAGG - Intergenic
957336436 3:78835363-78835385 CAGAGATGAAATTTATAACTTGG + Intronic
958028687 3:88080568-88080590 CAGAGCTGGAATTCAAACCTAGG + Intronic
959653469 3:108774439-108774461 CAAAGCGCAAACTCAAAACATGG - Intergenic
959904988 3:111701532-111701554 TAAAGCTCAAACTCAACACTGGG - Intronic
960004382 3:112767051-112767073 CAAAGCAGAAACTCTAAAATAGG - Intronic
960078115 3:113511876-113511898 AAGAGCTGACACTCAAGACCAGG + Intronic
962022801 3:131517759-131517781 CACAGTGGAAATTCAAAACTAGG + Intergenic
962070230 3:132025784-132025806 CAGAGCTGAAATTCAAACCTAGG + Intronic
964647954 3:158978835-158978857 CAGACCTGGAATTCAAATCTAGG + Intronic
964848319 3:161067709-161067731 CACAGCTGAAACCCAGGACTGGG + Intronic
965919316 3:173893318-173893340 CAGAGCTGAAATCTAAACCTCGG - Intronic
966869393 3:184280241-184280263 CAGAGCTGAGACTGAAATCCAGG - Intronic
967327420 3:188255355-188255377 CAGAACTGAGACTCAAAACCAGG + Intronic
967599068 3:191362848-191362870 CAGAGCTGCAAGTAAAAATTAGG + Intronic
967834059 3:193945943-193945965 CAGAGCTGAGACCCAAACCCAGG + Intergenic
968053206 3:195670524-195670546 CAGAGCTCAAACCCAAACCTGGG - Intergenic
968102607 3:195977837-195977859 CAGAGCTCAAACCCAAACCTGGG + Intergenic
970366483 4:15363932-15363954 CAGAGCAGACACTCAAAAAATGG + Intronic
970533436 4:17005310-17005332 CAGAGCTGAGATTCAAATCCAGG + Intergenic
971272235 4:25160768-25160790 CAGGACTGAAACACAGAACTTGG - Intronic
972759028 4:42083390-42083412 CAGAACTGAAAATCAATAATTGG - Intronic
973599015 4:52522500-52522522 CAGAGCTCAAACGCCAAGCTGGG - Intergenic
974324729 4:60398783-60398805 CAGAGCTGAAGCACAAAATTTGG + Intergenic
975081838 4:70290410-70290432 CAGAGCTGAGAGTCAAACCTGGG + Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
976381645 4:84406237-84406259 CAGAACTCAGACTCAAACCTGGG - Intergenic
976570572 4:86604172-86604194 AAGAGCTAAAACTCAAACCGAGG - Intronic
976574731 4:86656706-86656728 CAGATCTGAAACTCCATGCTGGG + Intronic
976906668 4:90244920-90244942 CAGAGCTGGAATTCAAACCAAGG - Intronic
977792784 4:101127931-101127953 CAGAGCTGGAATTCAAACCAAGG + Intronic
978701281 4:111649500-111649522 CAGATGTCAACCTCAAAACTGGG - Intergenic
979305287 4:119135291-119135313 AAAAGCTGAGACTCATAACTGGG - Intergenic
980089200 4:128424351-128424373 CAGAGCTGGGGCTCAAAACTGGG - Intergenic
980416254 4:132492533-132492555 CAGAGCTAAAATTCTAATCTAGG - Intergenic
981399690 4:144299338-144299360 CAGATCTGAAATTCACAACCAGG - Intergenic
981460328 4:145006508-145006530 CAGAAGTGAAATTCAAATCTAGG - Intronic
981514862 4:145596787-145596809 CAGATCTCAAACTCCACACTGGG + Intergenic
981869449 4:149468634-149468656 CAGATCTGAAACTCCATGCTGGG - Intergenic
982357003 4:154481809-154481831 CAGAGCTGAAATTTAAACTTGGG + Intronic
983183585 4:164676535-164676557 CAGATCTGAAACTCCATGCTGGG - Intergenic
984208769 4:176819809-176819831 CAGACCTGAAACTGACAACCAGG + Intergenic
985499457 5:232872-232894 CAGAGCTCAAACCCAAACCTGGG - Intronic
986427109 5:7644562-7644584 TAGATCTGAAACTCAAGACAAGG - Intronic
986594678 5:9409083-9409105 CAGAGTTGAAACTAAAACCCTGG + Intronic
987170656 5:15254003-15254025 CAGAGCTGGGACTCAAATCTTGG - Intergenic
987919492 5:24260325-24260347 TAGAGATGAAACTGAAAATTTGG + Intergenic
988893322 5:35643907-35643929 TAAAGCTGAAACACAAACCTAGG + Intronic
988895736 5:35672823-35672845 AAAAGCACAAACTCAAAACTGGG - Intronic
989509782 5:42272118-42272140 CAGAACTGGGACTCAAAACAGGG + Intergenic
989678096 5:43996666-43996688 CAAAGCTGGGACTCAAACCTAGG - Intergenic
989736887 5:44718314-44718336 AGGAGCTGAAACTCAAACCTAGG + Intergenic
990001899 5:50903275-50903297 AAAAGCTGAAACTCAAAAGTAGG - Intergenic
990230264 5:53705677-53705699 CAGAGCTCAAACTCCATGCTGGG + Intergenic
991132839 5:63144938-63144960 CAGAGCTGAAACTACAAGCCTGG + Intergenic
991561470 5:67958123-67958145 AAGAGCTGAAACTAAACCCTAGG + Intergenic
991630980 5:68656106-68656128 CAGAGCTGGGATTCAAACCTTGG - Intergenic
991985499 5:72281968-72281990 CAAAGCTGGGACTTAAAACTAGG - Intronic
992481704 5:77158114-77158136 CAGAGCTGGAACTCATACCCAGG + Intergenic
992579650 5:78158629-78158651 CAGAATTCAAACTCAGAACTAGG + Intronic
992580899 5:78174715-78174737 CAGAGCTCAAACACCAAGCTGGG + Intronic
992717691 5:79527187-79527209 CAGAGGTGAAATTCAAACCCAGG - Intergenic
994150400 5:96440964-96440986 CAGAGCTGAGAATCAAATCCAGG - Intergenic
994998586 5:107098184-107098206 CAGAGCTCACATTCAAACCTAGG + Intergenic
995399914 5:111729251-111729273 CAGAGAAGACATTCAAAACTAGG + Intronic
995474909 5:112538365-112538387 CAGAGCTGAAACTCGTGTCTAGG - Intergenic
995714279 5:115066860-115066882 CAGAGCTTCAACAAAAAACTTGG + Intergenic
996587315 5:125104439-125104461 CAGCGCTGATGCTCAAAAATGGG - Intergenic
997360918 5:133294317-133294339 TAGAGATGAAACTCAAATCAGGG - Intronic
997399312 5:133590384-133590406 CAAAGCTGAGATTCAGAACTGGG + Intronic
997649332 5:135503924-135503946 CAGAGCTGAAAGACACCACTAGG - Intergenic
997771690 5:136560973-136560995 CAGAGCTGCAACTCAAACTCAGG + Intergenic
997995694 5:138584169-138584191 TAGAGCTCAAAGTCAGAACTGGG + Intergenic
998600208 5:143577671-143577693 GAGAGCAGAGGCTCAAAACTGGG + Intergenic
998974540 5:147629875-147629897 CAAAATTGAAACTTAAAACTAGG - Intronic
999410229 5:151344013-151344035 CAGAGCCGGAACTCAAACCCAGG + Intronic
999530691 5:152460359-152460381 CAGAGCTGGAATTCAAACCTGGG + Intergenic
999551288 5:152689909-152689931 CAAAGCTGAAACTCAAAGCAGGG + Intergenic
999644260 5:153702345-153702367 CAGAGTTGGAACTCAAATCCAGG - Intronic
999649694 5:153753502-153753524 CAGAGCTGGGACTAGAAACTGGG - Intronic
999685912 5:154102976-154102998 CATAGCAGACACTCAATACTTGG + Intronic
999785702 5:154888549-154888571 GAGAAATGACACTCAAAACTAGG + Intronic
1000332673 5:160218352-160218374 CAGAGCTGGGATTCAAACCTAGG + Intronic
1000595728 5:163212612-163212634 CAGATCTCAAACTCCATACTGGG - Intergenic
1000996616 5:167965824-167965846 CAGAGCTGAAATTTGAACCTGGG + Intronic
1001278873 5:170371520-170371542 CAGAGCTGGAATTCAAATCTAGG - Intronic
1001349563 5:170946086-170946108 CAGAGCTGTGACTGAAATCTAGG - Intronic
1001768609 5:174275311-174275333 CAAAGCTGAAATTCAAATTTGGG + Intergenic
1001906104 5:175474723-175474745 GAGAGCTGAAACTCAAGCATGGG + Intergenic
1002010180 5:176273091-176273113 CAGATCTCAAACTCCAAGCTGGG - Intronic
1002371152 5:178755931-178755953 CAGAGCTGGAAATAAAATCTAGG + Intergenic
1002838212 6:883446-883468 CAAAGCGGAATCTCAAACCTAGG + Intergenic
1003338398 6:5196437-5196459 CAGAGCTGGAACTCAACTCAGGG - Intronic
1005271164 6:24164944-24164966 TAGAGCTGAAGATCAGAACTAGG - Intergenic
1006192608 6:32218834-32218856 CAGAGCTGAGATTCAAACCAAGG - Intronic
1006777751 6:36609267-36609289 TGGAGCTGAAACTATAAACTTGG + Intergenic
1007894136 6:45331478-45331500 CAGAGCTAAATTCCAAAACTAGG + Intronic
1008117027 6:47563151-47563173 CAGAACTGAAAATCAGAACAAGG - Intronic
1008905195 6:56669700-56669722 CAGACTTGGAACTCAAACCTAGG - Intronic
1009415299 6:63409549-63409571 CAGAGCTGAAATTTAAAATAAGG - Intergenic
1009835234 6:68991909-68991931 CAAAGTTGAAACACAAACCTAGG + Intronic
1010013082 6:71072543-71072565 CAGAGCTGAAACTAGAACCAAGG + Intergenic
1010029061 6:71254133-71254155 CAGAGCTGAGAATCAAATCCAGG + Intergenic
1010648250 6:78420336-78420358 CATAGCAGATTCTCAAAACTGGG - Intergenic
1010808750 6:80271705-80271727 TAGCTCTGAAACTCAGAACTTGG - Intronic
1012542703 6:100380282-100380304 CAGGGCTGAGATTCAAATCTAGG + Intergenic
1012803798 6:103869268-103869290 CAGAGCTGAGAGGCAAATCTAGG + Intergenic
1013026325 6:106276523-106276545 AAGACCTGAAACTAAAAACCAGG + Intronic
1014815915 6:125935226-125935248 TAGAGCTGAGATTCAAAATTTGG - Intergenic
1015001635 6:128223800-128223822 CAGGACTAAAATTCAAAACTAGG + Intronic
1016371998 6:143384924-143384946 CAGGGCTGAAACTCCAACGTGGG - Intergenic
1017029015 6:150204722-150204744 CAGAGATGAAACTGAAACCTGGG + Intronic
1017665349 6:156714955-156714977 CAGCGCTGAAAATCAATAGTAGG - Intergenic
1019595727 7:1857531-1857553 CAGGGCAGAAACTCAAAAGATGG - Intronic
1019935878 7:4257574-4257596 CAGAGCTGAAGCTAAAAGCTGGG - Intronic
1020852376 7:13372561-13372583 CAGTGTTAAAACTCAAAAATAGG + Intergenic
1021153973 7:17186591-17186613 CAGAGCTGGGACTCAAAACCAGG - Intergenic
1021168280 7:17367638-17367660 CAGAGCTGAATCACAATCCTGGG + Intergenic
1021306594 7:19039738-19039760 CAGAGCTCAAACACCATACTGGG + Intronic
1021794542 7:24240792-24240814 CTCAGCTAAAACTTAAAACTTGG + Intergenic
1022300978 7:29102118-29102140 CATAGCTGGAATTCAAACCTTGG - Intronic
1022453625 7:30538125-30538147 CAGATCTGAAACTCCATGCTGGG - Intronic
1022525800 7:31036415-31036437 CAACGCTGACATTCAAAACTGGG + Intergenic
1023284602 7:38606087-38606109 GAGAGCTGGGACTCAAACCTAGG + Intronic
1024407689 7:49001598-49001620 TAGAGCTGAAAGGCAAAACATGG - Intergenic
1025815261 7:64904923-64904945 CAGTACTAAAACTCAAAACCAGG - Intronic
1026477700 7:70750917-70750939 AAGTGTTGAAACTCGAAACTAGG + Intronic
1027351693 7:77318144-77318166 CAGAGCTGATATTCAAATCCAGG - Intronic
1028112044 7:86952378-86952400 CAAAGCTGAAACTCAAATTCTGG + Intronic
1028204579 7:88001889-88001911 CAGAGCTGCAACTCAAGCCTGGG - Intronic
1028457379 7:91053335-91053357 CAGAGCCAAAACTCAAACCCAGG + Intronic
1028526864 7:91796180-91796202 CAGAACTGGAACTGAAGACTTGG - Intronic
1028556521 7:92132068-92132090 AAGAACAGAAACTCAAAACACGG + Intronic
1031131235 7:117835813-117835835 TAGAGCCAAAACTCAAATCTAGG - Intronic
1036421415 8:8599492-8599514 CAGCGCTGAAACTCAAATCCAGG + Intergenic
1037341217 8:17847652-17847674 CCGATCTTAAACTGAAAACTAGG + Intergenic
1037381974 8:18295336-18295358 TAGAGCTGAAACTGAACACAAGG + Intergenic
1037382224 8:18298372-18298394 AAGAGTAGACACTCAAAACTTGG + Intergenic
1037950646 8:23017057-23017079 CAGGGCTGAAAGTCAGCACTGGG - Intronic
1038700673 8:29846744-29846766 CAGAGCTGGGACTCAAGCCTGGG - Intergenic
1038919954 8:32071780-32071802 CAGAGCTGAGATGCAAACCTAGG - Intronic
1039628197 8:39078145-39078167 CAGAATTGGAACTGAAAACTTGG - Intronic
1039833418 8:41236133-41236155 CAGAGCTGAGACTGAAACCCAGG - Intergenic
1040602181 8:48896336-48896358 CAGAGCGGTAAGTCTAAACTGGG + Intergenic
1041526659 8:58813960-58813982 CAGAGCTGGAATTCAAACCCAGG - Intronic
1042881461 8:73496463-73496485 CAGAGCTGATACTCAGACCCAGG - Intronic
1042899431 8:73707618-73707640 CTAATATGAAACTCAAAACTGGG + Intronic
1043299250 8:78705962-78705984 CAGAGCAGGACCTCACAACTGGG - Intronic
1043648179 8:82549723-82549745 CAGAGCTGGGACTCAACACTAGG - Intergenic
1043678574 8:82993317-82993339 TAAAGGTGAAACTCAAAGCTAGG - Intergenic
1044350845 8:91164773-91164795 CAGAGCTGAAACTCAAACCTAGG + Intronic
1044449138 8:92313646-92313668 CAGAGCTCAAACTCCATGCTGGG + Intergenic
1044534356 8:93342552-93342574 AAAAGCTGCAACTCAAACCTTGG + Intergenic
1044714997 8:95092094-95092116 CACAGGTGTGACTCAAAACTCGG - Intronic
1044784056 8:95776099-95776121 CAGAGCTGAGATTCAAGTCTGGG + Intergenic
1044956579 8:97487639-97487661 CAGAGCTCAAACACCACACTGGG + Intergenic
1045327954 8:101130605-101130627 CAGAACTGGAACTCAAAGCCAGG - Intergenic
1045610317 8:103832943-103832965 CAGAACAGAAACTTAAAACAAGG - Intronic
1045912946 8:107431636-107431658 GAGAACTGGAATTCAAAACTAGG - Intronic
1046728377 8:117698699-117698721 CAGAGCTGAATGTCAATGCTGGG + Intergenic
1046733226 8:117748469-117748491 CAGAGCTGAAATTAGAACCTAGG + Intergenic
1046829774 8:118731629-118731651 CAGAGCTGGAATTCAAACCTAGG + Intergenic
1046957210 8:120074058-120074080 CATAGCTGACCCTAAAAACTGGG + Intronic
1047234634 8:123029235-123029257 CAGAAATGAAACTGACAACTAGG - Intronic
1047682314 8:127266586-127266608 GAGAGCTGAAGCTCAAATCCTGG - Intergenic
1047903769 8:129451294-129451316 CAGAGCTGAGATTGGAAACTTGG - Intergenic
1048281748 8:133110796-133110818 AAGAGCTGGAACCCAAATCTGGG + Intronic
1048550622 8:135430468-135430490 CAGAGCTAGAATTCAAACCTAGG + Intergenic
1049269697 8:141687877-141687899 CAGAGCTGAAGCTCAAATCCAGG - Intergenic
1050012601 9:1200295-1200317 CAGAGCTGGAATTCAAACCCAGG - Intergenic
1050191768 9:3033718-3033740 CAGAGGTAAAACTCAAGCCTGGG - Intergenic
1050193384 9:3053901-3053923 CAGAACTGGAATTCAAACCTAGG + Intergenic
1051213812 9:14775219-14775241 CAAAGCAGAAATTCAAAGCTAGG + Intronic
1051767213 9:20538372-20538394 CACAGCTGAAATTCAAATCCAGG + Intronic
1052319064 9:27147915-27147937 CAGAGCTGAGACTGAAATTTAGG - Intronic
1052499460 9:29270851-29270873 CAGATCTGAAACTCCACACTGGG - Intergenic
1053373312 9:37580985-37581007 CAGAGCTGAAACTATAATCTAGG + Intronic
1055096302 9:72418022-72418044 AAGAACTGAAACTTAAAAGTTGG - Intergenic
1056069429 9:82970470-82970492 CAGAGCTGGGACTCAAACCTAGG - Intergenic
1058148038 9:101432968-101432990 CAGAGCTGGTTCTTAAAACTAGG - Intronic
1058525579 9:105854705-105854727 TAAAGCTGAAACTCAAACCCAGG - Intergenic
1058993970 9:110281455-110281477 CAGAGGTGAAACTATAAAGTCGG + Intergenic
1059303767 9:113337979-113338001 CAGAGCTGAAACTTGAATCCAGG + Intronic
1059339108 9:113587411-113587433 CAGAGCTGAGACTTGAACCTGGG - Intronic
1059719314 9:116944201-116944223 CAGAGCTCAAATTTAAATCTGGG + Intronic
1059890727 9:118799171-118799193 CAGAAATGAAACAAAAAACTGGG + Intergenic
1060445660 9:123685024-123685046 CAGAGCTGGTACTCAAACCCAGG - Intronic
1061068171 9:128292049-128292071 CAGAGCTGAGACTCAAATCCAGG - Intergenic
1185978956 X:4755025-4755047 TAGAGCTGCAACTCAAACCCAGG - Intergenic
1186773973 X:12845818-12845840 CAGAGCCGGGACTCAAATCTAGG + Intergenic
1187572072 X:20514959-20514981 CATAGCTGAAAGTCCCAACTAGG + Intergenic
1189086828 X:38034278-38034300 CAGAGCTGGTACTCAAACTTAGG - Intronic
1189745791 X:44167705-44167727 CAGAACTGAAAAGGAAAACTTGG - Intronic
1190731317 X:53227791-53227813 CAGAGCTGAGACCCAAAATCTGG - Intergenic
1190742916 X:53301985-53302007 CAGAGCTGAGACCCAAATCCAGG - Intronic
1190874125 X:54447618-54447640 TAGAGCTGAGATTCAAAGCTAGG + Intronic
1190888386 X:54548715-54548737 CAGAGCTGAGGATCAAAACCTGG + Intronic
1190935062 X:54992470-54992492 TAGAGCTGGAACTCAAACCTAGG + Intronic
1191799181 X:65058557-65058579 CAGATCTGAAACTCCATGCTGGG + Intergenic
1191907356 X:66107794-66107816 CAGAGCTCAAACTCTATGCTGGG + Intergenic
1192370081 X:70505933-70505955 CAGGGATGAAATACAAAACTCGG - Intergenic
1193387920 X:80893102-80893124 CAGATCTGAAACTCCACACCGGG + Intergenic
1193562295 X:83033045-83033067 CACAACTGAAGCCCAAAACTTGG + Intergenic
1194382613 X:93213900-93213922 CAGAGCTGATATTCAAACCTGGG - Intergenic
1194409522 X:93540760-93540782 CAGAGCAGATACTAAAACCTAGG + Intergenic
1194547874 X:95260537-95260559 CTGAGCTGAAAAACAAAACCAGG - Intergenic
1194845678 X:98805272-98805294 AAGTGCAGAAACTCAAAACGTGG + Intergenic
1195094037 X:101489153-101489175 CAAAGCTGAAACTCATATATTGG + Exonic
1195856169 X:109335301-109335323 CAGATCTCAAACTCAATGCTGGG + Intergenic
1195956561 X:110337091-110337113 CAGAGCTGGAATTCAAATCCAGG - Intronic
1197593604 X:128440278-128440300 CAGAGTTGGGACTCAAAACCAGG + Intergenic
1197719493 X:129735488-129735510 CAGAGCTGGGACTCAAACCTGGG - Intergenic
1198012545 X:132573134-132573156 CAGAGCTGAGATTCCAATCTAGG - Intergenic
1198562024 X:137860658-137860680 CAGAGTTGAGATTCAAAGCTAGG + Intergenic
1198571331 X:137960309-137960331 CAGAGCTCAAACTCCATGCTGGG - Intergenic
1198579467 X:138048080-138048102 CAGAGTTGGAACTGAAAAGTAGG + Intergenic
1199721032 X:150542906-150542928 CAGAGCTGGAATTCAAACCTAGG + Intergenic
1200361816 X:155614634-155614656 CAGAGCTGAGATTCAAACCTAGG + Intronic
1201302721 Y:12523922-12523944 CAGATCTCAAACTCCAAGCTGGG + Intergenic