ID: 950196883

View in Genome Browser
Species Human (GRCh38)
Location 3:11015597-11015619
Sequence AGGCAGGCAGCTCCTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950196883_950196895 30 Left 950196883 3:11015597-11015619 CCCTCTGTAGGAGCTGCCTGCCT 0: 1
1: 0
2: 2
3: 23
4: 286
Right 950196895 3:11015650-11015672 CCTCCCCTTCTCTGCTTTGCAGG 0: 1
1: 0
2: 6
3: 487
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950196883 Original CRISPR AGGCAGGCAGCTCCTACAGA GGG (reversed) Intronic
902692935 1:18121627-18121649 AGGATGGCAGATCCGACAGATGG - Intronic
903335182 1:22619833-22619855 CAGCAGGAAGCTCCTAGAGAAGG - Intergenic
904480211 1:30788589-30788611 AAGCAGGCAGCTCCCTGAGAAGG + Intergenic
904766901 1:32856645-32856667 AGGCAGCTAGTACCTACAGAAGG - Exonic
904970365 1:34414634-34414656 AGGCAGGTAGGTACTATAGAAGG - Intergenic
905335341 1:37240932-37240954 AGCCTGCCAGCTCCAACAGATGG + Intergenic
905938663 1:41845013-41845035 AGGGATGGAGCTCCCACAGAGGG - Intronic
906401980 1:45511183-45511205 AGGCAGGCCTTTCCTACAGGGGG - Exonic
906767552 1:48448046-48448068 AGGCTGGCAGCTTCTTGAGATGG - Intronic
907732371 1:57079625-57079647 AAGCAGCCAGGTCCTACAGGGGG - Intronic
907795386 1:57710940-57710962 AGGGAGGCAGCTGCTCCAGTTGG + Intronic
914987901 1:152475675-152475697 AGGAAGGGTGCTCCAACAGAAGG + Intergenic
917566605 1:176218571-176218593 AGGCAGGCACCTTCTTCACAAGG - Intergenic
918192935 1:182193317-182193339 AGGCAGGCACCTTCTTCACATGG + Intergenic
918781132 1:188702034-188702056 GGGCAGGCAGTTCCTACAGTTGG - Intergenic
919201369 1:194358548-194358570 AGGCAGGCAGCTCCGAGTGTGGG + Intergenic
919681700 1:200441933-200441955 AGGGATACAGCTCCTAAAGAGGG - Intergenic
919831747 1:201546120-201546142 AGGCAGGCAGCTGCTTCGTATGG - Intergenic
919851065 1:201673240-201673262 GGGCAGGCAGGCCCCACAGATGG + Intronic
919873622 1:201844037-201844059 AGGCAGGTAACACCCACAGATGG + Intronic
920229504 1:204461210-204461232 AAGCAGGCAGGGCCAACAGATGG - Intronic
921159739 1:212464429-212464451 AGGAAGGCAGGTGCTACACATGG - Intergenic
922045347 1:221939926-221939948 TGGCAGGCAGACTCTACAGATGG - Intergenic
922785775 1:228281640-228281662 GGGCAGCCAGCTCCAGCAGAGGG + Intronic
924738303 1:246779147-246779169 AGGCAGGGAGATCCTTGAGAAGG - Intergenic
1063559399 10:7112400-7112422 AGGCAGGCACCTTCTTCACAAGG - Intergenic
1064336650 10:14448970-14448992 AGTGAGGCAGCTCCCACAGCTGG - Intronic
1066098653 10:32097620-32097642 AGGCAGGCACTTCCTTCACAGGG + Intergenic
1067495136 10:46754835-46754857 AGGAAGGCAGCACCTGCTGAGGG - Intergenic
1067599518 10:47585561-47585583 AGGAAGGCAGCACCTGCTGAGGG + Intergenic
1068287847 10:54962660-54962682 AGGCAGGCAGCTCCAGGAGCCGG - Intronic
1068300368 10:55131282-55131304 AGGCAGGCAGCTTCCACTGTGGG + Intronic
1068817956 10:61338864-61338886 AAGCCGGCAGCTCATAAAGAAGG + Intergenic
1069329233 10:67271402-67271424 AGGCAGGCAACTTCTTCACAGGG - Intronic
1069834871 10:71302102-71302124 AGGCAGGCAGCCTCCACAGACGG - Exonic
1070166872 10:73905564-73905586 AGGCAGCCACGTCCTGCAGAGGG - Intergenic
1071216142 10:83404327-83404349 AAGCAGGCATCTCCTTCACAGGG + Intergenic
1071651048 10:87393443-87393465 AGGAAGGCAGCACCTGCTGAGGG + Intergenic
1074626327 10:115191723-115191745 AGGAAGGCACCTTCTACAAAGGG - Intronic
1075040490 10:119103955-119103977 AGGGAGGCGGGTCCTACAGCGGG + Intergenic
1075273824 10:121076123-121076145 AGGCAGGAAGCTCCAACATTTGG + Intergenic
1075414572 10:122252933-122252955 AGGCAGGCTTCTCCCACAGTGGG + Intronic
1075624141 10:123949654-123949676 AAGCAGTCAACTCCTACAGAAGG - Intergenic
1076561893 10:131372260-131372282 GGGGAAGCAGCTCCTACAGGCGG - Intergenic
1077510772 11:2961011-2961033 ACCAAGGCAGCTCCTAGAGAGGG - Intronic
1080228026 11:29983075-29983097 AAGCAGGCACCTCCTTCACAAGG + Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081778542 11:45693996-45694018 AGGCAGGCAGCTGCTTGGGAGGG - Intergenic
1082071628 11:47944082-47944104 AGCCAGGCAGCTCCAAAAGTAGG - Intergenic
1082895332 11:58184046-58184068 TGGCAGTCATCTCCTTCAGAGGG + Intergenic
1084412877 11:69014209-69014231 AGGCAGGCAGCTCCCAGCGCAGG - Intergenic
1084482519 11:69430133-69430155 AGGCAGGCAGATCCAACCCATGG - Intergenic
1085223261 11:74894533-74894555 AGGCAGGCACCTTCTTCACAAGG + Intronic
1085334111 11:75678251-75678273 TGGCATGCAGCTTCTACAGTGGG + Intergenic
1087158294 11:94925483-94925505 AGGCAGGCACCTTCTTCACAAGG + Intergenic
1087562954 11:99814918-99814940 AGGCAGGCACCTTCTTCACAAGG + Intronic
1089665138 11:120013546-120013568 GGGCAGGAAGCTCCTGCAGGGGG - Intergenic
1090461800 11:126897525-126897547 AGGAAACCAGCTCCCACAGAGGG + Intronic
1091155825 11:133371617-133371639 AAGCAGGCAGCTTCTTCACAAGG - Intronic
1091390845 12:125410-125432 GGGGAGGCAGCTCAGACAGAGGG - Intronic
1091970791 12:4785253-4785275 AGGCAGGCAGCCTCTATAGGCGG - Intronic
1092100046 12:5875549-5875571 AGCCTGGAAGCTCCCACAGATGG - Intronic
1092199345 12:6570440-6570462 AGCCCGCCAGCTCCTGCAGATGG + Exonic
1093764868 12:22951947-22951969 AAGCAGGCAGCTTCCACAGCTGG + Intergenic
1094475490 12:30837498-30837520 AGGCAAGTTACTCCTACAGAAGG - Intergenic
1095093866 12:38134074-38134096 TGGCAGGCAGCACCAAGAGAAGG - Intergenic
1096317762 12:50583472-50583494 AGACAAGCAGCACCTGCAGATGG - Intronic
1096552532 12:52382615-52382637 AGGCAGCCACTTCCCACAGATGG + Intronic
1098338156 12:69424722-69424744 AAGCAGGCACCTCCTTCACAAGG - Intergenic
1099801253 12:87459899-87459921 AGGCAGGCAACTTCTTCACAAGG + Intergenic
1100383341 12:94082962-94082984 AAGCAGGCAGCTTCTTCACATGG - Intergenic
1100985576 12:100199466-100199488 AGGCAAGGAGCGCCGACAGAAGG + Intronic
1104310883 12:127653494-127653516 AGGCAGGCACCTTCTTCACAGGG + Intergenic
1104780527 12:131417042-131417064 AGGCAGGCACCTTCTTCACAAGG - Intergenic
1104911899 12:132243770-132243792 AGGCAGGCAGGGCCTTCATAGGG - Intronic
1105436116 13:20379783-20379805 AAGCAGGCAGGTCCTACAGCAGG - Intergenic
1105657367 13:22455675-22455697 AGGTAGAGAGCTGCTACAGATGG + Intergenic
1105783184 13:23721953-23721975 AGGCAGGCAGATCCTTCAGATGG + Intergenic
1107101989 13:36603159-36603181 AGGCAGGCACCTTCTTCACAAGG + Intergenic
1107416520 13:40206292-40206314 AGGCAGGTGGCTGCTACAGAAGG + Intergenic
1107676070 13:42798520-42798542 GAGCAGGCAGGTCCTACGGAAGG + Intergenic
1108389689 13:49936154-49936176 CGGCCGGCATCTCCTTCAGAGGG + Exonic
1109496847 13:63182564-63182586 AAGCAGGCACCTTCTTCAGAAGG - Intergenic
1109525333 13:63567139-63567161 CTGCAAGCAGCTCCCACAGATGG - Intergenic
1109897924 13:68718771-68718793 ACTCAGGCAGGTCCTTCAGAAGG + Intergenic
1110458015 13:75711787-75711809 AGGCAGGCAGCTCTTCCATCAGG - Intronic
1110835374 13:80076070-80076092 AGGCAGGGAGCTTCTACAATTGG - Intergenic
1111318492 13:86592736-86592758 AAGCAGGCATCTCCTTCACAAGG + Intergenic
1112632565 13:101178681-101178703 AGGCAATCAGCTCCCACAGATGG + Intronic
1113150380 13:107257055-107257077 AGGCAGGCACCTTCTTCACAAGG + Intronic
1114189596 14:20430320-20430342 AAGCAGGCAGCTGGTAAAGAAGG + Exonic
1115738053 14:36356073-36356095 AAGCACTCAGCTCCTACAGCAGG + Intergenic
1117090265 14:52243406-52243428 AGGCAGGCACCTTCTTCACAGGG + Intergenic
1117179266 14:53175828-53175850 AGGCAAGTTACTCCTACAGAAGG + Intergenic
1117612247 14:57496404-57496426 AGGAAGGCATTTTCTACAGAAGG - Intergenic
1118285255 14:64465341-64465363 AGGCAGGCTGCTGCTGCAGGTGG + Intronic
1118327844 14:64793463-64793485 AGGCAGCCAGGTCCTTCAGCTGG + Exonic
1119374233 14:74176137-74176159 CCTCAGGCAGCTCCTACAGGAGG - Intronic
1120217895 14:81700137-81700159 AGGCAGGCACCTTCTTCACAGGG - Intergenic
1121454342 14:94028700-94028722 AGGCAGTGAGCTCCTACAGCGGG - Intronic
1121574289 14:94970583-94970605 AGGCAGGCACCTTCTTCATAGGG + Intergenic
1121716347 14:96078747-96078769 AGGCAGGCAGGTCCTCCTGAAGG - Intronic
1122114902 14:99522745-99522767 GGGCAGGGAGCTCCTAAAGCAGG + Intronic
1122309785 14:100787284-100787306 AGGCAGGACGCTCTGACAGACGG - Intergenic
1122730492 14:103793441-103793463 AGCAAGGCAGCTCCTCCACAAGG - Intronic
1123145506 14:106126079-106126101 TGGAAGGCTGCTCCAACAGAGGG + Intergenic
1123185704 14:106514787-106514809 TGGAAGGCTGCTCCAACAGAGGG + Intergenic
1125520640 15:40346161-40346183 AGGCAGGGAGACCCTCCAGATGG + Intergenic
1128506935 15:68278961-68278983 AGGCAGCCACCTCCTCCAAATGG - Intronic
1129906824 15:79193640-79193662 TGGCAGGCAGCTCCAAGTGATGG - Intergenic
1130912962 15:88283596-88283618 ACGCAGGCAGCTGCCTCAGAGGG + Intergenic
1131437594 15:92435691-92435713 AGGGAGTCAGCTACTTCAGATGG - Intronic
1131627505 15:94137525-94137547 AGGCAGGCACCTTCTTCACATGG + Intergenic
1132146565 15:99433023-99433045 TGGCAGGCAGCTCCTGCTGCCGG + Intergenic
1133021219 16:2967800-2967822 CAGCAGACAGCTCCTAGAGAGGG - Exonic
1133933810 16:10252795-10252817 AGGCGGTGAGCTCCTACAGTGGG + Intergenic
1134054683 16:11162277-11162299 AGGCAGGCCACTCCAACAGTGGG - Intronic
1136734277 16:32449582-32449604 AAGCAGGCACCTTCTTCAGAAGG - Intergenic
1138178234 16:54923064-54923086 AGGCCGGGAGCTCCTGCACAGGG - Intergenic
1140048396 16:71457944-71457966 AGGGAGGCAGCGCCTGGAGAAGG + Intronic
1140520523 16:75577035-75577057 AAGCAGCCAGCTCCTTCAGGGGG - Intronic
1140844866 16:78877256-78877278 AGGCAGGCAGGGCATACAGAGGG - Intronic
1141423836 16:83933098-83933120 GGCCATGCTGCTCCTACAGAAGG - Intronic
1141436926 16:84005074-84005096 AGGCAGGCAGACACAACAGACGG + Intergenic
1144289288 17:13809960-13809982 AGGCAGGCACCTTCTTCACAAGG - Intergenic
1147495384 17:40910710-40910732 AGGGAGCCAGCTCTTAGAGAAGG + Intergenic
1148505295 17:48122328-48122350 AGGCAGGGAGCTGCTACCAAAGG - Exonic
1149081861 17:52667413-52667435 AAGCAGGCACCTTCTTCAGATGG + Intergenic
1151269780 17:72985241-72985263 ACGCAGACAGCGCCCACAGAAGG + Intronic
1153820437 18:8827144-8827166 AGCCAGGCTGCTCCCGCAGATGG + Intronic
1156373988 18:36495918-36495940 AGACAGGCTGCTTCTAAAGAAGG + Intronic
1156471751 18:37381467-37381489 AGGCAGGAAGCTCCTTGAGGTGG + Intronic
1157472408 18:47999818-47999840 AGGAAGTCACATCCTACAGATGG - Intergenic
1158149930 18:54357266-54357288 AGTCAGGCAGCTCAGAAAGAGGG - Intronic
1158806291 18:60977699-60977721 AAGCAGGCACCTTCTTCAGACGG - Intergenic
1159994776 18:74953561-74953583 AGGCAGGGAGCTCCTCCTCAAGG - Intronic
1163229656 19:15992643-15992665 ATGGAGGAAGCTCCTAGAGATGG - Intergenic
1164393981 19:27848115-27848137 GGGTATGCAGATCCTACAGATGG - Intergenic
1164428787 19:28168743-28168765 AGGCAGGAAGCTCAGACAGCAGG - Intergenic
1166072961 19:40397454-40397476 AGGCAGGCAGCTCCACCTGGGGG + Exonic
1167653970 19:50751276-50751298 CCTCAGGCAGCTCCTTCAGAAGG + Intergenic
1168369561 19:55820916-55820938 TAGCAGGCAGATCCTAAAGATGG - Intronic
925151867 2:1620393-1620415 AGGCTGGCAGCTCCAGCTGATGG - Intergenic
926844085 2:17114670-17114692 CTGCAAGCATCTCCTACAGATGG + Intergenic
927113695 2:19882205-19882227 AAGCAGGCACCTCCTTCACAGGG - Intergenic
929023382 2:37575978-37576000 TTGCAGGCAAGTCCTACAGAGGG - Intergenic
931773529 2:65519899-65519921 AGGCAGGCACCTTCTTCACAAGG + Intergenic
935428443 2:102946242-102946264 AGGCTGTCAGCCCCAACAGAAGG - Intergenic
935841995 2:107123550-107123572 AGCAAGGCAGGTCCCACAGAAGG - Intergenic
936074900 2:109395525-109395547 AGATAGGCAGCTTCAACAGACGG - Intronic
936349074 2:111698983-111699005 GGGGAGGAAGCTCCTATAGAAGG - Intergenic
937445319 2:121952621-121952643 TGGCAGGCAGGTGCGACAGATGG - Intergenic
939568210 2:143809983-143810005 AGACAGACAGCTCCTAGAGATGG + Intergenic
940755680 2:157679243-157679265 AGGCAGGCACCTTCTTCACAAGG - Intergenic
941516577 2:166487501-166487523 GGGCAGTCATCTCCTACAGGTGG - Intronic
941519319 2:166519565-166519587 AGGGAGGCAGCTCATGCAGGAGG - Intergenic
941657516 2:168159889-168159911 AGGCAGGAAGCCCCTGCACAGGG - Intronic
943878657 2:193109018-193109040 AGGAAGGCACCTCCTTCACAAGG - Intergenic
945037256 2:205714945-205714967 TGGCAGGCACATCCCACAGAAGG + Intronic
947914020 2:233820198-233820220 AGGCTGGCACCTCCTGCAGGAGG - Intronic
948735158 2:239998929-239998951 AGATAGGCAGCTACCACAGAGGG + Intronic
1169694693 20:8374284-8374306 AGGCAGGCATCTTCTTCACAAGG - Intronic
1170605804 20:17874368-17874390 AGGGAGGCGGTTGCTACAGAGGG - Intergenic
1171278727 20:23879454-23879476 AGGCAGCCATCACCTGCAGAGGG + Exonic
1173881188 20:46413557-46413579 AGGCAGGCAGCTACTACTAAGGG + Intronic
1175791864 20:61744981-61745003 AGGCAGGCAGCTGCAACAGCTGG - Intronic
1176035112 20:63032354-63032376 CGGCAGGCAGCTCCTGAAGGCGG - Intergenic
1176086639 20:63298228-63298250 TGGCACGCAGCCCCTGCAGAAGG + Intronic
1176871764 21:14088603-14088625 CGGCAGGCGGCACCAACAGAAGG + Intergenic
1177581566 21:23030029-23030051 AGGCAGGCACCTTCTTCACAGGG + Intergenic
1178617066 21:34143751-34143773 ACACAGGCAGCTGCTACAGAGGG - Intergenic
1179576478 21:42311321-42311343 AGGCAGGCAGCGCTCACAGGAGG + Intergenic
1179576489 21:42311373-42311395 AGGCAGGCAGCGCTCACAGGAGG + Intergenic
1179649654 21:42799495-42799517 AGGCAAGTAACTTCTACAGAAGG + Intergenic
1180065148 21:45408682-45408704 ATGCAGGCAGCTCGGAGAGAGGG + Intronic
1181435925 22:22910811-22910833 AGGCAGGGAGCTCCAAGACAAGG + Intergenic
1182278779 22:29206315-29206337 AGGCAGCCAGCTCCGACACATGG - Intronic
1182361636 22:29749854-29749876 AGGCAGGCACCTTCTTCACAAGG - Intronic
1183666326 22:39248361-39248383 TAGCAGGCACCTCCTCCAGAAGG + Intergenic
1183740526 22:39666340-39666362 AGGGAGGCCACACCTACAGAAGG - Intronic
1184672146 22:46019607-46019629 AAGCAGGCACCTCCTTCACAAGG - Intergenic
1184879264 22:47294769-47294791 AGGCAGGTCGCTCCTGGAGAGGG - Intergenic
1185250422 22:49798909-49798931 ACGCTGGCAGCTCCTGCAGAGGG - Intronic
1185269351 22:49921812-49921834 AGGCAGGCAGCTCCAGCAAGGGG - Intronic
950196883 3:11015597-11015619 AGGCAGGCAGCTCCTACAGAGGG - Intronic
950251744 3:11471223-11471245 CGGCAGACAGCTCCTACCGCTGG + Intronic
951674427 3:25220651-25220673 AGGCAGGCATCTTCTTCACAGGG - Intronic
953594231 3:44293327-44293349 ATTCAGGCAGGTCCTCCAGAAGG + Intronic
953910109 3:46888487-46888509 AGGAAGGCAGCTATTTCAGAAGG + Intronic
954578936 3:51692601-51692623 AGGAAGGCTGCTCGTACAGATGG - Intronic
954710223 3:52501813-52501835 ATGCAGGTGGCTCCTGCAGAGGG - Intronic
956310343 3:67871576-67871598 GGGGAGATAGCTCCTACAGAAGG + Intergenic
959127416 3:102307288-102307310 ACTCAGTCAGCACCTACAGATGG + Intronic
960511824 3:118558425-118558447 AGGCAGGCAGGACATACTGATGG + Intergenic
960673969 3:120177205-120177227 AGGCAGGCAGGTCCTAAGGTAGG - Intronic
962065091 3:131971346-131971368 AGGCATCCAGCTCTCACAGAAGG + Intronic
967028786 3:185586660-185586682 AGGGAGGCAGCTCCTGATGAAGG + Intronic
968276042 3:197441105-197441127 AGACAGGGAGCTCAGACAGAAGG + Intergenic
968478361 4:823368-823390 AGGCAGGCAGCTCCTGCCCTGGG + Intronic
968644292 4:1731240-1731262 AGGCAGGCTGCCCCTGCTGATGG - Exonic
968813596 4:2810782-2810804 AGGCAGGCAGTTCTGACAGTTGG - Intronic
968916086 4:3497642-3497664 AGGCAGGTGGCACCTACAGGGGG + Intronic
968972024 4:3800950-3800972 GGGCAGGTAGCCCCAACAGAGGG + Intergenic
970858787 4:20678267-20678289 ATGAGGGCAGCTCCTCCAGAGGG + Intergenic
970987063 4:22171164-22171186 AGGCAGGCATCTTCTTCACAGGG + Intergenic
971072592 4:23111430-23111452 AGACAGGCAGCTTCTTCACAAGG + Intergenic
974872369 4:67659482-67659504 AAGCAGGCAGCTTCTTCACAGGG - Intronic
976590337 4:86843696-86843718 AGGCATGCAGCTCCTTGAGCAGG + Intronic
978822165 4:112979259-112979281 AGGCAGGCAGCTCCAAATGCTGG + Intronic
985011512 4:185587592-185587614 TGGCAGGCGGCCTCTACAGAAGG + Exonic
985381735 4:189402429-189402451 AAGCAGGCACCTCCTTCACAAGG - Intergenic
985639298 5:1056101-1056123 ACGCAGGTAGCTCCTGCCGAGGG + Intronic
985721063 5:1489318-1489340 AGCCAGGCTGCCCCTACAGCTGG + Intronic
986149205 5:5111526-5111548 AGGGAGGCAACTCCTGCAGAGGG + Intergenic
987654071 5:20783059-20783081 AAGCAGGCACCTCCTTCACAAGG - Intergenic
988488134 5:31684164-31684186 AGGCAGGTGGCTGCTACAGGAGG - Intronic
988741507 5:34078434-34078456 AAGCAGGCACCTCCTTCACAAGG + Intronic
989455252 5:41636817-41636839 AGGCATCCTGCTTCTACAGAAGG - Intergenic
990062510 5:51669614-51669636 AGGCTGGCAGGTACTAAAGAGGG - Intergenic
990083281 5:51943894-51943916 AAGCAGGCATCTTCTTCAGAGGG - Intergenic
990859637 5:60312524-60312546 AGGCAGGCACCTTCTTCACAAGG + Intronic
991662070 5:68960614-68960636 AGGCAAGCAGCTTCTTCACATGG + Intergenic
993064492 5:83080659-83080681 AGGCAGGAAGCTTATACAGCAGG - Intronic
993079801 5:83281902-83281924 AGGCAGTCAGCTTCTATAGAAGG - Intronic
993787389 5:92160044-92160066 AAGCAGGCACCTTCTACACAAGG + Intergenic
995243722 5:109914033-109914055 AGGCAGGGAGCTCTTTCAGCAGG + Intergenic
996285472 5:121786091-121786113 AGGCAGGGAACTTCAACAGAAGG - Intergenic
996446211 5:123554555-123554577 AGGCAGGCGGATCCCACAGTAGG - Intronic
997840565 5:137235812-137235834 AGGCAGGCAGCTCACATAGGTGG + Intronic
998568037 5:143233373-143233395 ATGGAGGCAGCCCCCACAGAGGG + Intergenic
999358115 5:150956557-150956579 AGGAAGCCAGCTACCACAGAAGG - Intergenic
999401794 5:151269974-151269996 AGGCTGGAAGATCCAACAGAGGG - Exonic
1001290118 5:170451037-170451059 AGGCAAGCAGCCCCAACTGACGG + Intronic
1001799777 5:174532826-174532848 AGGGCTGCGGCTCCTACAGAAGG + Intergenic
1002080262 5:176733401-176733423 AGGCAGGCTCCTCCTTGAGAGGG - Intergenic
1002588095 5:180265530-180265552 AGGCAGGCACCTTCTTCACAAGG - Intronic
1002928429 6:1618381-1618403 CTGCAGGCCGCTCCTACTGAGGG + Intergenic
1003277294 6:4663648-4663670 ATGCAGTCAGTGCCTACAGAAGG + Intergenic
1003473932 6:6463794-6463816 AGGCAGGCACCTTCTTCACAAGG - Intergenic
1005598694 6:27405210-27405232 CCTCAGGCAGATCCTACAGAAGG + Intergenic
1009560834 6:65240443-65240465 AGACAGGGAGCTACTAGAGAGGG - Intronic
1011009179 6:82684608-82684630 AGGCAGGCACCTGATACACAAGG + Intergenic
1012628405 6:101432160-101432182 AGGCAGGCAGCCCCAGGAGAAGG - Intronic
1012698328 6:102418650-102418672 AGGGATGCATCACCTACAGACGG + Intergenic
1013637816 6:112045924-112045946 GGACAGGCAGGTCCTTCAGAAGG + Intergenic
1014699862 6:124671531-124671553 AGGCAGACAGATCCTAAGGAAGG - Intronic
1017820875 6:158048304-158048326 AGGAAGGCAGCCCTTGCAGAGGG + Intronic
1018049945 6:160000309-160000331 AAGCAGGCAGCTTCTTCACATGG + Intronic
1018708478 6:166479771-166479793 AGGCAAGCAGCTCCTACAGCGGG - Intronic
1019123863 6:169826033-169826055 ATGAAGGCAGCTCCTCGAGAGGG - Intergenic
1019436971 7:1027560-1027582 AGGCCGGCAGCTCCTTCAAGAGG - Intronic
1019541461 7:1553554-1553576 ACGCATGCACCTCCTCCAGAAGG - Intronic
1021058192 7:16076964-16076986 AAGCAGACACCTCCTTCAGAAGG + Intergenic
1021717572 7:23473812-23473834 AGGCAGGCAGCTTCCAAGGAGGG - Intergenic
1022415355 7:30172414-30172436 AGGCAGGCACCTTCTTCACAGGG - Intergenic
1022849708 7:34247580-34247602 AGGAAGGCAGCAGCTACTGAGGG - Intergenic
1023141711 7:37108822-37108844 AGGCTGGCAGTGCCCACAGAAGG + Intronic
1023967577 7:44970882-44970904 AGGCAGGGAACTCATAGAGAAGG - Exonic
1025254950 7:57378278-57378300 AGGCAGTCAGCTCCCCCAAAAGG - Intergenic
1027199407 7:76053730-76053752 AGGCAGGCAGCTACCAGTGAGGG - Intronic
1027723139 7:81769997-81770019 ACCCAGGCATCTCCTCCAGAGGG - Exonic
1027884126 7:83881304-83881326 AAGCAGGCAGCTTCTTCATAGGG + Intergenic
1028445406 7:90916204-90916226 AGGCTGGCAGCTGCTAGTGATGG + Intronic
1029595711 7:101536559-101536581 AGGCAGGCAGATCCCAGACAGGG + Intronic
1031746181 7:125501033-125501055 AAGCAGGCAGCTTCTTCACAAGG + Intergenic
1032683698 7:134209997-134210019 AAGCAGGCAGCTCCTCCAGGAGG + Intronic
1033390478 7:140923833-140923855 AGGCAGGCAGGTCCGACAACTGG + Intronic
1034373826 7:150626557-150626579 TGGAAGGCTGTTCCTACAGACGG - Exonic
1034953050 7:155313859-155313881 CTTCAGGCAGCTCCTACAGCTGG - Intergenic
1035289411 7:157828022-157828044 AGGCAGGCAGGTCCCACGGTGGG - Intronic
1035549184 8:507073-507095 AGGCAGGCACCTTCTTCACAAGG + Intronic
1035916346 8:3628623-3628645 AGGGAGGCAGCTCCCGCAGAGGG + Intronic
1037483755 8:19328534-19328556 AGGCAGTCAGGTCCTAAATAGGG - Intronic
1037542748 8:19888263-19888285 AAGCAGGCACCTCCTTCACAAGG + Intergenic
1037886319 8:22598275-22598297 AAGAAGGCACCTCCTCCAGAGGG - Intronic
1037942364 8:22961399-22961421 AGGCAGGCAGCATTTATAGAAGG - Intronic
1039109527 8:34026478-34026500 AGGCAGGCACCTTCTTCACAAGG + Intergenic
1040280969 8:46043038-46043060 TGGCAGGCAGCACCAACAGAAGG + Intergenic
1042897285 8:73685122-73685144 AGGCAGGCATCTTCTTCATAAGG - Intronic
1043545989 8:81316317-81316339 AGGCTGACAGCACCTTCAGAAGG - Intergenic
1047916335 8:129587764-129587786 ATTCTGGCAGCTCCTACTGAGGG - Intergenic
1048270486 8:133024204-133024226 GTGCAGGCAGCTCCCTCAGATGG + Intronic
1048438981 8:134445851-134445873 AGGCAGGCAGCTACCACTGCAGG + Intergenic
1049659380 8:143812892-143812914 CAGCAGGCAGCTCCTCCAGCCGG + Exonic
1050781395 9:9341255-9341277 AGTCAGGCTGAGCCTACAGATGG - Intronic
1051054827 9:12972696-12972718 AGGCAGGCCTTTCCTACAGGGGG - Intergenic
1052891001 9:33700321-33700343 AGGCAGGCACCTTCTTCACAGGG + Intergenic
1054901733 9:70376160-70376182 AGGCAGGCAGAGAATACAGAAGG + Intergenic
1054949781 9:70836789-70836811 TGGAAGGCATCTCATACAGATGG - Intronic
1056942317 9:90966105-90966127 AGACAGGCAGCTCCAAGGGAAGG + Intergenic
1059352804 9:113677450-113677472 AGACAGGCACCTGGTACAGAAGG + Intergenic
1062023691 9:134330760-134330782 AGGCAGGCAGCGAGGACAGAAGG - Intronic
1062412136 9:136430941-136430963 GGGCAGGCATCTCCCACAGCCGG - Intronic
1186296333 X:8153109-8153131 CGGCAGGCAGGTCCTTCAGAAGG - Intergenic
1187227636 X:17388933-17388955 AGGCATGCAACTCATACAGAAGG + Intronic
1187933243 X:24312660-24312682 GTGCAGGCAACTGCTACAGAAGG + Intergenic
1187938982 X:24363394-24363416 GTGCAGGCAACTGCTACAGAAGG - Intergenic
1189394068 X:40604388-40604410 AGGCAGGCACCTTCTTCACAAGG + Intronic
1193342246 X:80362539-80362561 TGGCAGCCAGCTACTACATAGGG - Intronic
1193926272 X:87489144-87489166 AGTCTGGCAGATGCTACAGAGGG - Intergenic
1194841226 X:98745353-98745375 AGGCAGGCACCTTCTTCACAAGG - Intergenic
1196595393 X:117540038-117540060 AGACAAGCAGCTCCTACTCAAGG + Intergenic
1197341803 X:125284350-125284372 AAGCAGGCACCTTCTACACAGGG + Intergenic
1198581039 X:138064552-138064574 AGGCTTCCAGCTCCTACTGAAGG + Intergenic
1198772111 X:140141335-140141357 AGGCATCCAGCTCCCAAAGAAGG - Intergenic
1199170800 X:144732693-144732715 AAGCAGGCACCTCCTTCACAAGG + Intergenic
1199945494 X:152662846-152662868 AGGGAGGGGGCTCCTACAGGAGG + Intergenic
1200121561 X:153793584-153793606 TGGCTGGCAGCTGCTTCAGATGG + Exonic
1200926362 Y:8658466-8658488 AGGCAGACAGCTCTTATAGCTGG + Intergenic
1200939471 Y:8766896-8766918 AGGTTGACAGCTCCTGCAGATGG - Intergenic
1200940023 Y:8771517-8771539 AGGCTGACAGCTCTTACAGCTGG - Intergenic
1202151146 Y:21844872-21844894 AGGCTGGCAGCTCTGACAGCTGG - Intergenic