ID: 950197493

View in Genome Browser
Species Human (GRCh38)
Location 3:11019128-11019150
Sequence CTACTCAGAAGCAGAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1801
Summary {0: 1, 1: 3, 2: 39, 3: 288, 4: 1470}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950197493 Original CRISPR CTACTCAGAAGCAGAATTGC TGG (reversed) Intronic
900075431 1:812465-812487 ATACCCAGAAGTGGAATTGCTGG - Intergenic
900841865 1:5056319-5056341 ATACCCAGTAGTAGAATTGCGGG - Intergenic
900887689 1:5427138-5427160 CGTCCCAGAAGCAGAATTGTTGG + Intergenic
901107054 1:6764632-6764654 ATACCCAGAAGTGGAATTGCTGG + Intergenic
901132895 1:6973636-6973658 ATACTCAGAAGTGGGATTGCTGG + Intronic
902106747 1:14043444-14043466 GTACCCAGAAGTGGAATTGCTGG + Intergenic
902177730 1:14663798-14663820 ATAACTAGAAGCAGAATTGCTGG - Intronic
903176123 1:21582184-21582206 ATACCCAGTAGCAGGATTGCTGG + Intergenic
903290018 1:22304866-22304888 GTTCTCAGAAGTGGAATTGCTGG - Intergenic
903304815 1:22405824-22405846 ATACCCAGAAGTGGAATTGCTGG + Intergenic
903537930 1:24079720-24079742 AATCTCAGAAGCAGAATTGCTGG + Intronic
903595116 1:24488108-24488130 TAACTCAGAAGAAGAATTGCTGG - Intergenic
903944531 1:26953395-26953417 GTACCCAGAAGTGGAATTGCTGG - Intronic
904274717 1:29373149-29373171 ATACCCAGTAGCAGAATTTCTGG + Intergenic
904315624 1:29658723-29658745 GTACCCAGAAGTGGAATTGCAGG + Intergenic
904706877 1:32397764-32397786 ATACTCAGAAGTGGAAGTGCTGG - Intergenic
905018928 1:34795181-34795203 CTTCTTAGAAGCAGAGCTGCTGG - Exonic
905147518 1:35899400-35899422 ATACCCAGAAGCAGAATTGCTGG + Intronic
905332491 1:37215533-37215555 ATACTCAGAAGTTGGATTGCTGG - Intergenic
905888770 1:41506991-41507013 CAACACAGAAGCAGAATTGGTGG + Exonic
905903676 1:41600197-41600219 ATACCCAGAAGGGGAATTGCTGG - Intronic
905963618 1:42068261-42068283 ATACTCAGAAGTGGAATCGCTGG - Intergenic
906184066 1:43847278-43847300 ATACCCAGAAGTGGAATTGCTGG - Intronic
906386249 1:45371234-45371256 ATACCCAGAAGTAGGATTGCTGG - Intronic
906648975 1:47497048-47497070 ATACTCAGCAGTGGAATTGCTGG + Intergenic
906724150 1:48031394-48031416 ATACTAAAAAGCGGAATTGCTGG - Intergenic
906773293 1:48504893-48504915 TTACCCAGAAGTGGAATTGCTGG + Intergenic
906812485 1:48842648-48842670 ATAGTCAGAAGTAGGATTGCCGG - Intronic
906870344 1:49472567-49472589 ATACTGAGAAGTGGAATTGCTGG - Intronic
907086622 1:51681655-51681677 ATACTCAGTAGTGGAATTGCTGG - Intronic
907147508 1:52248776-52248798 ATACCCAGAAGTAGAATTGCTGG + Intronic
907204041 1:52753234-52753256 ATACTTAGGAGTAGAATTGCTGG + Intronic
907279315 1:53335328-53335350 ATACTCAGAAGTGGAATTGCTGG + Intergenic
907898106 1:58711908-58711930 ATACCCAGAAGTGGAATTGCTGG - Intergenic
908208014 1:61870737-61870759 ATACTCAGCAGTGGAATTGCTGG + Intronic
908217495 1:61969240-61969262 ATACCCAGAAGTAGAATTACTGG + Intronic
908504741 1:64785490-64785512 CTCCTGAGTAGCAGAATTACAGG + Intronic
908693429 1:66808766-66808788 ATACCCATAAGTAGAATTGCTGG - Intergenic
908699612 1:66884331-66884353 ATACCCAGAAGTAGGATTGCTGG + Intronic
908771440 1:67600532-67600554 ATACCCAGAAGTAGAATTGCTGG + Intergenic
908838285 1:68250770-68250792 CTATGCAAAAGAAGAATTGCTGG + Intergenic
908891304 1:68851284-68851306 ATACCAAGTAGCAGAATTGCTGG + Intergenic
909098510 1:71320380-71320402 GTACCCAGAAGTGGAATTGCTGG + Intergenic
909162168 1:72166406-72166428 ATACTCAGCAGTAGGATTGCTGG - Intronic
909411643 1:75359681-75359703 ATACTCAGAAATAGGATTGCTGG + Intronic
909506391 1:76395421-76395443 CTACCCAGTAGTAGGATTGCTGG - Intronic
909649793 1:77961226-77961248 CTACTCAGAAGGAGCATTTTAGG - Intronic
910017474 1:82545294-82545316 ATACCCAGAAGTGGAATTGCTGG - Intergenic
910110680 1:83679620-83679642 ATACTCAGAAGTGAAATTGCTGG + Intergenic
910574629 1:88746737-88746759 ATACCCAGAAGAGGAATTGCTGG - Intronic
910603906 1:89062143-89062165 ATACCCAGAAGGGGAATTGCTGG - Intronic
910634941 1:89397231-89397253 ATGCTCAGCAGTAGAATTGCTGG + Intergenic
910824362 1:91389951-91389973 AAACCCAGAAGTAGAATTGCTGG - Intronic
910959161 1:92742874-92742896 ATACCCAGAAGTGGAATTGCTGG - Intronic
911228083 1:95329687-95329709 ATACCCAGAAGTGGAATTGCTGG + Intergenic
911684003 1:100752847-100752869 ATACCCAGAAGTAGAATTGCTGG + Intergenic
911771646 1:101750685-101750707 ATACCCTGAAGTAGAATTGCTGG + Intergenic
911879159 1:103212028-103212050 ACACTCAGAAGTGGAATTGCTGG - Intergenic
911989834 1:104680687-104680709 ATACACAGAAGTGGAATTGCTGG - Intergenic
912032107 1:105261609-105261631 ATACTCAGTAACAGGATTGCTGG + Intergenic
912191880 1:107350471-107350493 ATACACAGAAGTAGGATTGCTGG - Intronic
912198301 1:107425690-107425712 ATACCCAGTAGTAGAATTGCTGG + Intronic
912264408 1:108141495-108141517 ATACTCAGAAGTGGAATTTCTGG - Intronic
912275463 1:108253602-108253624 ATACTCAGAAGAGGGATTGCTGG + Intergenic
912292761 1:108440746-108440768 ATACTCAGAAGAGGGATTGCTGG - Intronic
912586266 1:110769244-110769266 ATACACAGAAGTGGAATTGCTGG + Intergenic
912635943 1:111293093-111293115 ATACCTAGAAGCGGAATTGCTGG + Intronic
912662645 1:111546781-111546803 ATACCCAGAAATAGAATTGCTGG + Intronic
912946084 1:114085888-114085910 ATACCCAGAAATAGAATTGCTGG - Intergenic
913174101 1:116258053-116258075 ATACCCAGAAGTGGAATTGCTGG - Intergenic
913399446 1:118413103-118413125 CTACTCAGGAGTGGAATTGCTGG + Intergenic
913541407 1:119824580-119824602 ATACCCAGAAGTAGAATTGCTGG - Intergenic
914235609 1:145808202-145808224 CTACCCAGTAGCGGGATTGCTGG + Intronic
914383360 1:147141440-147141462 ATACTCAGAAGAGGGATTGCTGG + Intergenic
914690668 1:150023269-150023291 GTACTCAGAAGTTGAATTGCTGG - Intergenic
914724418 1:150315755-150315777 ATACCCAGAAGTAGAATTGCTGG + Intergenic
914941385 1:152026027-152026049 CAACCCAGAAATAGAATTGCTGG - Intergenic
914983423 1:152436378-152436400 ATACTCAGTAGTAAAATTGCTGG + Intergenic
915380720 1:155437584-155437606 ATTCTCAGAAGTGGAATTGCTGG - Intronic
915658131 1:157378533-157378555 ATACCCAGAAGCAGGATTGCTGG - Intergenic
915787546 1:158631922-158631944 ATACCCAGAAATAGAATTGCTGG - Intronic
915858328 1:159414601-159414623 ATACCCAACAGCAGAATTGCTGG + Intergenic
916196743 1:162231001-162231023 ATACCCAGAAGTAGAATTGCTGG + Intronic
916321405 1:163508987-163509009 CTTCTCAGAAGGATAATTCCAGG - Intergenic
916643491 1:166757876-166757898 ATACTCAGGAGTAGAATTGCTGG + Intergenic
916790249 1:168119067-168119089 ATACACAGAAATAGAATTGCTGG - Intronic
916854221 1:168733763-168733785 ATACTCAGGAGTGGAATTGCTGG + Intergenic
917253169 1:173084685-173084707 ATACCCAGTAACAGAATTGCTGG - Intergenic
917314712 1:173712601-173712623 GCACGCAGAAGCAAAATTGCTGG - Intergenic
917496635 1:175546403-175546425 CAAGCAAGAAGCAGAATTGCCGG + Intronic
917563370 1:176183583-176183605 ATACTCAGAAGTGGAATTGCTGG - Intronic
918092377 1:181308553-181308575 ATACCCAGAAGTGGAATTGCTGG - Intergenic
918174462 1:182030332-182030354 TTACTGGGAAGCAGAATTGGTGG + Intergenic
918224559 1:182469634-182469656 ATACTCAGAAGTTAAATTGCTGG - Intronic
918438163 1:184537973-184537995 ATACCCAGAAGTGGAATTGCTGG + Intronic
918825546 1:189319189-189319211 ATACCCAGAAGTAGAATTTCTGG - Intergenic
918928543 1:190821213-190821235 ATACCCAGAAGTGGAATTGCTGG - Intergenic
919105432 1:193144354-193144376 CTACTATGCAGCAGAATTACAGG - Intronic
919436540 1:197569403-197569425 ATTCCTAGAAGCAGAATTGCTGG - Intronic
919439484 1:197612836-197612858 ATACACAGAATAAGAATTGCTGG + Intronic
920032205 1:203044248-203044270 CTACTAAGCAGCACATTTGCAGG - Intronic
921176404 1:212598972-212598994 ATACTCAGCAGTAGGATTGCTGG + Intronic
921298861 1:213730282-213730304 ATACTCAGTAACAGGATTGCTGG + Intergenic
921347465 1:214201582-214201604 ATACTCAGAAGTAGAATTGCTGG - Intergenic
921434897 1:215107360-215107382 ATACCCAGAAACAGGATTGCAGG + Intronic
921493038 1:215802737-215802759 ATACCCAGAAGTGGAATTGCTGG - Intronic
921674316 1:217961526-217961548 ATACTAAGAAGCATGATTGCTGG - Intergenic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
921798665 1:219376961-219376983 ATACCCAGAAGTGGAATTGCTGG - Intergenic
921854111 1:219962968-219962990 ATACCCAGAAGTGGAATTGCTGG - Intergenic
921921756 1:220677497-220677519 ATACCCAGAAGTAGAATTGCTGG - Intergenic
922205883 1:223445827-223445849 ATACCCAGAAGTGGAATTGCTGG - Intergenic
922210418 1:223482136-223482158 ATACTCAGAAGTGGAAGTGCTGG - Intergenic
922271274 1:224037339-224037361 ATACCCAGAAGTGGAATTGCTGG - Intergenic
922305219 1:224338554-224338576 CTAATCAGAAGCTGAAGTGAAGG - Intergenic
922407462 1:225330284-225330306 ATACCCAGCAGTAGAATTGCTGG - Intronic
922409095 1:225352483-225352505 ATAATCAGAAGTGGAATTGCTGG + Intronic
922547625 1:226470405-226470427 ATATTCAGAAGTGGAATTGCTGG + Intergenic
922893977 1:229086496-229086518 ATACCCAGAAGTAGGATTGCTGG - Intergenic
923104174 1:230841759-230841781 ATACCCAGATGTAGAATTGCTGG - Intronic
923294039 1:232575653-232575675 ATGCCCAGAAGTAGAATTGCTGG - Intergenic
923362819 1:233228819-233228841 ACACTCAGAAATAGAATTGCTGG + Intronic
923381552 1:233425113-233425135 ATACTCAGAAATTGAATTGCTGG + Intergenic
923392327 1:233525379-233525401 ATACTCGGAAGTGGAATTGCTGG - Intergenic
923395512 1:233558439-233558461 ATACCCAGAAGTAGGATTGCTGG + Intergenic
923614117 1:235522400-235522422 ATACCTAGAAGCAGGATTGCTGG + Intergenic
924072453 1:240295773-240295795 ATTCCCAGAAGTAGAATTGCTGG + Intronic
924664370 1:246055483-246055505 ATACCCAGAAGTGGAATTGCTGG - Intronic
924812220 1:247413157-247413179 ACACTCAGAAGAAGGATTGCTGG + Intergenic
924832433 1:247611747-247611769 ATACTCAGCAACAGGATTGCTGG - Intergenic
1063153026 10:3354082-3354104 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1063168936 10:3488503-3488525 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1063269560 10:4492157-4492179 ATACTCAGGAGCATGATTGCTGG - Intergenic
1063351040 10:5355289-5355311 CTGCTCCTAAGCAGAATTTCAGG + Intergenic
1063477182 10:6339562-6339584 ATACCCAGAAGTAGAACTGCTGG - Intergenic
1063782026 10:9336050-9336072 GAACCCAGAAGTAGAATTGCTGG - Intergenic
1063862025 10:10321043-10321065 GTACTCAGAAGTGGATTTGCTGG - Intergenic
1063910790 10:10828138-10828160 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1064008762 10:11718524-11718546 ATATCCAGAAGCGGAATTGCTGG + Intergenic
1064215498 10:13396958-13396980 ATACCTAGAAGCGGAATTGCTGG + Intergenic
1064238926 10:13606850-13606872 ATACCTAGAAGTAGAATTGCTGG + Intronic
1064320955 10:14304143-14304165 ATACCCAGAAGTGGAATTGCTGG + Intronic
1064343739 10:14510911-14510933 ATACTTAGGAGCGGAATTGCTGG + Intergenic
1064419167 10:15175603-15175625 ATACTCAGCAGTGGAATTGCTGG - Intergenic
1064448763 10:15422371-15422393 ATACTTAGAAGTAGAATGGCTGG - Intergenic
1064503821 10:16007910-16007932 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1064543790 10:16431347-16431369 CCACTAAGAAGTGGAATTGCTGG + Intergenic
1064565492 10:16635030-16635052 CTTCCCAGAAGCAGAATGGCTGG - Intronic
1064680211 10:17803925-17803947 ATACCTAGAAGTAGAATTGCTGG + Intergenic
1065167771 10:22998593-22998615 ATACTTAGAAACAGAATTGCTGG - Intronic
1065245888 10:23757231-23757253 ATACTCAGTAGGAAAATTGCTGG + Intronic
1065345778 10:24746889-24746911 AAACCCAGAAGCAGGATTGCTGG - Intergenic
1065405729 10:25361446-25361468 ATACTCAGAAGTAGAATTGCAGG + Intronic
1065646753 10:27842860-27842882 ATGCCCAGGAGCAGAATTGCTGG - Intronic
1065764825 10:29018658-29018680 ATGCCCAGAAGCAGAATTGCTGG - Intergenic
1066079764 10:31918865-31918887 ATACCCAGAAGTGGAATTGCTGG - Intronic
1066108250 10:32174519-32174541 ATACTTAGGAGCGGAATTGCTGG - Intergenic
1066115915 10:32239744-32239766 ATACCCAGAAGTAGGATTGCTGG + Intergenic
1066116992 10:32249201-32249223 ATACCCAGAAGAGGAATTGCTGG - Intergenic
1066163771 10:32763462-32763484 GTACCCAGAAGGGGAATTGCTGG - Intronic
1066333244 10:34447965-34447987 ATATGCAGAAGCAGAATTGCTGG - Intronic
1066431917 10:35360121-35360143 GTACTCAGAAGTGGAATTGCTGG + Intronic
1066559639 10:36655810-36655832 ATACTCAGAAGTGGAATTACTGG - Intergenic
1066668066 10:37806217-37806239 ATACTCAGAAGTGGAATTGCTGG + Intronic
1066981031 10:42416478-42416500 ATACCCAGAAGTAGGATTGCTGG + Intergenic
1067052912 10:43034521-43034543 ATACCCAGAAGCAGAATTGCTGG - Intergenic
1067194548 10:44104880-44104902 ATATTCAGAAGCAGTATTGCTGG - Intergenic
1067413537 10:46085831-46085853 ATACCTAGAAGCAGAATTGTGGG + Intergenic
1068097761 10:52513105-52513127 CTACTCAGTAGTGGGATTGCTGG + Intergenic
1068155801 10:53196901-53196923 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1068295528 10:55067598-55067620 ATACCCAGTAGCGGAATTGCTGG + Intronic
1068465110 10:57379780-57379802 GTACTCAGCAGCAGGGTTGCTGG - Intergenic
1068536818 10:58249040-58249062 ATATTCAGAAGCAGGAATGCTGG + Intronic
1068544315 10:58328754-58328776 CTACCTAGAAGTAGAACTGCTGG + Intergenic
1068558946 10:58491136-58491158 CTATTCAGAAGTGGGATTGCTGG - Intergenic
1069011348 10:63376902-63376924 ATACCCAGGAGTAGAATTGCTGG - Intronic
1069021960 10:63499228-63499250 ATACTCAGAAGCAGGATTGCTGG + Intergenic
1069127215 10:64651058-64651080 TTACTCAGAAGCAATATGGCTGG + Intergenic
1069150010 10:64948373-64948395 ATACTCAGTAGTGGAATTGCTGG + Intergenic
1069170487 10:65222391-65222413 TTACTTAGGAACAGAATTGCTGG + Intergenic
1069200045 10:65602435-65602457 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1069224268 10:65922255-65922277 CTTCTTAAAAGCAGAGTTGCTGG - Intronic
1069349857 10:67512367-67512389 ATACTCAGAAGTGGGATTGCTGG - Intronic
1069363771 10:67674471-67674493 CAATTCAGAAGTAGAATTTCTGG + Intronic
1069369806 10:67735787-67735809 ATACCTAGAAGTAGAATTGCTGG - Intergenic
1069719876 10:70542783-70542805 ATACTCAGGAGTGGAATTGCTGG + Intronic
1069866363 10:71505862-71505884 ATACTTAGGAGCACAATTGCTGG - Intronic
1070215390 10:74373782-74373804 ATACCTAGGAGCAGAATTGCTGG - Intronic
1070254169 10:74799757-74799779 ATACACAGAAGTAGAATTGCTGG - Intergenic
1070356994 10:75649665-75649687 ATACCCAGAAGAGGAATTGCTGG + Intronic
1070405444 10:76090509-76090531 ACACTCAGAAGCAGAATTGCCGG - Intronic
1070553229 10:77507846-77507868 ATTCCTAGAAGCAGAATTGCTGG - Intronic
1070568891 10:77625859-77625881 CTAACCAGAAGTGGAATTGCTGG + Intronic
1070943487 10:80368349-80368371 ATGCCCAGAAGTAGAATTGCTGG + Intergenic
1071122629 10:82297294-82297316 ATACTCAGTAGTAGGATTGCTGG + Intronic
1071151208 10:82636756-82636778 ATACCCAGAAGAGGAATTGCTGG + Intronic
1071253826 10:83848777-83848799 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1071442292 10:85711106-85711128 ATACCCAGAAGTAAAATTGCTGG - Intronic
1071500579 10:86201048-86201070 ATTCTGAGGAGCAGAATTGCTGG - Intronic
1071738130 10:88325156-88325178 ATACTCAGAAGTGGAATTGCTGG + Intronic
1071952986 10:90726208-90726230 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1072266884 10:93738859-93738881 CTACCCAGTAGTGGAATTGCTGG - Intergenic
1072584290 10:96767442-96767464 ATATCCAGAAGTAGAATTGCTGG - Intergenic
1072628582 10:97130242-97130264 GTACCCAGAAGTGGAATTGCTGG - Intronic
1072712946 10:97729634-97729656 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1073012147 10:100369325-100369347 ATACCTAGAAGTAGAATTGCTGG - Intergenic
1073222268 10:101885261-101885283 ATACTCAGAAGTGGAATTGCTGG - Intronic
1073228926 10:101950429-101950451 ATACCTAGGAGCAGAATTGCTGG - Intronic
1073372178 10:103000355-103000377 ATACTCAGAATTGGAATTGCTGG - Intronic
1073372459 10:103002883-103002905 ATACCTAGTAGCAGAATTGCAGG - Intronic
1073821830 10:107273050-107273072 ATACTCAGTAGGGGAATTGCTGG + Intergenic
1073826744 10:107332614-107332636 ATACTCAGTTGTAGAATTGCTGG + Intergenic
1073937914 10:108656863-108656885 TTACCTAGGAGCAGAATTGCTGG - Intergenic
1073975805 10:109099512-109099534 ATACTCAGTAGTGGAATTGCTGG + Intergenic
1074157479 10:110811526-110811548 CCACTCTGCCGCAGAATTGCAGG - Intronic
1074202794 10:111254216-111254238 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1074349340 10:112720222-112720244 CTACTTAGGAGTAGAATTGCTGG + Intronic
1074725864 10:116308878-116308900 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1075301427 10:121328078-121328100 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1075308380 10:121389530-121389552 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1075510962 10:123072859-123072881 TTTCTCAGAAGCAGAAGTGGAGG + Intergenic
1075525351 10:123180262-123180284 ATACCCAGAGGCAGAATTGCTGG - Intergenic
1075859650 10:125663407-125663429 ATACTCAGTAGTAGCATTGCTGG + Intronic
1075863011 10:125693813-125693835 ATTCTCAGGAGTAGAATTGCTGG - Intergenic
1076035133 10:127193947-127193969 CTATTAAGAAACAGAATTACTGG - Intronic
1076211598 10:128650662-128650684 ACACCCAGTAGCAGAATTGCTGG - Intergenic
1076353512 10:129834858-129834880 CTATTCAGAAGCAGAGGGGCTGG + Intergenic
1076436495 10:130448563-130448585 ATACCCAGAAGGAGAATTGCTGG + Intergenic
1076743610 10:132500838-132500860 ATACCCAGACGCAGACTTGCTGG - Intergenic
1076851154 10:133093742-133093764 CAAGTCAGAAGCAGAGTTCCTGG - Intronic
1078583106 11:12555165-12555187 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1078783842 11:14467518-14467540 ATATCTAGAAGCAGAATTGCTGG - Intronic
1078888694 11:15533383-15533405 ATACGCAGAAGTAGGATTGCTGG - Intergenic
1079474082 11:20809873-20809895 GTACTCAGTAGCGGGATTGCCGG + Intronic
1079625508 11:22612147-22612169 GTACTCAGCAGTTGAATTGCTGG + Intergenic
1080071868 11:28098966-28098988 ATACTCAGAAGTGGGATTGCAGG - Intronic
1080272057 11:30460856-30460878 ATACTTAGAAGTGGAATTGCTGG - Intronic
1080467235 11:32509101-32509123 CTAATCAGAATCAGTAGTGCAGG + Intergenic
1080563515 11:33486325-33486347 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1080598604 11:33800385-33800407 ATATTTAGAAGTAGAATTGCTGG - Intergenic
1080618335 11:33965336-33965358 ATACTTAGAAGTGGAATTGCTGG - Intergenic
1081001464 11:37678115-37678137 ATACCCAGAAGCGGAATAGCTGG - Intergenic
1081030087 11:38069047-38069069 ATACCCAGAAGTAAAATTGCTGG + Intergenic
1081108029 11:39096571-39096593 ATACTCAGAGGTGGAATTGCTGG + Intergenic
1081195713 11:40157892-40157914 CTACCCAGTAGTGGAATTGCTGG - Intronic
1081717641 11:45261951-45261973 ATACCCAGAAGTGGAATTGCTGG - Intronic
1082206199 11:49437227-49437249 ATACTCAGTAATAGAATTGCTGG + Intergenic
1082649257 11:55768175-55768197 ATACTGAGAAGCGGTATTGCTGG - Intergenic
1082822717 11:57555141-57555163 CTACCCAGAAGTAGAACTGCTGG - Intronic
1083286715 11:61664321-61664343 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1083590858 11:63893560-63893582 ATACTGAGGAGCGGAATTGCTGG + Intronic
1084294513 11:68202936-68202958 ATACCCAGAAGTAGAATTGCCGG + Intronic
1084368704 11:68721952-68721974 ATACCCAGAAGTGGAATTGCTGG - Intronic
1084434198 11:69129063-69129085 ATACCCACTAGCAGAATTGCTGG - Intergenic
1084496619 11:69508672-69508694 ATACTTAGAAGCGGAATTGCTGG + Intergenic
1084852337 11:71951951-71951973 ATACCTAGAAGCAGAATTGCTGG - Intronic
1085520425 11:77135581-77135603 ATATCCAGAAGTAGAATTGCTGG + Intronic
1085746454 11:79118916-79118938 CCACTCAGAAGTACAATTGCTGG + Intronic
1085761148 11:79242801-79242823 ATTCCCAGAAGCAGAATTACTGG + Intronic
1086297162 11:85382960-85382982 ATACTGAGGAGCAGAATTGCTGG - Intronic
1086415403 11:86584446-86584468 ATACTCAGAAGTGGCATTGCTGG - Intronic
1086435576 11:86777008-86777030 CTTCCCAGAAGTAGAATTGCTGG + Intergenic
1086649069 11:89264547-89264569 ATACTCAGTAATAGAATTGCTGG - Intronic
1086778523 11:90872182-90872204 CTACTTAGGAGTAGAGTTGCTGG - Intergenic
1086845067 11:91738668-91738690 ATACTCAGTAGTGGAATTGCTGG - Intergenic
1086850799 11:91805336-91805358 ATAACCAGCAGCAGAATTGCTGG + Intergenic
1086980803 11:93196335-93196357 ATATTCTGAAGGAGAATTGCTGG + Intronic
1087260902 11:96011199-96011221 ATACTCAGTAATAGAATTGCTGG - Intronic
1087442051 11:98198116-98198138 TTACTCAGAAGAAGAAATGATGG + Intergenic
1087485327 11:98753476-98753498 ATACCCAGTAACAGAATTGCTGG - Intergenic
1087578358 11:100019699-100019721 ATACTCAGAAGTAGAATTGTTGG + Intronic
1087696406 11:101381689-101381711 ATACTCGGTAGCAGAATTTCTGG - Intergenic
1087829624 11:102805099-102805121 ATACTCAGTAGCGGAATTGCTGG - Intergenic
1087905172 11:103687502-103687524 ATACTCAGTAGTAGGATTGCTGG - Intergenic
1087977811 11:104571612-104571634 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1088248588 11:107842770-107842792 ATATCTAGAAGCAGAATTGCTGG - Intronic
1088415992 11:109589590-109589612 GTCTTCAGAAGCAGAATTGGTGG + Intergenic
1088444478 11:109910005-109910027 ATACTCAGCAGTAGGATTGCTGG + Intergenic
1088451843 11:109989664-109989686 GTACTCAGAAGTGGAATTGCTGG - Intergenic
1088757396 11:112897302-112897324 ATACCCAGAAGCAGAAATGCTGG - Intergenic
1088875115 11:113929025-113929047 GTACTCAGAAGTGGAATTGCTGG + Intronic
1088951596 11:114576818-114576840 ATACCAAGAAGCAGGATTGCTGG - Intronic
1089332288 11:117698246-117698268 CTACCCAGAACTGGAATTGCTGG + Intronic
1089580596 11:119479725-119479747 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1089801554 11:121034112-121034134 ATACCCAGAAGGGGAATTGCTGG + Intronic
1090125911 11:124083932-124083954 ATACCCAGAAGTAGAATTGCAGG - Intergenic
1090300757 11:125636460-125636482 ATCCCCAGAAGCAAAATTGCAGG + Intronic
1090612034 11:128480014-128480036 CTATTCACAAGCAGAGTGGCTGG + Intronic
1090816338 11:130299791-130299813 CTACCCAGAAATGGAATTGCTGG - Intronic
1090823557 11:130366849-130366871 GTTCTCAAAAACAGAATTGCTGG - Intergenic
1090885764 11:130874993-130875015 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1090924027 11:131234058-131234080 GTGGTCAGAAGCAGAATGGCAGG - Intergenic
1091168814 11:133502746-133502768 CTCCTGAGAAGCAGAATAGTGGG - Intronic
1091190550 11:133691913-133691935 CTACCTAGAAGGGGAATTGCTGG - Intergenic
1091574845 12:1723806-1723828 ATACCCAGAAGTAGAATTGCTGG - Intronic
1091724898 12:2839179-2839201 CTACTCAGATGCTGAAGTGGGGG + Intronic
1091849694 12:3685364-3685386 ATACCCAGAAGTGGAATTGCTGG - Intronic
1092102375 12:5895763-5895785 CTACCCAGAAGTGGGATTGCTGG - Intronic
1092365881 12:7876574-7876596 ATACCCAGAAGTGGAATTGCTGG - Intronic
1092397343 12:8139405-8139427 ATACCCAGAAGTAGGATTGCTGG + Intronic
1092605495 12:10113789-10113811 ATACCCAGCAGCAGGATTGCTGG - Intergenic
1092826890 12:12408948-12408970 ATACTCAGAAGTGGAATTGCTGG + Intronic
1092909295 12:13132296-13132318 ATACTCAGAAGTGGAATGGCTGG - Intronic
1092912407 12:13158516-13158538 ATACAGAGAAGGAGAATTGCTGG + Intergenic
1093214176 12:16343835-16343857 GTATTTAGAAGCAGAATTGTTGG + Intergenic
1093314914 12:17637473-17637495 ATACCCAGAAGAAGAATTGCTGG + Intergenic
1093370416 12:18358107-18358129 ATACCCAGAAGTAGGATTGCTGG + Intronic
1093395983 12:18682990-18683012 CAACTCAGCAGCAGAAGGGCAGG + Intergenic
1093458547 12:19387696-19387718 ATTCCCAGAAGTAGAATTGCTGG - Intergenic
1093593398 12:20933373-20933395 ATACTCAGCAGTAGGATTGCTGG + Intergenic
1093607705 12:21112926-21112948 ATACTCAGCAGTGGAATTGCTGG + Intronic
1094032341 12:26026875-26026897 GTAATTAGGAGCAGAATTGCTGG - Intronic
1094215650 12:27939359-27939381 ATACTCAGAAGTGGGATTGCTGG - Intergenic
1094784875 12:33836318-33836340 ATACTTAGGAGTAGAATTGCTGG - Intergenic
1095124958 12:38466018-38466040 ATACTCAGTAGCAAGATTGCTGG - Intergenic
1095353131 12:41238943-41238965 CTACTCAGTAATAGGATTGCTGG - Intronic
1095389149 12:41685243-41685265 ATACCCAGTAGCAGGATTGCTGG - Intergenic
1095422090 12:42034901-42034923 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1095627210 12:44330026-44330048 ATACTCAAAAGTAGAATTCCTGG + Intronic
1095682102 12:44989778-44989800 ATACCTAGAAGCAGAATTGCTGG - Intergenic
1095812045 12:46382442-46382464 CATCTAAGAACCAGAATTGCAGG - Intergenic
1095879727 12:47120310-47120332 ATACCTAGAAGTAGAATTGCTGG - Intronic
1095968503 12:47885078-47885100 GTACTCAGAACATGAATTGCTGG - Intronic
1095988867 12:48019949-48019971 TTTCCTAGAAGCAGAATTGCTGG + Exonic
1096160415 12:49371973-49371995 TTACACAGAAGTAGAATTGCTGG + Intronic
1096218643 12:49813159-49813181 ATACTTAGGAGTAGAATTGCTGG + Intronic
1096666029 12:53165824-53165846 ATACTCAGAAGTGGAATTGCTGG - Intronic
1096923724 12:55118422-55118444 ATACACAGAAGCACAAATGCTGG - Intergenic
1097328726 12:58309750-58309772 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1097411682 12:59262100-59262122 ATAATCAGAAGTAAAATTGCTGG - Intergenic
1097644825 12:62223917-62223939 ATACTCAGAAATAGAATTGCTGG - Intronic
1097763685 12:63498643-63498665 ATACTCAGTAGTTGAATTGCTGG + Intergenic
1098012341 12:66066856-66066878 CTTCACAGAAGCAGAAATTCAGG + Intergenic
1098022153 12:66167738-66167760 ATACCCAGAAGTGGAATTGCTGG - Intronic
1098385351 12:69912814-69912836 TTACTCAGAAGTGGAACTGCTGG + Intronic
1098457252 12:70688668-70688690 ATACTCAGAAGTGGAATTGCTGG - Intronic
1098660777 12:73090872-73090894 ATACACAGAAGTAGAATTGCTGG - Intergenic
1098826398 12:75303003-75303025 ATACTTAGAAGTAGAATTGTTGG - Intronic
1099026741 12:77473859-77473881 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1099294281 12:80810603-80810625 CTCCCCAGAAGCAGAATTGCTGG + Intronic
1099391363 12:82083564-82083586 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1099462838 12:82945143-82945165 CTACCCCAAAGCAGAATTGGGGG + Intronic
1099609727 12:84852348-84852370 ATACTCAGCAGTAGGATTGCTGG + Intergenic
1099616403 12:84941256-84941278 ATACCCAGCAGTAGAATTGCTGG - Intergenic
1099875360 12:88398362-88398384 ATACTCAGTAGTAGAATTGCTGG - Intergenic
1100022510 12:90087327-90087349 ATACCCAGAAGCGGAATTGCTGG + Intergenic
1100045030 12:90369332-90369354 ACACTCAGTAGTAGAATTGCTGG - Intergenic
1100111648 12:91251288-91251310 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1100297001 12:93272288-93272310 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1100400936 12:94228914-94228936 ATGCCCAGAAGCAGAATTACTGG + Intronic
1100432659 12:94544478-94544500 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1100735716 12:97527608-97527630 CTACAAAGATGCAGAACTGCTGG - Intergenic
1100888135 12:99095199-99095221 CGACCAAGAAACAGAATTGCTGG - Intronic
1100996810 12:100309788-100309810 CTACCCAGAAATAGAATTGCTGG + Intronic
1101057147 12:100929623-100929645 ATACCCCTAAGCAGAATTGCTGG + Intronic
1101306574 12:103534357-103534379 GTAGTCAGCAGCACAATTGCAGG - Intergenic
1101595654 12:106162567-106162589 ACACTCAGAAGTGGAATTGCTGG + Intergenic
1101716232 12:107315440-107315462 ATACTCAGAAGTGGCATTGCTGG + Intergenic
1101716386 12:107316969-107316991 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1101936657 12:109063558-109063580 ACACTCAGAAGTAGAATTGCTGG + Intronic
1102326304 12:111987803-111987825 ATACTCAGGAGTAGAATTACTGG - Intronic
1102435930 12:112923237-112923259 ATACTCAGAAGTGGGATTGCTGG + Intronic
1102655944 12:114482261-114482283 GTATTCAGAAGCAGATTTGAGGG + Intergenic
1103150217 12:118631552-118631574 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1103172612 12:118834384-118834406 ATACCCAGTAGCAAAATTGCTGG - Intergenic
1103181433 12:118915460-118915482 CAACTCAGAAGCAAACTTACTGG + Intergenic
1103422989 12:120804725-120804747 ATACCTAGTAGCAGAATTGCTGG - Intronic
1103686682 12:122737709-122737731 ATATCCAGAAGTAGAATTGCTGG - Intergenic
1103729468 12:123017430-123017452 ATACCCAGAAGTGGAATTGCTGG - Intronic
1103934922 12:124470334-124470356 ATACCTAGGAGCAGAATTGCTGG - Intronic
1104239824 12:126977363-126977385 ATACTCAGAAGTAGGATTGCTGG - Intergenic
1104738666 12:131156382-131156404 ATACTCAGAAGTGGGATTGCTGG - Intergenic
1105385411 13:19924821-19924843 ATACTCAGAAATGGAATTGCTGG + Intergenic
1105449858 13:20489773-20489795 ATACCCAGAAGTTGAATTGCTGG - Intronic
1105462014 13:20600742-20600764 ATACCTAAAAGCAGAATTGCTGG - Intronic
1105667097 13:22572236-22572258 GTACTGAGGAGTAGAATTGCTGG - Intergenic
1105838972 13:24236871-24236893 ATACCCAGAAACGGAATTGCTGG - Intronic
1105972456 13:25442256-25442278 ATACTCAGAAGTGAAATTGCTGG + Intronic
1106010423 13:25815666-25815688 ATACCCAGAAGTAGAATTGCTGG - Intronic
1106148057 13:27069584-27069606 GTACCTAGAAGTAGAATTGCTGG - Intronic
1106317808 13:28610438-28610460 ACACCTAGAAGCAGAATTGCTGG + Intergenic
1106338240 13:28804159-28804181 ATACCCAGAAGAAAAATTGCTGG + Intergenic
1106668664 13:31880976-31880998 ATACCCCGAAGTAGAATTGCTGG - Intergenic
1106689711 13:32101479-32101501 ATACCCAGAAGCTGAATTGCTGG + Intronic
1106733847 13:32569424-32569446 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1106799227 13:33239387-33239409 ATACTAAGAAGTAGAATTGCTGG + Intronic
1106812506 13:33373918-33373940 ATATTCAGAAGTGGAATTGCTGG - Intergenic
1106910373 13:34456773-34456795 ATACTCAGAAGCAGAATTGCTGG - Intergenic
1106967322 13:35086669-35086691 ATACTCAGTAGCAGGATTGCTGG + Intronic
1107042654 13:35966267-35966289 ATACCCAGAAGTGGAATTGCTGG - Intronic
1107146702 13:37068261-37068283 ATACCTAGAAGTAGAATTGCTGG - Intergenic
1107271774 13:38627681-38627703 ATACTGAGAAGTAGAATTACTGG - Intergenic
1107282348 13:38751155-38751177 ATACTCAGAAGTGGGATTGCTGG + Intronic
1107507627 13:41050517-41050539 ATATCAAGAAGCAGAATTGCTGG + Intronic
1107846140 13:44515111-44515133 ATTCCCAGAAGTAGAATTGCTGG - Intronic
1108010450 13:46002397-46002419 ATACCCAGAAGTAGAATTGCTGG - Intronic
1108068085 13:46599358-46599380 ATACTCAGAAGTAGAATTGCTGG + Intronic
1108109929 13:47058734-47058756 ATACTCAGAAGTAAAATTGCTGG + Intergenic
1108300648 13:49071387-49071409 ATACTCAGCAGTAGGATTGCTGG + Intronic
1108366115 13:49715772-49715794 ATTCTTAGAAGCAGGATTGCTGG - Intronic
1108383169 13:49873611-49873633 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1108509096 13:51138716-51138738 ATACCCAGAAGTAGCATTGCTGG - Intergenic
1108522268 13:51257193-51257215 ATACCCAGAAGTGGAATTGCTGG + Intronic
1108578476 13:51809180-51809202 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1108638230 13:52357379-52357401 CTACTCAGAAGTAGAATTGCTGG - Intergenic
1108639379 13:52368528-52368550 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1108642453 13:52395474-52395496 CACCTCAGAAGCAGCATTTCTGG - Intronic
1108785463 13:53895776-53895798 GTACCCAGAAGTAGGATTGCTGG - Intergenic
1108930703 13:55814661-55814683 ATACACAGGAGCAGAATTGCTGG - Intergenic
1109069074 13:57739655-57739677 CGACTCAGAAGAAGATTGGCTGG + Intergenic
1109084806 13:57956353-57956375 ATATTCAGAAGTAGAATTGCTGG + Intergenic
1109777118 13:67055688-67055710 CTACTCAGGAGCTGAAGTGGCGG + Intronic
1109986181 13:69988474-69988496 ATACTCAGTAGTGGAATTGCTGG + Intronic
1110305395 13:73981248-73981270 ATACCCAGAAGTAGAATTGCTGG - Intronic
1110489282 13:76084867-76084889 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1110885251 13:80624820-80624842 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1110894449 13:80731774-80731796 ATACTCAGCAATAGAATTGCTGG + Intergenic
1111190235 13:84797390-84797412 ATACTCAAAAGCAAGATTGCTGG + Intergenic
1111813951 13:93126915-93126937 ATACTCAGAAGTGGCATTGCTGG - Intergenic
1112023111 13:95389217-95389239 ATATTCAGAGGTAGAATTGCTGG + Intergenic
1112059298 13:95721423-95721445 ATACACAGGAGTAGAATTGCTGG + Intronic
1112088669 13:96057975-96057997 CTACCCAGAAGTAGAATTACTGG + Intergenic
1112173374 13:96995840-96995862 ATTCCCAGAAGCAGAATTGCTGG - Intergenic
1112370565 13:98789495-98789517 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1112479544 13:99761678-99761700 ATACTGAGTAGTAGAATTGCTGG + Intronic
1112500270 13:99937764-99937786 CAACTCAGGAGCAGGATTTCTGG + Intergenic
1112879224 13:104085368-104085390 TTACCCAGAAGCAAGATTGCTGG + Intergenic
1113124988 13:106967999-106968021 ATACTCAGAAGTAGAATTACTGG + Intergenic
1113554318 13:111219497-111219519 ATACCCAGAAGTGGAATTGCTGG + Intronic
1113583251 13:111444136-111444158 ACACCCAGAAGCAGAATTGTTGG + Intergenic
1113613713 13:111665917-111665939 CTACTCAGACTCAGAATTAAAGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114273096 14:21116370-21116392 ATTCTTAGAAGCAGAATGGCTGG - Intergenic
1114420325 14:22577100-22577122 GTACCCAGAAGTGGAATTGCTGG - Intronic
1114832349 14:26160333-26160355 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1114961309 14:27893689-27893711 ATACTCAGTAGTGGAATTGCTGG + Intergenic
1115012266 14:28563261-28563283 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1115082216 14:29468694-29468716 ATATTCAGAAGCAGAATTGCTGG + Intergenic
1115103263 14:29728788-29728810 ATACCCAGAAGCAGCATTGTTGG + Intronic
1115779366 14:36752377-36752399 ATACCCAGAAGTAGAATTGCTGG - Intronic
1116274706 14:42817578-42817600 ACACACAGAAGCAGGATTGCTGG - Intergenic
1116473417 14:45311622-45311644 ATACTCAGTAGTGGAATTGCTGG + Intergenic
1116660647 14:47706438-47706460 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1116803890 14:49472536-49472558 CTACTTAGAAGTAGGATTGCTGG - Intergenic
1116902080 14:50371251-50371273 ATACTCAGAAGTGGGATTGCTGG + Intronic
1116920506 14:50567474-50567496 ATACCCAGAAGTGGAATTGCTGG + Intronic
1117112043 14:52467727-52467749 ATACTGAGAAGTGGAATTGCTGG - Intronic
1117130407 14:52681119-52681141 ATACTTAGAAGTGGAATTGCTGG - Intronic
1117381773 14:55171600-55171622 ATACCCAGAAGTAGAATTGCTGG - Intronic
1117622844 14:57605586-57605608 ATACTCAGTAGTAGAATTGCTGG - Intronic
1118191163 14:63581773-63581795 ATACTCAAAAGTGGAATTGCTGG - Intergenic
1118213762 14:63788840-63788862 ATACGCAGCAGCGGAATTGCTGG - Intergenic
1118335212 14:64847549-64847571 CAACTCAGAAGAAGAAATCCAGG + Intronic
1118634821 14:67738168-67738190 ATATTAAGAAGCTGAATTGCTGG - Intronic
1118728152 14:68645508-68645530 GTACCCAGAAGTGGAATTGCTGG + Intronic
1119047171 14:71329264-71329286 ATACCCAGAAGCGGGATTGCTGG + Intronic
1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG + Intronic
1119295934 14:73533191-73533213 GTACCCAGAAGTAGAATTGCTGG - Intronic
1119299573 14:73560878-73560900 GTACCCAGAAGTAGAATTGCTGG - Intergenic
1119350009 14:73956373-73956395 ATACTTAGAAGTGGAATTGCTGG + Intronic
1119596333 14:75937867-75937889 ATACACAGAAGTGGAATTGCTGG + Intronic
1119655286 14:76413105-76413127 CTACCCAGACCCAGCATTGCAGG + Intronic
1120052662 14:79885431-79885453 GTAAGCAGAAGAAGAATTGCTGG - Intergenic
1120489006 14:85152663-85152685 ATACCCAGATGTAGAATTGCTGG - Intergenic
1120611038 14:86641723-86641745 ATACTCAGAAGTGAAATTGCTGG - Intergenic
1120870626 14:89333794-89333816 ATACCCAGAAGTGGAATTGCTGG - Intronic
1121008766 14:90507622-90507644 CAACTCAGAAGCAGCAGAGCTGG - Intergenic
1121034903 14:90693836-90693858 ATACTTAGAAGTGGAATTGCTGG - Intronic
1121285422 14:92731807-92731829 ATACTTAGGAGCGGAATTGCTGG + Intronic
1121588908 14:95084363-95084385 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1121800659 14:96771369-96771391 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1121878309 14:97475346-97475368 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1122048012 14:99037040-99037062 ATACCCAGAAGCGGAAGTGCTGG - Intergenic
1122149990 14:99720247-99720269 ATACTCAGAAGTGGGATTGCTGG + Intronic
1122166632 14:99830003-99830025 CTACCTAGGAGTAGAATTGCCGG + Intronic
1122295405 14:100702965-100702987 ATACTCAGCAGCGGAATTGCTGG + Intergenic
1122431218 14:101647222-101647244 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1122440040 14:101725384-101725406 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1122897287 14:104765816-104765838 GTACCCAGAAGTGGAATTGCTGG - Intronic
1123801659 15:23827510-23827532 ATACCCAGAAGTAGGATTGCTGG + Intergenic
1123906652 15:24928210-24928232 ATACTCAGTAGTGGAATTGCTGG - Intronic
1123950770 15:25271831-25271853 GTACTTAGGAGCAGAATTGTTGG - Intergenic
1124122656 15:26903466-26903488 ATACTCAGTAACAGAATTGCTGG + Intronic
1124411464 15:29440951-29440973 ATACCCAGAAGTGGAATTGCTGG - Intronic
1124418560 15:29495055-29495077 ATACCCAGAAGTAGAATTGTTGG + Intronic
1124448282 15:29759973-29759995 GTACCCAGAAGTGGAATTGCTGG + Intronic
1124913162 15:33943090-33943112 ATATCCAGAAGCAGGATTGCTGG - Intronic
1125170986 15:36766416-36766438 ATACCCAGAAGCAGGATTGCTGG + Intronic
1125293884 15:38180831-38180853 ATACTCAGAAATAAAATTGCTGG - Intergenic
1125370309 15:38968649-38968671 ATACCCAACAGCAGAATTGCTGG + Intergenic
1125700382 15:41677459-41677481 ATACCTAGAAGTAGAATTGCTGG + Intronic
1125871774 15:43108608-43108630 ATACCCAGAAGTGGAATTGCTGG - Intronic
1126222285 15:46228205-46228227 ATACTCAGAAGCAGGGTTGCTGG - Intergenic
1126337055 15:47597347-47597369 CTACCCAGTAGTGGAATTGCCGG - Intronic
1126458237 15:48888096-48888118 ATACCCAGAAGTAGAATGGCTGG - Intronic
1126504253 15:49385229-49385251 CTACTCTGCATCAGAAATGCAGG - Intronic
1126606652 15:50484630-50484652 ATACCCTGAAGTAGAATTGCTGG - Intronic
1126834771 15:52649783-52649805 CTATTCAGTAGCAGAACTTCAGG - Intronic
1126892378 15:53220304-53220326 ATACCCAGCAGCAGATTTGCTGG + Intergenic
1126937745 15:53729997-53730019 ATACTGAGAAGTGGAATTGCTGG - Intronic
1127162662 15:56206065-56206087 ATACTCAGAAGTGGAACTGCTGG - Intronic
1127174935 15:56344147-56344169 ATACCTAGGAGCAGAATTGCTGG - Intronic
1127730129 15:61792831-61792853 ATATCCAGAAGCGGAATTGCTGG + Intergenic
1128266774 15:66273716-66273738 ATACCCAGAAGTAAAATTGCTGG - Intergenic
1128280856 15:66393101-66393123 GTACTCAGAAGTGGAATTGCTGG + Intronic
1128299403 15:66556136-66556158 ATACCCAGAAGTAGAATTGCTGG - Intronic
1128355655 15:66924721-66924743 ATACTAAGAAGTGGAATTGCTGG + Intergenic
1128424851 15:67531400-67531422 ATACCTAGGAGCAGAATTGCTGG - Intergenic
1128425554 15:67539042-67539064 ATACTCAAAAGTGGAATTGCTGG - Intergenic
1129012430 15:72433629-72433651 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1129129734 15:73482848-73482870 GTACTCATAAGTAGAATTGCTGG + Intronic
1129495795 15:75978554-75978576 ATACCCAGCAGCAGGATTGCTGG + Intronic
1129759209 15:78119435-78119457 ATACCCAGAAGTAGAATTGCTGG + Intronic
1129910829 15:79224902-79224924 ATACTCGGAAGTAGTATTGCTGG + Intergenic
1129928610 15:79388610-79388632 ATACTCAGTAGTAGGATTGCTGG + Intronic
1130084121 15:80763004-80763026 ATACCCAGAAATAGAATTGCTGG + Intergenic
1130147929 15:81288991-81289013 ATACCCAGAAGTGGAATTGCTGG + Intronic
1130182874 15:81649160-81649182 ATACCTAGAAGCAGGATTGCTGG + Intergenic
1130203820 15:81857272-81857294 ATACTCAGAAGTAGAATTGCTGG - Intergenic
1130289147 15:82581459-82581481 ATACCTAGAAGGAGAATTGCTGG + Intronic
1130338842 15:82981491-82981513 ATACCCAGAAGTGGAATTGCTGG - Intronic
1130533401 15:84765377-84765399 ATACCCAGAAGTGGAATTGCTGG + Intronic
1130636552 15:85626752-85626774 ATACCCAGAAGTGGAATTGCTGG + Intronic
1130692663 15:86097829-86097851 ATACTCAGTGGTAGAATTGCTGG + Intergenic
1130920466 15:88339815-88339837 ATACACAGAAGTGGAATTGCTGG + Intergenic
1130943642 15:88533412-88533434 ATACCCAGAAGTAGAATTGTTGG - Intronic
1130976570 15:88780854-88780876 TTACCCAGAAGTAGAGTTGCCGG - Intergenic
1131135370 15:89930602-89930624 ATACCCAAAAGTAGAATTGCTGG - Intergenic
1131159664 15:90096959-90096981 ATATACAGAAGCAGAATTGCTGG - Intronic
1131315455 15:91332713-91332735 CTATTCAAAAGTAAAATTGCTGG - Intergenic
1131744139 15:95427513-95427535 ACACCCAGAAGTAGAATTGCTGG - Intergenic
1131878780 15:96839824-96839846 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1131964180 15:97821324-97821346 ATACCAAGAAGCATAATTGCTGG + Intergenic
1132037259 15:98495032-98495054 ATACTCAGAAGTGGGATTGCTGG + Intronic
1132041957 15:98532646-98532668 ATATCCAGAAGCAGGATTGCTGG + Intergenic
1132060221 15:98686426-98686448 ATACCCAGAAGTGGAATTGCTGG + Intronic
1132324020 15:100951421-100951443 ATACTCAGGAGTGGAATTGCTGG - Intronic
1133070831 16:3245806-3245828 CTACCCAGAAGTGGAACTGCGGG - Intronic
1133383320 16:5348928-5348950 ATACACAGAAGTAGGATTGCTGG + Intergenic
1133454065 16:5927577-5927599 ATACCCAGAAGCACTATTGCTGG - Intergenic
1133602533 16:7353439-7353461 ATACCTAGGAGCAGAATTGCTGG - Intronic
1134088422 16:11374821-11374843 ATACCCAGAAGTAGAATTGCTGG + Intronic
1134160035 16:11880330-11880352 ATACTCAGAAAGAGTATTGCTGG + Intronic
1134432937 16:14228254-14228276 ATACCCAGAAGTGGAATTGCTGG - Intronic
1135073680 16:19374770-19374792 ATACCCAGAAGGAGGATTGCTGG + Intergenic
1135108938 16:19675483-19675505 GTACCCAGAAGTAGCATTGCTGG + Intronic
1135273825 16:21093262-21093284 GTACTATGAAGCACAATTGCTGG - Intronic
1135556268 16:23439194-23439216 CTACTCAGAAGTGGAATTGCTGG - Intronic
1135556280 16:23439342-23439364 CTACTCAGAAGTGGAATTGCTGG - Intronic
1135596862 16:23751264-23751286 ATACCTAGGAGCAGAATTGCTGG + Intergenic
1135774880 16:25248778-25248800 ATACCCAGTAGCAGGATTGCTGG - Intronic
1136509327 16:30726376-30726398 ATACTGAGGAGAAGAATTGCTGG + Intronic
1136931537 16:34422187-34422209 TTACCCAGAAGTGGAATTGCTGG - Intergenic
1136973035 16:34989632-34989654 TTACCCAGAAGTGGAATTGCTGG + Intergenic
1137485443 16:48886860-48886882 ATACCCAGAAGTAGGATTGCTGG + Intergenic
1137517052 16:49155117-49155139 ATACTCAGAAGCAAGATTGCTGG - Intergenic
1137534794 16:49311951-49311973 CTACCCAGAAGTGGGATTGCTGG + Intergenic
1137681690 16:50352555-50352577 ATACCCAGTAGCTGAATTGCTGG + Intronic
1137904993 16:52311995-52312017 ATTCCCAGAAGTAGAATTGCTGG - Intergenic
1138127464 16:54450769-54450791 ATTCTTAGAAGCAGAATTGCTGG + Intergenic
1138198812 16:55073984-55074006 CTCCTCAGTAGCAGGACTGCAGG - Intergenic
1138341794 16:56294626-56294648 CTACCCAGGAATAGAATTGCTGG + Intronic
1138469238 16:57219170-57219192 ATACCTAGCAGCAGAATTGCCGG + Intronic
1138609925 16:58114851-58114873 CTACTCAGAAGATGAGCTGCCGG - Exonic
1138749896 16:59407318-59407340 ATACCCAGGAGTAGAATTGCTGG + Intergenic
1138757456 16:59505661-59505683 ATACTCAGAAGTGGGATTGCTGG - Intergenic
1139183446 16:64774186-64774208 ATACTCAGAAGTAGGATTGTGGG + Intergenic
1139196553 16:64925555-64925577 ATACCCAGTAACAGAATTGCTGG + Intergenic
1139553459 16:67690184-67690206 ATACCCAGAAGTGGAATTGCCGG + Intronic
1139721275 16:68857540-68857562 ATACCCAGGAGCACAATTGCTGG + Intronic
1140323790 16:73980266-73980288 ATACCTAGAAGCAGAATTACTGG - Intergenic
1140442139 16:74996328-74996350 CTAGGTAGGAGCAGAATTGCTGG + Intronic
1140617972 16:76690302-76690324 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1140998713 16:80287499-80287521 GTACCTAGAAGCAGAATTGCTGG - Intergenic
1141002990 16:80325452-80325474 CAACTCAGAGGCAGAATTGCTGG + Intergenic
1141196216 16:81863558-81863580 ATATCCAGAAGCTGAATTGCTGG + Intronic
1141196219 16:81863605-81863627 ATATCCAGAAGCTGAATTGCTGG + Intronic
1141458902 16:84164776-84164798 ATACTCAGGAGCACAATTGCTGG + Intronic
1141557883 16:84848012-84848034 CTCCTGAGAAGTAGGATTGCTGG + Intronic
1142317526 16:89357500-89357522 CTACCCAGAAGGGGAACTGCTGG - Intronic
1142524223 17:527454-527476 CTACTCAAGAGTAGAACTGCTGG + Intronic
1142646737 17:1318770-1318792 ATACCCAGAAGCGGAACTGCTGG + Intergenic
1142947300 17:3441635-3441657 ATACTCAGAAGTAAAATTGCTGG - Intronic
1143566268 17:7722887-7722909 CTACCTAGAAGTGGAATTGCTGG + Intronic
1143914635 17:10280512-10280534 ATACCCAGAAGCAGAATTGCTGG + Intergenic
1143919946 17:10323177-10323199 ACACCCAGGAGCAGAATTGCTGG + Intronic
1143930351 17:10416464-10416486 ATACTCAGAAGTAGAATTGTGGG + Intronic
1143973297 17:10811668-10811690 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1143998776 17:11033056-11033078 AAAGTCAGAAGCAGGATTGCTGG - Intergenic
1144122685 17:12171170-12171192 ATTCACAGAAGTAGAATTGCTGG + Intergenic
1144202431 17:12953506-12953528 ATACCCAGAAGTGGAATTGCTGG - Intronic
1144279005 17:13705777-13705799 GTATTCAGGAGCAGAATTGCTGG + Intergenic
1144463372 17:15476841-15476863 ATACCCAGAAGTGGAATTGCTGG - Intronic
1144576155 17:16430973-16430995 ATACCCAGAAGTGGAATTGCTGG + Intronic
1144887545 17:18473718-18473740 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1144940528 17:18936616-18936638 ATACCCAGGAGCAGAATTGCTGG - Intergenic
1145065902 17:19761151-19761173 ATAATCAGAAGCAGAATTGCTGG + Intergenic
1145094447 17:20013213-20013235 ATACCCAGAAGTAGAATTGTTGG + Intronic
1145144672 17:20470577-20470599 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1145158931 17:20561334-20561356 CTACTTAGGAGTGGAATTGCTGG - Intergenic
1145176124 17:20701979-20702001 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1145791195 17:27628207-27628229 ATACCCAGAAGTGGAATTGCTGG + Intronic
1145897499 17:28468595-28468617 ATACCAAGAAGCAGTATTGCTGG - Intronic
1146143106 17:30386964-30386986 ATACCCAGGAGTAGAATTGCTGG + Intronic
1146375649 17:32292363-32292385 ATATTCAGAAGTGGAATTGCTGG - Intronic
1146660454 17:34662169-34662191 CTACCTAGAAGCAGCAGTGCTGG - Intergenic
1146817727 17:35956721-35956743 ATACTTAGAAGCAGGATTACTGG + Intergenic
1147120702 17:38333646-38333668 CTACTCAGAAGCAGGTATACAGG - Intronic
1147249001 17:39141647-39141669 ATACCCAGAAGCGGAATTGCTGG + Intronic
1147471944 17:40670567-40670589 ATACCCAGAAGGGGAATTGCTGG - Intergenic
1147985458 17:44304754-44304776 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1148039285 17:44693567-44693589 ATTCCCAGAAGCAGAAATGCTGG - Intergenic
1148294252 17:46486495-46486517 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1148316435 17:46704209-46704231 ATACCCAGAAGTGGAATTGCTGG + Intronic
1148316805 17:46708203-46708225 ATACTCAGAAGTGGAATTGCTGG + Intronic
1148829642 17:50423118-50423140 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1149085122 17:52707667-52707689 ATACTCAGCAGTAGGATTGCTGG - Intergenic
1149130350 17:53293113-53293135 CTACCTAGAAGTACAATTGCTGG - Intergenic
1149131830 17:53311689-53311711 ATACTCAGAAACAGGAATGCTGG - Intergenic
1149530798 17:57393627-57393649 ATACTAAGGAGCGGAATTGCTGG + Intronic
1149807312 17:59630912-59630934 ATACTTAGAAGTGGAATTGCTGG + Intronic
1149876385 17:60237936-60237958 ATATTTAGAAGTAGAATTGCTGG + Intronic
1149897716 17:60442004-60442026 ATACCCAGAAGTTGAATTGCTGG + Intergenic
1149903077 17:60499543-60499565 ATACTCAGAAGTTGAATTGCTGG - Intronic
1150017207 17:61570181-61570203 GTACTTAGGAGCGGAATTGCTGG + Intergenic
1150045568 17:61909990-61910012 CTACCCAGCAGTAGGATTGCTGG + Intronic
1150058381 17:62041012-62041034 CTACCCAGAAGTGGAATTGCTGG - Intronic
1150534816 17:66025781-66025803 ATACCCAGAAGTGGAATTGCTGG - Intronic
1150565406 17:66334737-66334759 ATACCCAGAAGTGGAATTGCTGG - Intronic
1150567574 17:66355606-66355628 ATTCTCAAAAGCAGATTTGCTGG - Intronic
1150961656 17:69919821-69919843 ACACTCAGTAGCAGGATTGCTGG - Intergenic
1151115266 17:71728431-71728453 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1151242126 17:72766330-72766352 ATACTTAGAAGAAGAATTGCTGG + Intronic
1152464886 17:80460536-80460558 ATACTCTGAAGTGGAATTGCTGG - Intergenic
1152485459 17:80588587-80588609 ATACCCAGAGGCAGAATTGCTGG + Intronic
1152777886 17:82213578-82213600 CCACTCCCACGCAGAATTGCGGG - Intergenic
1153092543 18:1364540-1364562 ATACCCAGCAGCAGGATTGCTGG + Intergenic
1153141646 18:1979328-1979350 GTACCCAGAAGTAAAATTGCTGG + Intergenic
1153192630 18:2559095-2559117 ATACCCAGAAGTGGAATTGCTGG - Intronic
1153258363 18:3196433-3196455 CTACTCAGAAACTGAGTTGTTGG - Intronic
1153497503 18:5714798-5714820 ATACTAAGGAGCAGAAGTGCTGG + Intergenic
1153604932 18:6823560-6823582 ATACCCAGAAGTGGAATTGCTGG + Intronic
1153697159 18:7655533-7655555 AAACTTAGGAGCAGAATTGCTGG - Intronic
1153721793 18:7911276-7911298 ATACTTAGGAGCAGAATTGCTGG + Intronic
1153745387 18:8173676-8173698 CTACCCAGAAGCAGACTCTCTGG - Intronic
1154012243 18:10584901-10584923 ATACTCAGCAGTAGGATTGCTGG + Intergenic
1155260238 18:24034983-24035005 ATACCCAGAAGTGGAATTGCTGG + Intronic
1155296576 18:24390241-24390263 ATACCCAGAAGTAGAATTGCTGG - Intronic
1155314312 18:24556364-24556386 ATAACCAGAAGCAGAATTGCTGG - Intergenic
1155345513 18:24853180-24853202 CTCATCAGGAGCAGAAGTGCTGG + Intergenic
1155361071 18:25003434-25003456 GTACCCAGAAGTAGGATTGCTGG + Intergenic
1155641292 18:28018799-28018821 ATACTCAGAAGTGGATTTGCTGG - Intronic
1155754100 18:29468438-29468460 CTACCCAGAAGAGGGATTGCTGG + Intergenic
1155765921 18:29632481-29632503 ATACCCAGAAGGAGAATTGCTGG + Intergenic
1155863658 18:30936487-30936509 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1156105459 18:33654256-33654278 CTTCTCAAAAACAGAATTGAAGG + Intronic
1156148438 18:34214643-34214665 GTACACAGAAGCAGGTTTGCTGG - Intronic
1156236741 18:35212779-35212801 ATACTCATAAGTGGAATTGCTGG + Intergenic
1156256792 18:35405940-35405962 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1156329273 18:36104245-36104267 ATACTCAGAAGAGGAACTGCTGG - Intergenic
1156800511 18:41107903-41107925 ATACCCAAAAGTAGAATTGCTGG + Intergenic
1156954984 18:42951627-42951649 ATACTCAGAAGTGGAATTACTGG - Intronic
1157225151 18:45856030-45856052 ATACCTAGGAGCAGAATTGCTGG - Intronic
1157483570 18:48071621-48071643 GTACTCAAAAGTAGAATTGCTGG - Intronic
1157508005 18:48244925-48244947 ATACTCAGTAGCGGGATTGCTGG - Intronic
1157587271 18:48811900-48811922 ATACCCAGAAGTGGAATTGCTGG + Intronic
1157588793 18:48822671-48822693 ATACTCAGAAGCGGGATTGCTGG + Intronic
1157794645 18:50562093-50562115 CTGCTCAAAAGCAGAATTCTAGG - Intronic
1158034661 18:53012167-53012189 ATACCTAGAAGTAGAATTGCTGG - Intronic
1158348970 18:56545318-56545340 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1158531592 18:58267756-58267778 CAAATCAGAAGCAGACTCGCTGG - Intronic
1158650665 18:59281801-59281823 ATACCCAGAAGTGGAATTGCTGG + Intronic
1158819282 18:61140465-61140487 ATACCCAGAAGTAGTATTGCTGG + Intergenic
1158887615 18:61843431-61843453 ATACTCAGAGGTGGAATTGCTGG - Intronic
1158898977 18:61943902-61943924 ATACCCAGGAGTAGAATTGCTGG + Intergenic
1159069220 18:63604907-63604929 CTGGTCAGAAGCAGAAGAGCTGG - Intergenic
1159180849 18:64902485-64902507 ATACTCAGAAGTGGGATTGCTGG - Intergenic
1159566862 18:70061106-70061128 ATACTCAGCAGCTGGATTGCTGG + Intronic
1159579561 18:70219772-70219794 ATACTCAGAAGTGGAATTACTGG - Intergenic
1159683427 18:71385113-71385135 ATACTCAGAATTAGGATTGCTGG - Intergenic
1159825447 18:73203109-73203131 ATACCCAGGAGCAGGATTGCTGG + Intronic
1159939490 18:74395940-74395962 CTACTCACATGCAGAGTGGCAGG + Intergenic
1159960584 18:74552792-74552814 GTACTCAGGAATAGAATTGCTGG + Intronic
1160084334 18:75760875-75760897 ATACCCAGAAGAAGGATTGCTGG + Intergenic
1160166344 18:76515927-76515949 ATACCTAGAAGCAGAATTGCTGG - Intergenic
1161784418 19:6314711-6314733 ATACTCAGTAGCGGGATTGCTGG - Intronic
1161834223 19:6634330-6634352 GTACATAGAAGTAGAATTGCTGG - Intergenic
1161935673 19:7370555-7370577 ATACCCAGAAGTGGAATTGCGGG - Intronic
1161940700 19:7401708-7401730 CTACAGAGGAACAGAATTGCTGG - Intronic
1161942756 19:7415827-7415849 ATACCCAGGAGTAGAATTGCTGG + Intronic
1162246931 19:9408786-9408808 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1162785345 19:13031405-13031427 CTACTCTGCAGCAGAAGGGCTGG + Intronic
1163001175 19:14368568-14368590 CTATGCAGAAGTAGAATTGATGG + Intergenic
1163001661 19:14372108-14372130 ATACTCAGGAGCAGAATGGCTGG + Intergenic
1163052860 19:14697707-14697729 ATACTGAGGAGCAGAATTGCTGG + Intronic
1163064665 19:14784251-14784273 ATACCCAGGAGCAGAATGGCTGG - Intergenic
1163155103 19:15435720-15435742 CTACTCAGCAGGAGAATCGCTGG + Intronic
1163172161 19:15539545-15539567 ATACCTAGGAGCAGAATTGCTGG + Intronic
1163534173 19:17867457-17867479 TGACTCAGGAGCAGAAGTGCAGG - Intergenic
1163859631 19:19735073-19735095 ATGCTCAGAAGCAGACTTCCTGG + Intergenic
1164528947 19:29032847-29032869 ATACTCAGCAGCGGGATTGCTGG - Intergenic
1164687360 19:30176288-30176310 CAACTGAGAAGCAGAAATGGAGG - Intergenic
1164728963 19:30487158-30487180 ATTCTCAGAAGCAGAATTACTGG - Intronic
1164955594 19:32380730-32380752 ACACTCAGGAGCATAATTGCTGG - Intronic
1165007289 19:32817616-32817638 CTACTCAGAAGTGGAGCTGCTGG + Intronic
1165084369 19:33333179-33333201 GTACTCAGAAGTGAAATTGCTGG - Intergenic
1165548085 19:36559260-36559282 ATAGCCAGAAGCAGAATTGCTGG - Intronic
1165584393 19:36901004-36901026 CTACCTAGGAGTAGAATTGCTGG - Intronic
1165919388 19:39284791-39284813 ATACACAGAAGTGGAATTGCTGG - Intergenic
1166379131 19:42345805-42345827 ATACCTAGGAGCAGAATTGCTGG + Intronic
1166405332 19:42517808-42517830 ATACTCAGAAGTGGAATTGCTGG - Intronic
1166628144 19:44379886-44379908 ATACCCAGAAGTGGAATTGCTGG - Intronic
1167204616 19:48092385-48092407 ATACTCAGAGGTAGAATTGCTGG - Intronic
1167407564 19:49323841-49323863 ATACCCAGAAGTGGAATTGCTGG - Intronic
1167471804 19:49679754-49679776 CCACCAAGAAGGAGAATTGCTGG + Intronic
1167779119 19:51584961-51584983 CTACCCAGAAGTGGAGTTGCTGG - Intronic
1167815574 19:51877738-51877760 ATACCCAGAAGTGGAATTGCTGG - Intronic
1167998701 19:53427210-53427232 ATACTCAGAGGTAGGATTGCTGG + Intronic
1168008826 19:53513321-53513343 ATACTCAGAGGTAGGATTGCTGG + Intergenic
1168285202 19:55328203-55328225 CTACCTAGAAGTAGAATTACTGG + Intronic
1168397230 19:56058706-56058728 ATACTCAGAAGTAAGATTGCTGG - Intronic
1168500744 19:56890880-56890902 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1168566557 19:57429423-57429445 ATACCCAGAAGTAAAATTGCTGG + Intronic
925211601 2:2052916-2052938 CAACCCAGAAGTGGAATTGCTGG - Intronic
925282422 2:2694072-2694094 CTTTCCAGAAGAAGAATTGCTGG - Intergenic
925815283 2:7741509-7741531 ATACACAGAGGTAGAATTGCTGG + Intergenic
925834658 2:7932380-7932402 ACACTCAGAAGAGGAATTGCTGG - Intergenic
926130379 2:10299812-10299834 ATACCCAGAAGTGGAATTGCTGG - Intergenic
926208738 2:10852990-10853012 ATACCCAGAAGTGGAATTGCTGG + Intronic
926633419 2:15157799-15157821 CTAGTCACAAGCAGCAATGCTGG - Intergenic
926823055 2:16874547-16874569 ATACCCAGTAGTAGAATTGCTGG - Intergenic
927034576 2:19160787-19160809 ATACTCAGAAGTAATATTGCTGG + Intergenic
927045000 2:19269028-19269050 ATACTCAGTAGTGGAATTGCTGG - Intergenic
927473990 2:23398088-23398110 AGGCTCAGAAGCAGAATTGCTGG - Intronic
927565070 2:24104715-24104737 CCACACAGAAGCAGAGCTGCTGG - Intronic
927609273 2:24521740-24521762 ATACCCAGAAGTAGGATTGCTGG + Intronic
927946931 2:27140581-27140603 ATACATAGAAGCAGACTTGCTGG + Intergenic
928054532 2:28038894-28038916 GTACCCAGTAGTAGAATTGCTGG + Intronic
928060770 2:28110717-28110739 CTATTCAGAAGTGGTATTGCTGG + Intronic
928156825 2:28884394-28884416 ATACTTAGAAGCAGAATTGCTGG + Intergenic
928290471 2:30032754-30032776 CTATTGGGCAGCAGAATTGCTGG - Intergenic
928748994 2:34449449-34449471 ATACCCAGCAGTAGAATTGCTGG + Intergenic
928750230 2:34461961-34461983 CTACTCAGAAGCAAAAGGGATGG + Intergenic
928970664 2:37025133-37025155 CTGTTCAGAATCAGAATGGCAGG + Intronic
929017213 2:37510298-37510320 ATACCCAGAAGAGGAATTGCTGG - Intergenic
929103028 2:38335226-38335248 ATACCCAGGAGTAGAATTGCTGG - Intronic
929117246 2:38454985-38455007 GTACCTAGGAGCAGAATTGCTGG + Intergenic
929184353 2:39078425-39078447 GTACTTAGAAGTAGAATTGCTGG - Intronic
929634440 2:43503192-43503214 ATACCTAGAAGTAGAATTGCAGG - Intronic
929661735 2:43793011-43793033 AGACTCAGAAGTGGAATTGCTGG + Intronic
930129842 2:47838415-47838437 CTTTTCAGAAGTAGAATTACTGG + Intronic
930134848 2:47891631-47891653 ATACTTGGAAGAAGAATTGCTGG + Intronic
930144371 2:47986252-47986274 ATACCCAGAAGTGGAATTGCTGG + Intergenic
930275937 2:49311190-49311212 GTACTCAGTAGTAGGATTGCTGG + Intergenic
930446583 2:51481228-51481250 ATACCCAGAAGTAAAATTGCTGG - Intergenic
930459447 2:51653630-51653652 ATACCCAGAAGTGGAATTGCTGG - Intergenic
930572663 2:53107035-53107057 ATACTCAGTAGTGGAATTGCTGG - Intergenic
930767321 2:55097337-55097359 AGACTCAGAATCAGAATTTCTGG + Intronic
931028912 2:58148047-58148069 CTCCTGAGATGTAGAATTGCTGG + Intronic
931153536 2:59601817-59601839 ATACACAGAAGAAGAATTGCTGG + Intergenic
931287344 2:60843648-60843670 AAACTGAGGAGCAGAATTGCTGG + Intergenic
931444373 2:62314512-62314534 CTACCCAAAAGCAGAATGGGAGG + Intergenic
931594215 2:63923400-63923422 ATACCCAGAAGTAGAATTGCTGG - Intronic
931765163 2:65448946-65448968 CTACACAGAACCAGAAGTGGTGG - Intergenic
932363254 2:71128340-71128362 ATACTCATAAGTGGAATTGCTGG - Intronic
932725537 2:74176910-74176932 ATACTTAGGAGCAGAATTGCTGG - Intronic
932963138 2:76439355-76439377 AAACCTAGAAGCAGAATTGCTGG - Intergenic
933305580 2:80593986-80594008 ATACCCAGAAGTGGAATTGCAGG + Intronic
933360436 2:81275999-81276021 ATACTCAGAAGTTAAATTGCTGG - Intergenic
933766027 2:85710330-85710352 CTACCCAGAAGCAGACTATCAGG - Intergenic
934696140 2:96401784-96401806 ATACTCAGAGGTGGAATTGCTGG - Intergenic
934705069 2:96471334-96471356 ATACTTAGAAGTGGAATTGCTGG - Intergenic
935022057 2:99241101-99241123 CTTCTCAGAAACAGAAGTGATGG + Intronic
935076029 2:99744896-99744918 ATACTTAGGAGCAGAATTTCTGG + Intronic
935212587 2:100951315-100951337 ATACCCATAAGTAGAATTGCTGG - Intronic
935323551 2:101912392-101912414 GTACCCAGAAGTGGAATTGCTGG - Intergenic
935395308 2:102601736-102601758 ATACCCAGAAGCAATATTGCTGG + Intergenic
935517753 2:104064023-104064045 CTACCTAGAAGTGGAATTGCTGG - Intergenic
935629911 2:105205276-105205298 ATACTCGGAAGTAGAATTGTTGG + Intergenic
935874896 2:107495870-107495892 CTACTCAGAAGCATAATTACTGG + Intergenic
935947510 2:108299709-108299731 ATACCCAGAAGTGGAATTGCTGG - Intronic
935974881 2:108568539-108568561 TTACTCAGAAGTAGGATTGCTGG + Intronic
936773109 2:115938819-115938841 TTACTAGGAGGCAGAATTGCAGG - Intergenic
936906775 2:117545250-117545272 CTACTCCGAAGTGGGATTGCTGG + Intergenic
936975703 2:118219712-118219734 ATACTCAGGAATAGAATTGCTGG + Intergenic
937005474 2:118508715-118508737 GTACTTAGGAGTAGAATTGCTGG - Intergenic
937252122 2:120531125-120531147 ATACCCAGAAGTAGAATTGCTGG - Intergenic
937277898 2:120697424-120697446 ATTCTCAGAAGCGCAATTGCTGG - Intergenic
937497955 2:122444379-122444401 ATACCCAGAAGTAGAATTACTGG + Intergenic
938235575 2:129703634-129703656 ATACCCAGAAGTGGAATTGCTGG + Intergenic
938319261 2:130352131-130352153 CCTTTCTGAAGCAGAATTGCAGG + Intergenic
938545453 2:132325262-132325284 ATACCCAGAAGTGGAATTGCTGG + Intergenic
938811553 2:134858011-134858033 ATAGCCAGAAGTAGAATTGCTGG - Intronic
938818142 2:134925786-134925808 ATACCCAGGAGTAGAATTGCTGG + Intronic
938821612 2:134966239-134966261 ATACTCAGTAGGAGGATTGCTGG + Intronic
938826940 2:135015056-135015078 GTATTTAGGAGCAGAATTGCTGG + Intronic
938844335 2:135193499-135193521 GTACTCAAAAGTGGAATTGCTGG - Intronic
938894687 2:135738320-135738342 CTACTGAGAGGCAAAACTGCTGG - Intergenic
939054460 2:137346939-137346961 ATACATAGAAGCGGAATTGCTGG + Intronic
939071096 2:137544094-137544116 ATACCTAGAAGTAGAATTGCTGG - Intronic
939263671 2:139843346-139843368 GTACTCAGCAGTAGAATTACTGG - Intergenic
939303656 2:140381001-140381023 TTATTCAGAAGTAGATTTGCTGG - Intronic
939480140 2:142738038-142738060 ATACCCAGAAGTAGGATTGCTGG + Intergenic
939610122 2:144299749-144299771 ATACCCAGAAGTGGAATTGCTGG - Intronic
939695519 2:145318667-145318689 CTACCAAGAAGTGGAATTGCTGG + Intergenic
939724898 2:145706005-145706027 ATACCCAGAAGTAGGATTGCTGG + Intergenic
939798043 2:146672299-146672321 ATACCAAGAAGCACAATTGCTGG - Intergenic
939874865 2:147566033-147566055 ATACTTAGAAGTAGAATTACTGG - Intergenic
939926533 2:148181371-148181393 ATACCCAGGAGCAGAATTGCTGG + Intronic
939990076 2:148869647-148869669 ATACCTAGAAGTAGAATTGCTGG + Intergenic
940059748 2:149551828-149551850 ATACTGAGAAGTGGAATTGCTGG + Intergenic
940212705 2:151272553-151272575 ATACCCAGAAGTTGAATTGCTGG - Intronic
940278416 2:151963709-151963731 CTTCTTAGAAGCAAAATTACTGG - Intronic
940283111 2:152007730-152007752 ATATTCAGAAGTGGAATTGCTGG + Intronic
940359334 2:152780734-152780756 GTACTCAGAAGTGGGATTGCTGG + Intergenic
940727897 2:157356014-157356036 CTAGTCAGAAGCAGAACAGTTGG - Intergenic
940762862 2:157756785-157756807 GTACTCAGTAGTGGAATTGCTGG - Intronic
940813204 2:158269073-158269095 ATATTCAGAAGATGAATTGCTGG + Intronic
940912660 2:159222749-159222771 ATATCCAGAAGCAGAATTTCTGG + Intronic
941046458 2:160681285-160681307 ATACCCAGAAGCGGAGTTGCTGG + Intergenic
941103651 2:161326533-161326555 ATACCCAGAAGCTGAATTGCTGG - Intronic
941109479 2:161403022-161403044 ATACTTATGAGCAGAATTGCTGG - Intronic
941131390 2:161653908-161653930 ATACTCAGAAGTGGGATTGCTGG + Intronic
941419338 2:165262760-165262782 ATACTCAGTAGTGGAATTGCTGG + Intronic
941419706 2:165268073-165268095 ATACCCAGAAGTAGAATTACTGG - Intronic
941671940 2:168303452-168303474 ATACCCAGCAGCAGGATTGCTGG + Intergenic
941807786 2:169726179-169726201 GTACCCAGCAGCAGGATTGCTGG - Intronic
941947931 2:171120773-171120795 ATACTCAGAAGTGAAATTGCTGG - Intronic
942057941 2:172202639-172202661 ATACTCAGCAGCAGGATTGCTGG - Intergenic
942243101 2:173982222-173982244 ATACCCAGAAGTGGAATTGCTGG + Intergenic
942287072 2:174430117-174430139 ATACTAAGGAGCACAATTGCTGG + Intergenic
942539883 2:177004729-177004751 ATACACAGAAGAGGAATTGCTGG - Intergenic
942646526 2:178116351-178116373 CTACACAGAAGAAGATCTGCGGG + Exonic
942650347 2:178160551-178160573 ATACCCAGAAGTAGAATTGGTGG + Intergenic
942897886 2:181079942-181079964 ATACTCAAAAGTAGGATTGCTGG - Intergenic
942999416 2:182306344-182306366 ATACACAGAAGTGGAATTGCTGG + Intronic
943082947 2:183278532-183278554 ATACTCAGAAGTGGGATTGCTGG - Intergenic
943154950 2:184163930-184163952 ATACCCAGAAGTAGAATTTCTGG - Intergenic
943304204 2:186239936-186239958 ATACTCAGTAATAGAATTGCTGG - Intergenic
943554402 2:189384265-189384287 ATACTCAGCAGTAGGATTGCTGG + Intergenic
943625564 2:190195334-190195356 ATACCAAGAAGCAGAACTGCTGG + Intronic
944135573 2:196395860-196395882 ATACCCAGAAGTAGAATAGCTGG - Intronic
944622416 2:201530232-201530254 ATACCCAGAAGTAGGATTGCTGG - Intronic
944923461 2:204438845-204438867 ATAGTCAGAAGGAGGATTGCTGG - Intergenic
944935905 2:204567723-204567745 ATACCCAGAAGTAGAATTGCTGG + Intronic
945007760 2:205427242-205427264 ATTCACAGAAGCAGGATTGCTGG - Intronic
945255985 2:207803678-207803700 ATACTCAGAAGTGGAATTGCTGG + Intergenic
945389892 2:209252269-209252291 ATACTCAGAAGTAAAACTGCTGG - Intergenic
945479384 2:210326552-210326574 ATACTCAGAAGTAGGATTGCTGG + Intergenic
945622755 2:212162070-212162092 ATACCAAGAAGTAGAATTGCTGG - Intronic
945863768 2:215153909-215153931 ATACCGAGAAGCATAATTGCTGG + Intergenic
946114189 2:217447196-217447218 CTTCTCTCAAGGAGAATTGCAGG + Intronic
946283800 2:218686777-218686799 CTACGTAGGAGTAGAATTGCTGG + Intronic
946471081 2:219961711-219961733 ATACCTAGAAGTAGAATTGCTGG + Intergenic
946924239 2:224610778-224610800 ATACCCAGAAGTGGAATTGCTGG - Intergenic
946938013 2:224742021-224742043 ATACCCAGAAGTAGAATTGCTGG + Intergenic
947128898 2:226901393-226901415 ATATGCAGAAGTAGAATTGCTGG + Intronic
947544096 2:230998852-230998874 ATACTGAGAAGTGGAATTGCTGG - Intronic
947587132 2:231363331-231363353 ATACCCAGAAGAAGAATTGGTGG + Intronic
948490872 2:238312289-238312311 CTACCCAGAAGTAGGACTGCTGG - Intergenic
948503743 2:238413591-238413613 ATGCTCAGAAGTAGAATTGCTGG + Intergenic
948504532 2:238419409-238419431 ATACTCAGAAGTGGAATTGCTGG + Intergenic
948529530 2:238595508-238595530 CTACTCAGGAGCAGGAGGGCAGG - Intergenic
948546395 2:238732471-238732493 GTACTTAGGAGCACAATTGCTGG + Intergenic
949082294 2:242112336-242112358 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1168829409 20:836716-836738 ACACTCAGAAGTGGAATTGCTGG + Intronic
1169282396 20:4278686-4278708 CTACTGAGAAGCTGGATTGATGG + Intergenic
1169331276 20:4718305-4718327 ATACTCAGGAGTAGATTTGCTGG - Intergenic
1169334587 20:4745486-4745508 TTACTGAGAAGTAGAATTGGTGG - Intergenic
1169661883 20:7988131-7988153 CTACTTAGATGTAGAGTTGCAGG + Intronic
1170079784 20:12461459-12461481 ATACTCAGAAGTAGTATTGCTGG - Intergenic
1170114408 20:12841264-12841286 ATACCTAGAAGTAGAATTGCTGG + Intergenic
1170209339 20:13832566-13832588 ATACTAAGCAGCAGAATTGCTGG + Intergenic
1170216585 20:13898113-13898135 ATACCCAGAAGTAGAATTGCTGG - Intronic
1170443362 20:16400489-16400511 GTACCCAGAAGTAGAATTGCTGG - Intronic
1170450543 20:16478933-16478955 ATACTTGGAAGTAGAATTGCTGG - Intronic
1170499825 20:16963050-16963072 ATACTCAGTAACAGGATTGCTGG - Intergenic
1170687530 20:18582985-18583007 ATACTCAGCAGTAGGATTGCTGG + Intronic
1170870425 20:20200870-20200892 CAACTCAGAGGCAGCTTTGCGGG + Intronic
1170986122 20:21260616-21260638 ATACCCAGAAGTGGAATTGCAGG + Intergenic
1171049933 20:21848158-21848180 GTACTCAGAATTGGAATTGCTGG - Intergenic
1171378326 20:24711166-24711188 GTACTTAGAAGTGGAATTGCTGG + Intergenic
1171874312 20:30558018-30558040 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1172014880 20:31867397-31867419 ATTCCTAGAAGCAGAATTGCTGG - Intronic
1172172462 20:32947118-32947140 GTATTTAGAAGCAGAATGGCTGG + Intronic
1172790327 20:37500320-37500342 ATACTTAGAAACAGAATTGATGG - Intronic
1172919679 20:38471098-38471120 CCACTTAGAAGCAGAATTTCAGG + Intergenic
1173079843 20:39855209-39855231 ATACTCAGAAGTGGAATTGTTGG + Intergenic
1173152001 20:40575123-40575145 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1173537461 20:43826972-43826994 ATACCCAGAAGTAGGATTGCTGG + Intergenic
1173578261 20:44127317-44127339 ATACCTAGGAGCAGAATTGCTGG + Intronic
1173772654 20:45676214-45676236 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1174208675 20:48859684-48859706 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1174995732 20:55566404-55566426 GTACTCAGAAGGGAAATTGCTGG + Intergenic
1175302098 20:57950177-57950199 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1175514840 20:59562601-59562623 GTACCCAGAGGCAGAACTGCCGG - Intergenic
1175772928 20:61635150-61635172 CTGCTGAGAAGTTGAATTGCTGG + Intronic
1176133607 20:63508479-63508501 ATGCTCAGAAGCGGAATTGCTGG + Intergenic
1176517221 21:7794795-7794817 ATACCCAGGAGTAGAATTGCTGG - Intergenic
1177017428 21:15809630-15809652 ACACCAAGAAGCAGAATTGCTGG - Intronic
1177113793 21:17061154-17061176 CCACTTAGAAGCAGAATTGAAGG + Intergenic
1177158697 21:17524473-17524495 CTACCCAGGAGGAGAATCGCTGG + Intronic
1177538659 21:22463199-22463221 ATACTCAGTAGTAGGATTGCTGG + Intergenic
1177964048 21:27705060-27705082 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1178039733 21:28626867-28626889 ATACTTAGGAGCAGAATTGTTGG - Intergenic
1178095523 21:29211230-29211252 ATACTCAGAAGCATAATTACTGG - Intronic
1178627400 21:34229415-34229437 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1178651249 21:34424807-34424829 ATACCCAGGAGTAGAATTGCTGG - Intergenic
1178771735 21:35511097-35511119 CAATTCAGAAGCAGCATTCCTGG - Intronic
1178933649 21:36841962-36841984 ATACCCAGGAGTAGAATTGCTGG - Intronic
1178955182 21:37015464-37015486 CTAATCAAAAACAGAATGGCCGG - Intronic
1179066899 21:38033427-38033449 ATACTCAGAAGTGGAATTGCTGG + Intronic
1179119949 21:38534700-38534722 ATACCCAGAAGTAGAATTGCTGG - Intronic
1179130240 21:38629733-38629755 ATACCCAGAAGTATAATTGCTGG - Intronic
1179429961 21:41314915-41314937 ATACTGAGAAGTGGAATTGCTGG - Intronic
1179636710 21:42716244-42716266 ATACCAAGAAGCACAATTGCTGG + Intronic
1179817797 21:43918685-43918707 CTACTCAGGAGGAGAATCACTGG - Intronic
1180016280 21:45087192-45087214 ATTCCTAGAAGCAGAATTGCTGG - Intronic
1180239850 21:46495089-46495111 CTATTCAGATTCAGAACTGCAGG + Intronic
1180677638 22:17598803-17598825 ATACCCAGAAGTAGAATTGCTGG - Intronic
1180943030 22:19672268-19672290 AAAATCAGGAGCAGAATTGCTGG + Intergenic
1181322097 22:22015841-22015863 ATACCTAGGAGCAGAATTGCTGG - Intergenic
1181581363 22:23830167-23830189 ATACCCAGGAGTAGAATTGCTGG + Intronic
1181583429 22:23840193-23840215 GTACCCACAAGCAGCATTGCTGG - Intergenic
1181749704 22:24980586-24980608 ATACCCAGAAGTGGAATTGCTGG + Intronic
1182175675 22:28284974-28284996 ATACTCAGACGTAGAATTGCTGG - Intronic
1182244741 22:28947366-28947388 ATACTTAGGAGCGGAATTGCTGG + Intronic
1182247664 22:28972618-28972640 ATACTCAGGAGTGGAATTGCTGG + Intronic
1182674445 22:32027206-32027228 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1182791480 22:32956790-32956812 ATTCCCAGAAGTAGAATTGCTGG + Intronic
1183118511 22:35711399-35711421 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1183141840 22:35949396-35949418 ATATTCAGAAGCAGAACTGCTGG + Intronic
1183659798 22:39212589-39212611 CTACCCAGAAGTGGGATTGCTGG + Intergenic
1183673519 22:39287043-39287065 TTCCTTAGAAGGAGAATTGCTGG - Intergenic
1183757620 22:39784377-39784399 ATACTCAGTAGTAGAATTGCTGG - Intronic
1184097348 22:42323703-42323725 CTTCCCAGAGGCAGAAATGCAGG + Intronic
1184154616 22:42659077-42659099 ATACTTAGAAGTGGAATTGCTGG + Intergenic
1184597613 22:45523801-45523823 TTACCCAGAAGTGGAATTGCTGG + Intronic
1184756942 22:46521859-46521881 ATACCCAGAAGCGGGATTGCTGG + Intronic
949266781 3:2166062-2166084 ATACCCAGAAGTGGAATTGCTGG + Intronic
949366189 3:3283642-3283664 ATACTCAGAGGAGGAATTGCTGG + Intergenic
949371459 3:3338981-3339003 ATACTCAGGAGTAGAACTGCTGG + Intergenic
949557542 3:5169403-5169425 ATATTCAGAAGTTGAATTGCTGG + Intronic
949938183 3:9133818-9133840 CTATTTAGAAGCAGACATGCTGG + Intronic
950044775 3:9942667-9942689 CAACACAGAAGCAGACTAGCTGG - Intronic
950120332 3:10477897-10477919 CTACCCAGTAGTGGAATTGCTGG + Intronic
950182408 3:10924965-10924987 CTACCTAGAAGTGGAATTGCTGG - Intronic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
950278702 3:11686159-11686181 ATACCCAGAAGCAGAGCTGCTGG - Intronic
950375049 3:12564263-12564285 ATACCCAGAAGTGGAATTGCCGG + Intronic
950451007 3:13065715-13065737 ATACTCAGAAGTGGGATTGCTGG - Intronic
950622672 3:14218480-14218502 GTACTTAGGAGCAGAATGGCTGG + Intergenic
950694328 3:14686345-14686367 ATACCCAGAAGTGGAATTGCTGG + Intronic
950732312 3:14971498-14971520 ATACCCAGAAGTGGAATTGCTGG + Intronic
950905395 3:16533270-16533292 ATACTCAGAAGTGGAATTGCTGG + Intergenic
950960807 3:17104807-17104829 ATACTTAGCAGTAGAATTGCTGG - Intergenic
951069876 3:18314968-18314990 ATACCCAGAAGTAGAATTGCTGG + Intronic
951095678 3:18627071-18627093 ATATTCAGAAGTGGAATTGCTGG - Intergenic
951350699 3:21603372-21603394 GTTACCAGAAGCAGAATTGCTGG - Intronic
951562899 3:23986002-23986024 ATACCCAGAAGTGGAATTGCTGG - Intergenic
951594782 3:24306202-24306224 CTTCTGAAAACCAGAATTGCAGG - Intronic
951869138 3:27340827-27340849 ATACCCAGTAGCAGAATTGCTGG - Intronic
952069264 3:29613957-29613979 ATACTCAGCAGCGGGATTGCTGG - Intronic
952109507 3:30106417-30106439 GTACTCAGCAGTAGCATTGCTGG + Intergenic
952177607 3:30882674-30882696 ATACTCAGAAGTAGAATTGCTGG + Intronic
952204022 3:31161291-31161313 ATACTCAGGAGTAGAATTACTGG - Intergenic
952434024 3:33254476-33254498 ATACCAAGAAGCACAATTGCTGG - Intergenic
952461570 3:33532001-33532023 ATACCCAGAAGTAGAATTGCTGG - Intronic
952486853 3:33820910-33820932 ATACTCAAAAGTGGAATTGCTGG + Intronic
952644328 3:35638309-35638331 CATTTCAGAAGCTGAATTGCTGG + Intergenic
952757854 3:36887984-36888006 ATACCCAGGAGTAGAATTGCCGG - Intronic
952778382 3:37069220-37069242 GTACCCAGAAGTGGAATTGCTGG - Intronic
952841290 3:37648035-37648057 ATACCCAGAAGAGGAATTGCAGG + Intronic
952868698 3:37877597-37877619 ATATACAGAAGTAGAATTGCTGG + Intronic
952914050 3:38218125-38218147 ATCCTCATAAGTAGAATTGCTGG + Intronic
953041637 3:39260423-39260445 ATACTCAGAAGTGGTATTGCTGG + Intergenic
953082387 3:39632761-39632783 ATACCCAGAAGTAGGATTGCTGG - Intergenic
953086697 3:39675611-39675633 CTACTCAGTAGTGGGATTGCTGG + Intergenic
953276309 3:41502208-41502230 ATTCCCAGAAGTAGAATTGCTGG + Intronic
953318691 3:41952697-41952719 ATACTCAGAAGTGGAATTGCTGG - Intronic
953724418 3:45385257-45385279 CTACTCAGAAGTAGAGTTGCTGG + Intergenic
953900905 3:46843292-46843314 ATACCTAGAAGCAGAATTACTGG - Intergenic
954601316 3:51872516-51872538 ATACCCAGAAGTGGAATTGCTGG - Intergenic
954817790 3:53296894-53296916 ATACCCAGGAGCAGAATTGCTGG + Intronic
954889868 3:53915737-53915759 ATACTCAGAAGCAAAATTGCTGG + Intergenic
955045481 3:55355511-55355533 ATAGCCAGAAGCGGAATTGCTGG + Intergenic
955171981 3:56575052-56575074 GTACTCAGAATTGGAATTGCAGG + Intronic
955359609 3:58261826-58261848 ACACTCATAAGTAGAATTGCTGG - Intronic
955622856 3:60884343-60884365 ATACCCAGCAGCAGGATTGCTGG - Intronic
955708811 3:61756962-61756984 ATTCTGAGAAGCAGAAGTGCTGG - Intronic
955928300 3:64029659-64029681 GTTCCCAGAAGCAGGATTGCTGG - Intergenic
955958211 3:64312255-64312277 ATACCCAGAAGTGGAATTGCTGG - Intronic
956145256 3:66185461-66185483 ATACCTAGAAGTAGAATTGCTGG + Intronic
956405451 3:68924107-68924129 CTACCCAGAAGTGGAGTTGCTGG - Intronic
956600926 3:71021549-71021571 CTACCTAGAAGTTGAATTGCTGG + Intronic
956981301 3:74641677-74641699 ATACCCAGAAGTGGAATTGCTGG - Intergenic
956987053 3:74712848-74712870 ATACTTAAAAACAGAATTGCTGG + Intergenic
957184409 3:76923245-76923267 GTGTTCAGAAGCAGAATGGCGGG - Intronic
957256909 3:77848748-77848770 ATACTCAGTGGTAGAATTGCTGG + Intergenic
957312459 3:78538632-78538654 ATACCCAGTAGCAAAATTGCTGG - Intergenic
957404312 3:79757172-79757194 GTACCCAGAAGTAGAATTGCTGG + Intronic
957454684 3:80426005-80426027 ATACTCAGTAGTGGAATTGCTGG + Intergenic
957605504 3:82393383-82393405 ATACCCAGAAGTGGAATTGCTGG + Intergenic
957645632 3:82921113-82921135 TTTTTCAGGAGCAGAATTGCAGG + Intergenic
958034298 3:88151553-88151575 CTTGTTAGAAGCAGAATTTCTGG - Intronic
958537051 3:95417676-95417698 GTAATCAGATGTAGAATTGCTGG - Intergenic
959090509 3:101897720-101897742 ATACCTAGAAGAAGAATTGCTGG + Intergenic
959278692 3:104309949-104309971 CTACTCAGAAATGGGATTGCTGG - Intergenic
959567886 3:107851337-107851359 ATACCCAGTAGCAGGATTGCTGG - Intergenic
959654680 3:108789187-108789209 GTACCCAGAAGAAGAATTGCTGG - Intergenic
959880089 3:111434047-111434069 ATACTCAGAAGTCAAATTGCTGG - Intronic
960012151 3:112845523-112845545 CAACTCAGAAGGAGTTTTGCTGG + Intronic
960674578 3:120181911-120181933 CTAGTCAGATGCAGTCTTGCAGG - Intronic
960751232 3:120956685-120956707 ATATCCAGAAGAAGAATTGCTGG + Intronic
960779119 3:121297990-121298012 ATACCCAGAAGTAGGATTGCTGG + Intronic
960945042 3:122960453-122960475 ATACCCAGAAGTGGAATTGCTGG - Intronic
961005167 3:123400403-123400425 ATTCTCAGAAGCAGAATTAGTGG - Intronic
961053212 3:123765177-123765199 ATGCTCAGAAGTGGAATTGCTGG - Intronic
961073364 3:123959153-123959175 ATTCCCAGAAGTAGAATTGCTGG + Intronic
961310211 3:125992669-125992691 ATGCCCAGAAGTAGAATTGCTGG - Intergenic
961350454 3:126297959-126297981 GTACCCAGTAGCAGGATTGCTGG + Intergenic
961422921 3:126820677-126820699 AGACTCAGAAGTACAATTGCTGG + Intronic
961430929 3:126882411-126882433 CTACTAAGAAACAGAAGTCCTGG + Intronic
961504981 3:127364052-127364074 ATACCCAGGAGTAGAATTGCTGG + Intergenic
961863370 3:129935787-129935809 ATACCCAGAAGTAGAATTCCTGG - Intergenic
961863891 3:129939630-129939652 CTGCCTAGAAGCAGAATTTCTGG + Intergenic
962489607 3:135880449-135880471 ATAATCAGGAGTAGAATTGCTGG - Intergenic
962565615 3:136655904-136655926 ATACCCAGAAGTAAAATTGCTGG - Intronic
962698770 3:137976751-137976773 ATACCCAGCAGTAGAATTGCTGG + Intergenic
962743396 3:138379838-138379860 ATACTCAGCAGTAGGATTGCTGG + Intronic
962744393 3:138386923-138386945 ATACCTAGAAGTAGAATTGCTGG + Intronic
962843711 3:139257359-139257381 ATACGCAGAAGTAGAATTGCTGG + Intronic
962993677 3:140603856-140603878 ATACACAGAAGTAGAATGGCTGG + Intergenic
963291087 3:143490150-143490172 ATACCCAGAAGTAGAATTGCTGG - Intronic
963403491 3:144833308-144833330 ATACTCAGTAGTGGAATTGCTGG + Intergenic
963418520 3:145028906-145028928 ATACCCAGCAGTAGAATTGCTGG - Intergenic
963955642 3:151250778-151250800 GTGCCCAGAAGCAAAATTGCTGG + Intronic
964491250 3:157238920-157238942 ATACTCAGTAGTGGAATTGCTGG + Intergenic
964511311 3:157455104-157455126 ATACCCAGCAGTAGAATTGCTGG + Intronic
964670691 3:159222128-159222150 CTACCCAGAAGAGGGATTGCAGG - Intronic
964800256 3:160548800-160548822 ATACTCAGAAGTGGAATTGCTGG + Intronic
964804637 3:160595007-160595029 ATACTCAGCAGTGGAATTGCTGG - Intergenic
964854235 3:161128781-161128803 ATACCCAGAAGTAAAATTGCTGG - Intronic
965154460 3:165029411-165029433 ATACCCAGTAGCAGGATTGCTGG - Intronic
965174180 3:165309305-165309327 CTACCCAGCAGTGGAATTGCTGG + Intergenic
965187593 3:165484681-165484703 ATACACAGATGTAGAATTGCTGG - Intergenic
965631484 3:170737808-170737830 ATACCCAGTAGCGGAATTGCTGG - Intronic
965696900 3:171418335-171418357 TTTCTCAGGAGTAGAATTGCTGG - Intronic
965739549 3:171859360-171859382 ATACCCAGAAGTAGCATTGCTGG - Intronic
966153854 3:176894667-176894689 ATACTCAGTAGTGGAATTGCTGG - Intergenic
966235520 3:177697528-177697550 ATACTCAGAAATAGAATTGCTGG - Intergenic
966285558 3:178291272-178291294 ATACTTTGAAGCAGAATTACCGG + Intergenic
966311593 3:178600421-178600443 ATAACCAGAAGTAGAATTGCTGG + Intronic
966605605 3:181818857-181818879 ATACTCAGGAGTAGAATTTCTGG + Intergenic
966697259 3:182803105-182803127 ATACCCAGAAGTGGAATTGCTGG + Intronic
966698015 3:182813227-182813249 ATACCCAGAAGTAGAATTGCTGG + Intronic
966963388 3:184964946-184964968 ATACCCAGAAGTAGAATTGTTGG + Intronic
967165453 3:186775785-186775807 ATACTCAGAAGTGGAATTGGTGG + Intergenic
967489412 3:190072518-190072540 ATCCTTAGAAGTAGAATTGCTGG - Intronic
967680355 3:192355137-192355159 TTACCTAGAAGTAGAATTGCTGG - Intronic
967784807 3:193480758-193480780 ATACTCAGGAGTGGAATTGCTGG - Intronic
967911207 3:194544077-194544099 ATACCAAGAAGCACAATTGCTGG + Intergenic
968183939 3:196618301-196618323 ATTCCCATAAGCAGAATTGCTGG + Intergenic
968400190 4:287801-287823 GTGCTCAGAAGTAGAATTACTGG + Intronic
968461859 4:730189-730211 GTGCACAGCAGCAGAATTGCGGG + Intronic
968541156 4:1169093-1169115 CCAAGCAGAAGCAGTATTGCAGG - Intronic
968839034 4:2987638-2987660 GTACTCAGAAGCAGAATTGTTGG + Intronic
968875515 4:3265296-3265318 ATACTCAGAAGTGGAATTACTGG + Intronic
969186843 4:5481092-5481114 ATACCCAGAAGTGGAATTGCTGG + Intronic
969990625 4:11258702-11258724 ATACCCAGAGGTAGAATTGCTGG - Intergenic
970186995 4:13466663-13466685 ATACACAGAAGTAGGATTGCTGG - Intronic
970881025 4:20931017-20931039 CTACTCAAAAGAGGAATTGCTGG - Intronic
971084395 4:23254640-23254662 ATACCCAGAAGCGGGATTGCTGG + Intergenic
971346113 4:25813175-25813197 GTATCCAGAAGCAGAATTTCTGG - Intronic
971457195 4:26856487-26856509 ATACTCAGAAGTGGGATTGCTGG + Intergenic
971544769 4:27871212-27871234 ATACACAGAAGTAGAATTGCTGG - Intergenic
971592557 4:28486751-28486773 ATACTCAGAAGTGGGATTGCTGG + Intergenic
971628031 4:28949450-28949472 ATACCCAGGAGAAGAATTGCTGG - Intergenic
971693283 4:29865508-29865530 ATACTCAGTAGTGGAATTGCTGG - Intergenic
971745203 4:30570742-30570764 ATACCTAGAAGTAGAATTGCTGG - Intergenic
971754528 4:30690215-30690237 ATACATAGAAGTAGAATTGCTGG + Intergenic
971879929 4:32358691-32358713 ATACCCAGAAGTGGAATTGCTGG + Intergenic
971976949 4:33702133-33702155 ATAGTCAGAAGTAGAATTTCTGG + Intergenic
972179989 4:36452196-36452218 ATACCCAGTAGTAGAATTGCTGG - Intergenic
972190018 4:36579462-36579484 CTACTCGGTAGTAGGATTGCTGG - Intergenic
972373812 4:38451415-38451437 ATACTCAGAAGTAGAATTGCTGG - Intergenic
972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG + Intergenic
972690019 4:41388132-41388154 CTACCTAAAAGTAGAATTGCTGG - Intronic
972744323 4:41918577-41918599 ATACTCAGAAGTGAAATTGCTGG - Intergenic
972970675 4:44572065-44572087 ATACTCAGTAGTGGAATTGCTGG + Intergenic
973029645 4:45320638-45320660 TTATTTAGAAGTAGAATTGCTGG + Intergenic
974081950 4:57223116-57223138 ATACTCAGAAGTGGGATTGCTGG + Intergenic
974437164 4:61870923-61870945 ATACCCAGAAGTGGAATTGCTGG - Intronic
974490090 4:62553501-62553523 CTACCCAGCAGTGGAATTGCTGG + Intergenic
974677897 4:65118955-65118977 ATACTCAGAAGTGGAATTGTTGG + Intergenic
974930291 4:68353450-68353472 ATACACAGAAATAGAATTGCTGG + Intergenic
975040597 4:69740680-69740702 CTACTCAGTAATAGGATTGCTGG + Intronic
975374366 4:73626423-73626445 ATACCCAGAAGGGGAATTGCTGG + Intergenic
975463043 4:74676913-74676935 ATGCTCAGGAGCACAATTGCTGG + Intergenic
975768418 4:77694226-77694248 ATACTCAGAAGTGGGATTGCTGG + Intergenic
975825144 4:78311581-78311603 ATACCCAGGAGCAGAATGGCTGG + Intronic
975886158 4:78967820-78967842 ATACCCAGAAGTAGGATTGCTGG + Intergenic
975948379 4:79737176-79737198 ATACTCAGAAGATGGATTGCCGG + Intergenic
975981408 4:80164114-80164136 GTACCCAGAAGTGGAATTGCTGG - Intergenic
976027270 4:80704333-80704355 CTACTGAGAATGAGAAATGCAGG + Intronic
976240609 4:82952585-82952607 GTACCCAAAAGTAGAATTGCTGG - Intronic
976371625 4:84295417-84295439 ATACCCAGTAGCAGGATTGCTGG + Intergenic
976384839 4:84444854-84444876 ACACCCAGAAGCGGAATTGCTGG + Intergenic
976528650 4:86123408-86123430 ATACCCAGAAGTAGGATTGCTGG + Intronic
976576317 4:86676490-86676512 ATACTCAGAAGTGGAGTTGCTGG - Intronic
976911029 4:90305809-90305831 ATACCCAGAAGTAGGATTGCTGG - Intronic
976989445 4:91346498-91346520 ATACTAAGGAGCACAATTGCTGG + Intronic
977033563 4:91919711-91919733 ATACCCAGTAGCAGAATTGCTGG + Intergenic
977139149 4:93345166-93345188 ATACTCAGAAGTAGGATTGCTGG + Intronic
977464693 4:97369184-97369206 ATACTCGAAAGTAGAATTGCTGG + Intronic
977608605 4:99009377-99009399 ATACTCAGAAGTGGGATTGCTGG + Intronic
977697059 4:99977471-99977493 ATACTCAGTAACAGAATTTCTGG - Intergenic
978042415 4:104084421-104084443 CTTCTCAAAAGAAGAAGTGCAGG + Intergenic
978049628 4:104181840-104181862 ATACCCAGAAGTTGAATTGCTGG - Intergenic
978138918 4:105295800-105295822 ATACCTAGAAGTAGAATTGCTGG - Intergenic
978290532 4:107133590-107133612 ATACCCAGAAGTAGGATTGCTGG - Intronic
978982351 4:114963035-114963057 CTACCCAGAAGTGGAATTACTGG - Intronic
979217072 4:118178693-118178715 ATACCCAGAAGCAGAATTGCTGG + Intronic
979517364 4:121624939-121624961 ATACCCAGGAGCAAAATTGCTGG + Intergenic
979867924 4:125778905-125778927 ATACTCAGTAATAGAATTGCTGG + Intergenic
980079509 4:128329081-128329103 ATACCCAGAAGTGGAATTGCTGG - Intergenic
980094667 4:128476667-128476689 ATACCCAGAAGAGGAATTGCTGG - Intergenic
980282725 4:130741394-130741416 ATACTTAGAAGTAGAATTGCTGG + Intergenic
980310455 4:131123156-131123178 CTAATAAGAAGAAGAATTACTGG + Intergenic
981229292 4:142334464-142334486 ATACCCAGAAGTGGAATTGCTGG + Intronic
981551906 4:145950477-145950499 ATACTCTGAAGTAGAATTGCTGG - Intergenic
981785602 4:148475947-148475969 ATACTCAGTAGTGGAATTGCTGG - Intergenic
981858898 4:149330521-149330543 ATACTCAGAAGTGGAATTGGTGG + Intergenic
981868670 4:149459930-149459952 ATACTCAGAAGTGGAATTGCTGG + Intergenic
982145448 4:152384161-152384183 ATACTCAGAAGTGGAAATGCTGG - Intronic
982297288 4:153842391-153842413 ATATGTAGAAGCAGAATTGCTGG + Intergenic
982346221 4:154363193-154363215 ATACTCAGAAGTAGACTTTCTGG - Intronic
982388944 4:154842810-154842832 CTACTCAGAAATGGAATTGCTGG - Intergenic
982400144 4:154957518-154957540 ATACTGAGGAGCAGAACTGCTGG + Intergenic
982428009 4:155289018-155289040 ATACTAAGCAGCACAATTGCTGG - Intergenic
982508362 4:156249273-156249295 TTACCCAGAAGTGGAATTGCTGG + Intergenic
982583842 4:157212284-157212306 ATACCCAGAAGTAGAATTTCTGG + Intronic
982998733 4:162384514-162384536 ATACCCAGTAGTAGAATTGCCGG - Intergenic
982999584 4:162397280-162397302 ATACCCAGAAACTGAATTGCTGG - Intergenic
983397700 4:167221937-167221959 ATACTCAGAAGTGGAATTGCTGG - Intronic
983655870 4:170083865-170083887 ATACTCAGCAGTGGAATTGCAGG - Intronic
983906775 4:173191386-173191408 CTAGACAGAAGCAGAAGGGCTGG - Intronic
984180510 4:176477126-176477148 ATACTCAGAAGTGGCATTGCAGG - Intergenic
984393988 4:179170713-179170735 ATACCGAGAAGCAGTATTGCTGG + Intergenic
984406665 4:179341443-179341465 ATACCCAGAAGTGGAATTGCTGG - Intergenic
984825744 4:183923136-183923158 ATACCCAGAAGTAGCATTGCTGG + Intronic
984934246 4:184876271-184876293 ATACTCAGAAGTAGGATTGCTGG - Intergenic
984955247 4:185038524-185038546 ATACCCAGAAGTGGAATTGCTGG + Intergenic
984955279 4:185038874-185038896 ATACCCAGAAGTGGAATTGCTGG - Intergenic
985084794 4:186301395-186301417 GTACCCAGGAGCAGAATTTCTGG + Intergenic
985178283 4:187227010-187227032 TTACCCAGAAGTGGAATTGCTGG - Intergenic
985710588 5:1426130-1426152 ATACCCAGAAGTTGAATTGCTGG - Intronic
985815011 5:2121016-2121038 ATACTCAGTAGTAGGATTGCTGG + Intergenic
986028060 5:3869392-3869414 TTCATCAGAAGTAGAATTGCTGG - Intergenic
986039593 5:3978862-3978884 CTACCCAGAAGTGGGATTGCTGG + Intergenic
986099867 5:4597583-4597605 ATACTCAGTAGTGGAATTGCTGG - Intergenic
986210859 5:5670663-5670685 ATACTCAGTAACAGAATTGCTGG + Intergenic
986263399 5:6168812-6168834 ATACCCAGAAGAAGGATTGCTGG - Intergenic
986288708 5:6380396-6380418 ATACTCAGAAGTAGGACTGCTGG - Intergenic
986299770 5:6468690-6468712 CTCCTAAGAAGTAGAATTGAAGG - Intronic
986624518 5:9711144-9711166 ATACTCAGAAGTGGGATTGCTGG - Intronic
986739173 5:10690792-10690814 TAACTCAGAAGTGGAATTGCTGG + Intronic
986789701 5:11147834-11147856 ATACCTAGAAGCAGAATTGATGG - Intronic
986816468 5:11417776-11417798 CTACATAGAAGCAAAATTCCTGG - Intronic
987119968 5:14757908-14757930 ATACCCAGAAGTGGAATTGCTGG - Intronic
987264854 5:16242714-16242736 GTACACAGAAGTAGAATTGCTGG - Intergenic
987303075 5:16614649-16614671 CTTCCCAGAAGTGGAATTGCTGG - Intronic
987380953 5:17285562-17285584 CTACCCAGAAGTGGGATTGCTGG - Intergenic
987429399 5:17813943-17813965 ATACCCAGAAGTAGAATTGCTGG + Intergenic
987439437 5:17938375-17938397 ATACCCAGTAGCAGGATTGCTGG - Intergenic
988315051 5:29614734-29614756 ATACTCAGAAATTGAATTGCTGG + Intergenic
988462015 5:31447983-31448005 ATACTTAGGAGTAGAATTGCTGG - Intronic
988596546 5:32597570-32597592 ATATTCAGAAGTAGGATTGCTGG + Intronic
988624372 5:32856632-32856654 TTACCCAGAAATAGAATTGCTGG + Intergenic
988782634 5:34537172-34537194 ATACTCAGAAATGGAATTGCTGG - Intergenic
989013491 5:36901456-36901478 ATACTCAGCAGTAGGATTGCTGG + Intronic
989034029 5:37150835-37150857 CTACTTAAAATCAGAATTTCAGG + Intronic
989546051 5:42674859-42674881 ATACCTAGGAGCAGAATTGCAGG + Intronic
990000927 5:50891807-50891829 ATACACAGAAGCAGGATTGCTGG - Intergenic
990113029 5:52351405-52351427 ATACTCAGAAACAGAATTGCTGG + Intergenic
990438921 5:55824224-55824246 ATACTCAGAAGTGGAATTGCTGG + Intergenic
990593536 5:57290774-57290796 ATACCCAGCAGTAGAATTGCTGG - Intergenic
990703828 5:58504602-58504624 TTACTCAGTAGCGGGATTGCTGG - Intergenic
990750351 5:59009205-59009227 ATACTTAGAAGTAGGATTGCTGG - Intronic
990767562 5:59203467-59203489 ATACCCAGAAGTAGAATTGCTGG - Intronic
990805425 5:59655049-59655071 ATACCTAGAAGTAGAATTGCTGG + Intronic
990830383 5:59949759-59949781 CTATACAGAAACAGATTTGCTGG - Intronic
990902479 5:60767523-60767545 ATACCCAGAAGCAGAATTGCTGG + Intronic
991026157 5:62032183-62032205 ACACTCAGTAACAGAATTGCTGG + Intergenic
991124725 5:63056420-63056442 ATACCCAGAAGTGGAATTGCTGG + Intergenic
991298974 5:65109339-65109361 ATACCTAGGAGCAGAATTGCTGG + Intergenic
991310850 5:65239982-65240004 ATACTTAGGAGTAGAATTGCTGG - Intronic
991357582 5:65785184-65785206 TTACTGAGATGTAGAATTGCTGG + Intronic
991373766 5:65944156-65944178 ATACACCGAAGCGGAATTGCTGG + Intronic
991423400 5:66465115-66465137 ATACCCAGAAGTGGAATTGCTGG - Intergenic
991438946 5:66625769-66625791 CTAACCAGAAGTAGAATTGCTGG - Intronic
991460552 5:66854111-66854133 CTCCCCAGTAGCAGGATTGCAGG + Intronic
991460917 5:66857417-66857439 ATGCCAAGAAGCAGAATTGCTGG + Intronic
991907630 5:71527774-71527796 ATACCCAGAAGTGGAATTGCTGG + Intronic
992062772 5:73072385-73072407 ATACCCAGAAGTAAAATTGCTGG - Intronic
992065801 5:73106787-73106809 ATACCCAGAAGTGGAATTGCTGG + Intergenic
992131982 5:73702552-73702574 ATACCTAGAAGTAGAATTGCTGG + Intronic
992343884 5:75856304-75856326 ATACCCAGAAGTAGGATTGCTGG + Intergenic
992648526 5:78834794-78834816 ATACTCAGAAGTGGGATTGCTGG + Intronic
992657759 5:78927639-78927661 CCAATCAGAGGCAGAATTGGTGG - Intronic
992707324 5:79409990-79410012 ATACCTAGAAGTAGAATTGCTGG - Intronic
992757320 5:79920183-79920205 ATACTGAGCAGTAGAATTGCTGG - Intergenic
992788920 5:80196509-80196531 ATATCTAGAAGCAGAATTGCTGG - Intronic
992800341 5:80289879-80289901 ATACTCAGAAGTGGAATTGTTGG - Intergenic
992949351 5:81842057-81842079 GTACCCAGAAGTGGAATTGCTGG + Intergenic
992973764 5:82090240-82090262 ATGCCCAGAAGCATAATTGCTGG - Intronic
992993961 5:82314489-82314511 ATAGCCAGAAGCAGAGTTGCTGG - Intronic
993065422 5:83091872-83091894 ATACTCAGAAGTGGGATTGCTGG + Intronic
993108133 5:83623389-83623411 ATACTCAGAAGAGGAATGGCTGG - Intergenic
993447739 5:88035104-88035126 GTACCCAGAAGTAGGATTGCTGG + Intergenic
993942806 5:94081320-94081342 ATACCCAGAAGTAGAATTGCTGG - Intronic
994032547 5:95161072-95161094 ATACCCAGAAGTAGGATTGCTGG - Intronic
994085724 5:95756521-95756543 ATACACAGAAGTGGAATTGCTGG + Intronic
994087880 5:95780174-95780196 CTAATTAGAAGGAAAATTGCTGG + Intronic
994282816 5:97926292-97926314 CTACCCAGTAGTAGGATTGCTGG + Intergenic
994334111 5:98543856-98543878 ATACCCAGAAGTGGAATTGCTGG - Intergenic
994577693 5:101600745-101600767 GTACTCAGTAGTAGGATTGCTGG - Intergenic
994647534 5:102489725-102489747 ATATCCAGTAGCAGAATTGCCGG - Intronic
994817682 5:104605072-104605094 CTACCCAGCAGTAGGATTGCTGG - Intergenic
995099670 5:108284165-108284187 ATGCCCAGTAGCAGAATTGCTGG - Intronic
995121460 5:108540396-108540418 ATACTCAGAAGTAGAATTACTGG - Intergenic
995194295 5:109346386-109346408 ATACCCAGAACTAGAATTGCTGG - Intronic
995213009 5:109561942-109561964 ATACCCAGTAGTAGAATTGCTGG + Intergenic
995382958 5:111555366-111555388 ATACCCAGAAGTAGAATTGCTGG + Intergenic
995626472 5:114082569-114082591 ATATCCAGAAGTAGAATTGCTGG - Intergenic
995635920 5:114190219-114190241 CTACCTAGAAGCAGAATGGCTGG - Intergenic
995700118 5:114926297-114926319 ATACCCAGAAGTGGAATTGCTGG - Intergenic
995755570 5:115500169-115500191 ATACCCAGCAGCAGGATTGCTGG + Intergenic
995935746 5:117511041-117511063 ATACCCAGAAGTGGAATTGCTGG - Intergenic
996049093 5:118911485-118911507 ATACCCAGAAGTAGGATTGCTGG - Intronic
996107968 5:119528679-119528701 CTATTCATCACCAGAATTGCAGG - Intronic
996160513 5:120156402-120156424 ATACTCAGAAGTGGGATTGCTGG + Intergenic
996208194 5:120769719-120769741 ATGCCCAGAAGCGGAATTGCTGG + Intergenic
996268079 5:121567523-121567545 ATATTCAGAATCAGAATTGTTGG - Intergenic
996402647 5:123079754-123079776 CTTCCCAGTAGTAGAATTGCTGG - Intergenic
996951399 5:129130371-129130393 ATACCCAGTAGTAGAATTGCTGG + Intergenic
996981790 5:129505037-129505059 ATACCCAGAAGTGGAATTGCTGG + Intronic
997082121 5:130752655-130752677 ATACCCAGAAGTGGAATTGCTGG - Intergenic
997188806 5:131910049-131910071 ATACTCAGCAGTAGGATTGCTGG - Intronic
997247434 5:132362195-132362217 ATACCCAGAAGTGGAATTGCTGG - Intergenic
997321181 5:132980063-132980085 ATACTCAGAAGTGGAATTTCTGG - Intergenic
997343426 5:133165590-133165612 ATCCTCAGAAATAGAATTGCTGG + Intergenic
997816548 5:137024741-137024763 ATACCCAGAAGTGGAATTGCTGG - Intronic
997833036 5:137168833-137168855 ATACCTAGAAGTAGAATTGCTGG - Intronic
997914565 5:137911482-137911504 ATACCCAGAAGTAGAATTGCTGG + Intronic
997959867 5:138312177-138312199 ATACCCAGAAGTAAAATTGCTGG - Intronic
998273544 5:140729274-140729296 ATACCCAGAAGTGGAATTGCTGG + Intergenic
998634901 5:143942528-143942550 ATACCCAGTAGCAGGATTGCTGG + Intergenic
998966797 5:147549931-147549953 ATACCCAGAAGTGGAATTGCTGG + Intergenic
999217764 5:149949997-149950019 ATATCCAGAAGCAGAACTGCTGG + Intergenic
999541541 5:152579632-152579654 ATACTCATTAGTAGAATTGCTGG + Intergenic
999555327 5:152735813-152735835 GTACCCAGAAGCTGGATTGCTGG + Intergenic
999669816 5:153949167-153949189 CTTCTGAGAAGTAGAAATGCTGG - Intergenic
999918659 5:156292612-156292634 ATACCCAGAAGTAGAATTGCTGG + Intronic
1000034977 5:157439515-157439537 GTACCCAGAAGTGGAATTGCTGG - Intronic
1000160881 5:158596654-158596676 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1000213649 5:159133882-159133904 ATACCCAGTAGCAGGATTGCTGG + Intergenic
1000719551 5:164690146-164690168 ATACCCAGAAGTAAAATTGCTGG - Intergenic
1001189660 5:169617306-169617328 ATACCCAGTAGCAGGATTGCTGG - Intergenic
1001417130 5:171553839-171553861 ATACCCAGTAACAGAATTGCTGG - Intergenic
1001635118 5:173204521-173204543 ATACCTAGAAGCGGAATTGCTGG + Intergenic
1002482415 5:179511607-179511629 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1002633053 5:180593729-180593751 CTGCTCAGAGGTAGAATGGCTGG + Intergenic
1002695227 5:181083786-181083808 CTACCTAGGAGCATAATTGCTGG - Intergenic
1002706890 5:181167164-181167186 ATACCCAGAAGTAGAATTTCTGG - Intergenic
1002791057 6:437979-438001 CTACCCAGAAGTGGAGTTGCTGG + Intergenic
1003043838 6:2714589-2714611 ATACTCAGAAGTGGAATTGCTGG - Intronic
1003054808 6:2808470-2808492 ATACACAGAAGAAGGATTGCTGG - Intergenic
1003091792 6:3110139-3110161 ATACTCAGAAACGGAATTGCTGG + Intronic
1003129623 6:3384731-3384753 ATACCCAGAAGTAGAAATGCTGG - Intronic
1003169123 6:3707057-3707079 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1003263659 6:4547894-4547916 ATACTCAGAAGTGGAATTACTGG - Intergenic
1003436584 6:6094659-6094681 ATACCTAGAAGTAGAATTGCTGG + Intergenic
1003568226 6:7238719-7238741 CTACTCAGAAGCACACAGGCCGG + Intronic
1003587599 6:7407146-7407168 ACACCCAGAAGTAGAATTGCTGG + Intronic
1003807408 6:9740869-9740891 ATACCCAGAAGTGGAATTGCTGG + Intronic
1004005726 6:11635729-11635751 CTACTCAGAGGCTGAGGTGCGGG + Intergenic
1004015162 6:11725661-11725683 GTACCCAGAAGTGGAATTGCTGG - Intronic
1004020551 6:11772229-11772251 GAACTCAGAAGCAGCATTTCAGG - Intronic
1004097079 6:12567178-12567200 ACACTCAGAAGTGGAATTGCTGG + Intergenic
1004153138 6:13140264-13140286 ATACCCAGAAGTGGAATTGCTGG - Intronic
1004218743 6:13726460-13726482 ATACCCAGGAGTAGAATTGCTGG - Intergenic
1004228240 6:13807639-13807661 ATACTTAGGAGTAGAATTGCTGG + Intronic
1004304807 6:14490328-14490350 ATACCTAGAAGCGGAATTGCTGG - Intergenic
1004469230 6:15914150-15914172 ATACCCAGAAGCAGAATGGCTGG - Intergenic
1004501741 6:16216186-16216208 ATACGCAGAAGTGGAATTGCTGG + Intergenic
1004808427 6:19230515-19230537 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1004928762 6:20441522-20441544 ATATCCAGAAGTAGAATTGCTGG + Intronic
1005227936 6:23664820-23664842 ATACCAAGAAGCACAATTGCTGG + Intergenic
1005330854 6:24748840-24748862 CTATTCAGAAGAAGGAATGCAGG - Intergenic
1005877527 6:30023690-30023712 GTACCCAGAAGAGGAATTGCTGG + Intergenic
1006351405 6:33523908-33523930 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1006383231 6:33713268-33713290 ATACCCAGAAGCGGAATTGCTGG + Intergenic
1006747363 6:36352828-36352850 ATACTTAGAAGCAGGATTGCTGG + Intergenic
1006821083 6:36895860-36895882 ATACCTAGAAGTAGAATTGCTGG + Intronic
1006959250 6:37911053-37911075 ATACGCAGAAGTGGAATTGCTGG + Intronic
1007194206 6:40046323-40046345 ATACCCAGAAGTAGAATTTCTGG - Intergenic
1007211892 6:40199175-40199197 ATACACAGCAGCAGAAATGCAGG - Intergenic
1007502368 6:42308097-42308119 ATACCTAGAAGCAGAATTCCTGG - Intronic
1007537818 6:42610316-42610338 ATACCTAGAAGCAAAATTGCTGG - Intronic
1007867540 6:44989515-44989537 ATACCCAGAAGCAGCATTGCTGG + Intronic
1008100315 6:47383724-47383746 ATACTCAGCAACAGGATTGCTGG + Intergenic
1008103465 6:47417584-47417606 ATACTCAGAAATGGAATTGCTGG + Intergenic
1008151924 6:47963464-47963486 GTACTCAGAAGTGGGATTGCTGG - Intronic
1008205063 6:48645188-48645210 ATACTCAGAAGTGTAATTGCTGG - Intergenic
1008257230 6:49318328-49318350 ATACCCAGTAGTAGAATTGCTGG - Intergenic
1008655441 6:53607806-53607828 ATATCCAGAAGTAGAATTGCTGG + Intronic
1008655961 6:53614194-53614216 CTACCCAGAAGCAGACTCCCTGG - Intronic
1008796329 6:55307850-55307872 ATACTCAAAAGTGGAATTGCTGG + Intergenic
1008934148 6:56971481-56971503 ATACCCAGGAGTAGAATTGCTGG + Intronic
1008977339 6:57443260-57443282 GTACCCAGAAGTAGGATTGCTGG + Intronic
1009165474 6:60336213-60336235 GTACCCAGAAGTAGGATTGCTGG + Intergenic
1009196287 6:60689816-60689838 ATACTCAAAAGCAGAATTGCTGG + Intergenic
1009344263 6:62594342-62594364 ATACTAAGAAGTGGAATTGCTGG - Intergenic
1009344712 6:62599144-62599166 ATACCCAGAAGCAGAATTGCTGG + Intergenic
1009620933 6:66076223-66076245 ATACCCAGTAGCAGAATTGCTGG + Intergenic
1009829910 6:68916980-68917002 ATTCTCAGCAGCAGAAATGCTGG + Intronic
1010468333 6:76195098-76195120 ATACACAGAAGTGGAATTGCTGG + Intergenic
1010606877 6:77901227-77901249 ATACTCAGTAGTAGAATTACTGG + Intronic
1010808288 6:80265183-80265205 ATACCCAGAAGTGGAATTGCTGG - Intronic
1010858289 6:80871359-80871381 CTATCCAGTAGCAGGATTGCTGG - Intergenic
1011091700 6:83610087-83610109 ATACCCAGAAGTGGAATTGCTGG - Intronic
1011190572 6:84723833-84723855 ATACCCAGAAGTAAAATTGCTGG + Intronic
1011210566 6:84951744-84951766 TTACTCAGAAATAGAATTGCTGG - Intergenic
1011259228 6:85454208-85454230 CTACCCAGGAGCAGAATTGCTGG + Intronic
1011571651 6:88743803-88743825 ATTTTCAGAAGCAGAATTGCTGG + Intronic
1011618882 6:89223559-89223581 ATACTCAGTAGCGGGATTGCTGG + Intronic
1011714108 6:90086346-90086368 ATACCCAGAAGTGGAATTGCTGG + Intronic
1011776143 6:90732847-90732869 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1011796378 6:90958062-90958084 GTTCTCAGAATTAGAATTGCTGG + Intergenic
1011923399 6:92611588-92611610 CTACACAGAAGTGGGATTGCTGG + Intergenic
1012256897 6:97043573-97043595 TTACCCAGAAGTGGAATTGCTGG + Intronic
1012577119 6:100816389-100816411 ATACCCAGTAGTAGAATTGCTGG - Intronic
1012748499 6:103125421-103125443 ATACTCAGTAGTAGGATTGCTGG + Intergenic
1012755564 6:103226364-103226386 ATACTCAGAAATAGGATTGCTGG - Intergenic
1012793206 6:103726760-103726782 ATACTCAGCAGCAGGATTGCTGG + Intergenic
1013020846 6:106216228-106216250 ATACTTAGGAGTAGAATTGCTGG - Intronic
1013036584 6:106390933-106390955 ATACTCAGAATTTGAATTGCTGG + Intergenic
1013047374 6:106500179-106500201 GTACCCAGAAGCAGGATTGCTGG + Intergenic
1013058429 6:106607959-106607981 ATACTCAGTAGTAGGATTGCTGG - Intronic
1013096651 6:106951611-106951633 ATACTCAGATGTGGAATTGCTGG - Intergenic
1013151426 6:107450052-107450074 ACACCCAGAAGCAGAATTGTTGG + Intronic
1013185398 6:107753311-107753333 ATACTCAGAAATGGAATTGCTGG - Intronic
1013197075 6:107853768-107853790 ATACTCAGAAGTAGAGTTGCTGG + Intergenic
1013252970 6:108353107-108353129 ATACTCAGAAGTGGAATTGCTGG + Intronic
1013273585 6:108562464-108562486 CTAGTCAGAAGCAGGTTTACTGG - Intronic
1013614422 6:111828388-111828410 ATACCCAGAAGTAGAATTGCTGG - Intronic
1013626846 6:111946569-111946591 ATACCCAGAGGTAGAATTGCTGG - Intergenic
1013930221 6:115521719-115521741 ATACTCAGTAATAGAATTGCTGG - Intergenic
1013985100 6:116182396-116182418 ATACTCAGGAGCAGGATTGCTGG + Intronic
1014047268 6:116905031-116905053 ATACCCAGAAGCGGAATTACTGG + Intronic
1014186362 6:118438872-118438894 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1014236025 6:118955871-118955893 ATACCTAGAAGTAGAATTGCTGG + Intergenic
1014327869 6:120021607-120021629 ATACTCAGAAGTGAAATTGCTGG - Intergenic
1014334293 6:120113078-120113100 ATCCTCAGAAGTGGAATTGCTGG - Intergenic
1014385457 6:120795656-120795678 ATACCCAGAAATAGAATTGCTGG + Intergenic
1014441719 6:121480941-121480963 CTGCTAAGAAGCAGATTTGGGGG - Intergenic
1014680587 6:124424918-124424940 ATACCCAGAAGAAGGATTGCTGG + Intronic
1014734032 6:125070365-125070387 ATATTCAGCAGCAGGATTGCTGG + Intronic
1014782690 6:125582998-125583020 CTACCCAGAAGTGGAATTACTGG + Intergenic
1014966679 6:127761882-127761904 AAACTCAGAAGTAGGATTGCTGG - Intronic
1015096789 6:129424835-129424857 ATACACAGAAGCAGAATGGCTGG - Intronic
1015148306 6:130012232-130012254 ATACTCAGAAGTAGTATTGCTGG - Intergenic
1015288819 6:131514661-131514683 ATACTCAGTAGTGGAATTGCTGG + Intergenic
1015301820 6:131661234-131661256 ATACTCAAAAGTGGAATTGCTGG + Intronic
1015438049 6:133213291-133213313 ATACCCAGAAATAGAATTGCTGG - Intergenic
1015464958 6:133538734-133538756 GTACCCAGAAGTGGAATTGCTGG + Intergenic
1015579907 6:134713176-134713198 CTACTTAGTAGCAGTATTTCTGG + Intergenic
1015887690 6:137935533-137935555 GTACTCAGAAGTGGGATTGCTGG + Intergenic
1016257972 6:142131979-142132001 CTTCTCAGAATCAGAATTTCAGG - Intergenic
1016524091 6:144980529-144980551 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1016670736 6:146703821-146703843 ACACTCAGAAGGAGGATTGCTGG + Intronic
1016707850 6:147134097-147134119 ATACTCAGAAGTAGGATTGCTGG - Intergenic
1017059260 6:150466379-150466401 CTACACATCAGCAGAATTGCTGG - Intergenic
1017209522 6:151839470-151839492 ATACCCAGAAGTAGAATTACTGG - Intronic
1017231083 6:152074606-152074628 ACACTCAGGAGCACAATTGCTGG + Intronic
1017319667 6:153075240-153075262 TTTATCAGAAGCAAAATTGCTGG - Intronic
1017585169 6:155912650-155912672 GTATTCAGGAGCAAAATTGCTGG + Intergenic
1017897772 6:158696039-158696061 ATACTCAGAAGTGGAATTACTGG + Intronic
1018965483 6:168484572-168484594 ATAATCAGAAGTGGAATTGCTGG - Intronic
1019736894 7:2654883-2654905 CTACTCAGCAGGAGAATCGCTGG - Intronic
1019761492 7:2816003-2816025 GTACTTAGACGCAGAGTTGCTGG - Intronic
1019899501 7:4008908-4008930 ATACTGAGAAGCAGAATTGCTGG + Intronic
1021436342 7:20620872-20620894 ATACTTAGATGTAGAATTGCTGG - Intronic
1021436707 7:20625778-20625800 ATACCCGGAAGTAGAATTGCTGG - Intronic
1021497142 7:21288468-21288490 ATACTCAGAAGAGGAATTGCTGG - Intergenic
1021545673 7:21810912-21810934 ATACTGAGAAGTAGAATTTCTGG - Intronic
1021608929 7:22437614-22437636 GTACACAGAAGTAGAATTGCTGG + Intronic
1021706545 7:23373679-23373701 ATACCCAGAAGTGGAATTGCTGG - Intronic
1021777261 7:24065983-24066005 ATACTCAGTAGCAGGATTGCTGG - Intergenic
1022080022 7:27011028-27011050 ATATCCAGAAGTAGAATTGCTGG + Intergenic
1022147588 7:27560814-27560836 ATACCCAGAAGTAAAATTGCTGG + Intronic
1022170498 7:27824132-27824154 ATACCCTGAAGTAGAATTGCTGG + Intronic
1022608346 7:31839697-31839719 ATACCTAGAAGCAGAATGGCTGG + Intronic
1022706217 7:32804440-32804462 ATTCCTAGAAGCAGAATTGCTGG - Intergenic
1022896503 7:34755135-34755157 GTAACTAGAAGCAGAATTGCTGG + Intronic
1022897499 7:34766332-34766354 ATACTCAGAAGTGGAATTGTTGG - Intronic
1022899882 7:34796805-34796827 ATACCCAGGAGCACAATTGCTGG - Intronic
1022916756 7:34963457-34963479 GTACCCAGAAGTGGAATTGCTGG - Intronic
1023072090 7:36445734-36445756 TTACCTAGTAGCAGAATTGCTGG + Intronic
1023197192 7:37654119-37654141 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1023409190 7:39871874-39871896 ATACTTAGAAGTGGAATTGCTGG + Intergenic
1023520159 7:41042127-41042149 ATACCCAGAAGCGGAATTTCTGG - Intergenic
1023544340 7:41301833-41301855 TTACTCAGTAGCAGGATTGCTGG + Intergenic
1023672700 7:42594924-42594946 ATACATAGAAGTAGAATTGCTGG - Intergenic
1023712032 7:43005283-43005305 GTACTCAGAAGTAGAATTGCTGG + Intergenic
1023930707 7:44704068-44704090 GTACTCAGAAGTGGAATTGCTGG + Intronic
1024136495 7:46414276-46414298 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1024369287 7:48561254-48561276 ATACCCAGAATCAGAATTGCTGG + Intronic
1024510549 7:50200882-50200904 ATACCGAGAAGCAGACTTGCTGG - Intergenic
1024680119 7:51677675-51677697 GTACTCAGAAGAATGATTGCTGG - Intergenic
1025043740 7:55672162-55672184 ATACTTAGAAGTGGAATTGCTGG - Intergenic
1025136664 7:56420676-56420698 ATACTTAGAAGTGGAATTGCTGG - Intergenic
1025195627 7:56930312-56930334 GTACCTAGAAGTAGAATTGCTGG + Intergenic
1025676323 7:63646627-63646649 GTACCTAGAAGTAGAATTGCTGG - Intergenic
1025918969 7:65892298-65892320 ATACCCAGTAGCAGGATTGCTGG + Intronic
1026220795 7:68395048-68395070 ATACTCAGTAGCTGGATTGCTGG - Intergenic
1026337663 7:69408680-69408702 ATACCCAGAAATAGAATTGCTGG - Intergenic
1026655281 7:72251168-72251190 CACATCAGAAGCAGAATTGAAGG - Intronic
1027529436 7:79312311-79312333 CTACTGAGACGAAGAATTGGAGG - Intronic
1027686511 7:81285506-81285528 ATACTCAGAAATAAAATTGCTGG - Intergenic
1027938032 7:84633907-84633929 ATACCCAGCAGCAGGATTGCTGG + Intergenic
1028210280 7:88065818-88065840 ATTCTTAGAAACAGAATTGCAGG + Intronic
1028358550 7:89938985-89939007 AAACTCAGAAGTAGAATTGCTGG + Intergenic
1028415578 7:90576940-90576962 GTACCCAGAAGTGGAATTGCTGG - Intronic
1028529208 7:91819495-91819517 ATACCCAGTAGTAGAATTGCTGG + Intronic
1028612769 7:92730893-92730915 ATACTCAGAAGTGGAATTGCTGG + Intronic
1028690829 7:93647645-93647667 ATACCTAGGAGCAGAATTGCTGG - Intronic
1028854323 7:95573634-95573656 ATACCTAGAAGCATAATTGCTGG + Intergenic
1028861187 7:95652482-95652504 ATACTTAGAAGTAGAATTGTGGG + Intergenic
1028864025 7:95687249-95687271 TTACACAAAAGCATAATTGCTGG - Intergenic
1028996207 7:97103035-97103057 ATACTCAGTAGTAGGATTGCTGG - Intergenic
1029087149 7:98020677-98020699 CTACCCAGAAGTGGAATTGCTGG + Intergenic
1029148133 7:98461273-98461295 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1029224584 7:99015819-99015841 CTACCCAGAAGTAGGCTTGCTGG + Intergenic
1029513556 7:101011899-101011921 ATACCCAGAAGTAGAATTGCTGG + Intronic
1029925951 7:104317110-104317132 ATACTCAGAAGTGGGATTGCTGG - Intergenic
1029937443 7:104441903-104441925 CTGCCCAGAAGTGGAATTGCTGG + Intronic
1030043789 7:105476322-105476344 ATACTGAGAAGTGGAATTGCTGG + Intronic
1030094225 7:105883614-105883636 CTACCCAGAAATAGAATTGCTGG + Intronic
1030241237 7:107327915-107327937 ATACCCAGAAGTGGAATTGCTGG - Intronic
1030261378 7:107568195-107568217 GTACCCAGATGTAGAATTGCTGG + Intronic
1030291984 7:107881855-107881877 ATACCCAGAAGAAGTATTGCTGG + Intergenic
1030491260 7:110237777-110237799 ATACCCAGAAGTAGTATTGCTGG - Intergenic
1030511088 7:110482681-110482703 GTACTTAGAAGTAGAATTGCTGG - Intergenic
1030731438 7:112994233-112994255 ATACTCAGAAGTGAAATTGCTGG - Intergenic
1030785552 7:113656740-113656762 ATACCCAGAAGCAGATTTGCAGG - Intergenic
1031243575 7:119277144-119277166 ATACTCAGCAGCAGGATTGCTGG + Intergenic
1031251916 7:119394610-119394632 ATACCCAGAAGCAGGATTGCTGG - Intergenic
1031263105 7:119548293-119548315 ATACTCAGAGGTAGAATTGCTGG - Intergenic
1031307558 7:120150520-120150542 ATACCCAGAAGAGGAATTGCTGG - Intergenic
1031383758 7:121120159-121120181 ATACCCAGAAGTGGAATTGCTGG + Intronic
1031493339 7:122416840-122416862 CTTCTCTGTAGCAGAATTTCAGG - Intronic
1031542778 7:123015442-123015464 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1031764122 7:125754559-125754581 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1031956826 7:127951047-127951069 ATACCCAGAAGCAGAATTGCTGG - Intronic
1032099858 7:128965579-128965601 ATACCCAGAGGTAGAATTGCTGG - Intronic
1032221315 7:129996508-129996530 ATACACAAAAGCAGAATTGCTGG + Intergenic
1032314091 7:130818173-130818195 ATACTTAGAAACGGAATTGCTGG + Intergenic
1032543439 7:132723249-132723271 ATACCCAGAAGTAGAATTGCAGG - Intronic
1032579666 7:133092461-133092483 GTACCCAGGAGTAGAATTGCTGG - Intergenic
1032624813 7:133580354-133580376 CTACTCAGAAGTGGAATTGTTGG + Intronic
1032962228 7:137049453-137049475 CTACTCAATTGAAGAATTGCTGG - Intergenic
1033170828 7:139082477-139082499 ATAATCAGAAGTAGAATTGCTGG - Intronic
1033260171 7:139837292-139837314 ATACCCAGTAGCGGAATTGCTGG - Intronic
1033381428 7:140823670-140823692 ATACACAGAAGGAGAATTGATGG + Intronic
1033415689 7:141159429-141159451 ATGCCCAGAAGTAGAATTGCTGG - Intronic
1033506256 7:142004172-142004194 ATACTCAGTAGTGGAATTGCTGG - Intronic
1033642405 7:143274369-143274391 ATACTCAGAAGTGGGATTGCTGG - Intergenic
1034031774 7:147774601-147774623 GTCCTCATAAGCAGAAATGCCGG + Intronic
1034119393 7:148613291-148613313 ATACCTAGAAGTAGAATTGCTGG - Intronic
1034388551 7:150763198-150763220 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1035152737 7:156888454-156888476 CAATTCAGAAGTAGAATTGCTGG - Intronic
1035594639 8:846644-846666 ATACCCAGTAGCAGGATTGCTGG + Intergenic
1036535248 8:9643751-9643773 ATACCCAGAAGCAGAATTGCCGG - Intronic
1036989121 8:13571718-13571740 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1037293531 8:17376447-17376469 ATACTTAGGAGCAGAATTGCTGG + Intronic
1037378033 8:18253007-18253029 ATACCCAGAAGCAGAACTACTGG - Intergenic
1037383008 8:18308370-18308392 TTACTCAGGAGTAGAATGGCTGG - Intergenic
1037383840 8:18316633-18316655 AAACTCAGAAGTAGAATTACCGG - Intergenic
1037408891 8:18573135-18573157 TTACTTAGGAGTAGAATTGCTGG - Intronic
1037508786 8:19560785-19560807 CAACCCAGAAGTGGAATTGCTGG - Intronic
1037523058 8:19698800-19698822 ATACTTAGAAGCAAAATTGCTGG - Intronic
1037558153 8:20046617-20046639 AGACACAGAAGTAGAATTGCTGG + Intergenic
1037650716 8:20835983-20836005 CTACTCAAGACCAGAGTTGCTGG - Intergenic
1038264499 8:26027599-26027621 ATACCCAGAAGTGGAATTGCTGG - Intronic
1038320568 8:26522361-26522383 CTGCCTAGAAGTAGAATTGCTGG + Intronic
1038366782 8:26944154-26944176 ATACCCAGTAGCAGGATTGCTGG + Intergenic
1038555438 8:28509943-28509965 GTAGTCAGAAGTGGAATTGCTGG + Intronic
1038621488 8:29147460-29147482 CTCCTGAGAAGCAGAACTGCCGG - Exonic
1039228849 8:35420571-35420593 CAACTCAGGAGCAGACTAGCAGG + Intronic
1039358483 8:36847821-36847843 ATACACAGTAGTAGAATTGCTGG + Intronic
1039581844 8:38673244-38673266 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1039643470 8:39251183-39251205 TTACTCAGTAGTAGAATTGCTGG + Intronic
1039860965 8:41457027-41457049 ATACCTAGAAGCGGAATTGCTGG + Intergenic
1039991112 8:42488556-42488578 ATACCCAGAAGTGGAATTGCTGG + Intronic
1040419647 8:47226856-47226878 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1040706214 8:50131697-50131719 ATACTCAGAAGTGGGATTGCTGG + Intronic
1040885385 8:52257293-52257315 CTACTTAGAAGAAGAATTGCTGG + Intronic
1041095823 8:54348668-54348690 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1041101935 8:54404861-54404883 ATTCTCAGAAGTGGAATTGCTGG - Intergenic
1041330909 8:56723713-56723735 TTCCTAAGAAACAGAATTGCTGG - Intergenic
1041339300 8:56825185-56825207 ATACTTAGAAGTGGAATTGCTGG - Intergenic
1041399755 8:57429496-57429518 ATACTCAGTAATAGAATTGCTGG + Intergenic
1041495619 8:58482448-58482470 ATACTCAGAAGTAGGATTGCTGG + Intergenic
1041593721 8:59621476-59621498 ATACCTAGAAGCAGAATTTCTGG + Intergenic
1041810838 8:61908175-61908197 TTACCCAGAAGTAGAATTGCTGG + Intergenic
1041845761 8:62326810-62326832 AAACTCAGAAGTGGAATTGCTGG + Intronic
1041902764 8:63000090-63000112 ATATCAAGAAGCAGAATTGCTGG - Intergenic
1042189456 8:66170778-66170800 ATACTCAGAAGTGGAATTGCAGG - Intronic
1042328173 8:67549997-67550019 ATACTCAGAAGTGAAATTGCTGG + Intronic
1042352383 8:67790401-67790423 GTACCCAGCAGAAGAATTGCTGG - Intergenic
1042463993 8:69105319-69105341 CTAATGAGTAGCAGAATTTCAGG - Intergenic
1042506666 8:69567847-69567869 ATACCCAGAAGTGGAATTGCTGG + Intronic
1042578881 8:70254349-70254371 ATACCCAGAAGTGGAATTGCAGG - Intronic
1042628145 8:70782935-70782957 ATACTCAGAAGTGGGATTGCTGG + Intronic
1042629779 8:70804164-70804186 TCACACAGAAGCAGAACTGCTGG + Intergenic
1042832341 8:73045036-73045058 GTACCCAGAAGTGGAATTGCTGG + Intronic
1042857368 8:73281092-73281114 ATTCCCAGAAGTAGAATTGCTGG - Intergenic
1043179611 8:77070717-77070739 ATAGCCAGAAGTAGAATTGCTGG + Intergenic
1043204792 8:77424570-77424592 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1043569340 8:81584656-81584678 GTACTCAGAAATGGAATTGCTGG + Intergenic
1043649616 8:82575150-82575172 CTGCTCAGAACCAGACATGCTGG - Intergenic
1043681963 8:83039593-83039615 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1043696673 8:83228084-83228106 ATACTCAAGAGCAGAATTGCTGG + Intergenic
1043708803 8:83387163-83387185 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1043828483 8:84959067-84959089 ATATCCAAAAGCAGAATTGCTGG - Intergenic
1043842226 8:85120961-85120983 ATCCCCAGAAGTAGAATTGCTGG + Intronic
1044022427 8:87122077-87122099 ATACTCAGAAGTAGAATTACTGG + Intronic
1044134215 8:88564243-88564265 ATACCTAGAAGCAGAACTGCTGG - Intergenic
1044269042 8:90218658-90218680 ACACCCAGAAACAGAATTGCTGG + Intergenic
1044471710 8:92577476-92577498 ATACCCAGGAGCAGAATTGCTGG + Intergenic
1044638618 8:94354698-94354720 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1044689144 8:94859597-94859619 TTACTCTGAAGCAAAAATGCAGG - Exonic
1044816923 8:96122997-96123019 ATACTCAGAAGCAGAATTGCTGG + Intergenic
1044886723 8:96786538-96786560 ATACCAAGAAGTAGAATTGCTGG + Intronic
1045004481 8:97906047-97906069 ATACTAAGGAGTAGAATTGCTGG + Intronic
1045014049 8:97983381-97983403 ATACCCAGAAGTGGAATTGCTGG + Intronic
1045072455 8:98523052-98523074 ATACCCAGAGGTAGAATTGCTGG + Intronic
1045074537 8:98549119-98549141 CTACCTAGAAGTACAATTGCTGG + Intronic
1045085177 8:98675528-98675550 ATACCCAGAAGTGGAATTGCTGG - Intronic
1045122605 8:99054186-99054208 ATACTGAGAAGTAGAATTGCTGG + Intronic
1045138918 8:99256407-99256429 ATACTTAGAAGTACAATTGCTGG + Intronic
1045633676 8:104157831-104157853 ATACCCAGAAGTGGAATTGCTGG + Intronic
1045672426 8:104571196-104571218 ATACTTAGGAGAAGAATTGCTGG - Intronic
1045701944 8:104876916-104876938 ATACCCATAAGTAGAATTGCTGG + Intronic
1045915924 8:107471027-107471049 CTACCCAGTAATAGAATTGCTGG - Intronic
1046032658 8:108802481-108802503 TTACCCAGAAGTGGAATTGCTGG - Intergenic
1046079204 8:109350471-109350493 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1046155816 8:110288976-110288998 TTACTCAGGAGTACAATTGCTGG - Intergenic
1046194768 8:110847060-110847082 ATACCCAGCAGTAGAATTGCTGG - Intergenic
1046457635 8:114487790-114487812 ATACCCAGTAGCAGGATTGCTGG - Intergenic
1046498674 8:115046841-115046863 ATACCCAGTAGCAGGATTGCAGG - Intergenic
1046627840 8:116594155-116594177 ATTCTCAGAAAGAGAATTGCTGG + Intergenic
1046656523 8:116900543-116900565 ATACTCAGTATTAGAATTGCTGG - Intergenic
1046726700 8:117682750-117682772 ATATGCAGAAGTAGAATTGCTGG - Intergenic
1046981768 8:120344207-120344229 CTACTCAGAGGCTGTATTTCTGG + Intronic
1047059707 8:121211097-121211119 ATACCCAGTAGCAGGATTGCTGG + Intergenic
1047560251 8:125979607-125979629 ATACTCAGTAGTAGAATTGCTGG - Intergenic
1047856921 8:128920521-128920543 ATTCCCAGAAGTAGAATTGCTGG - Intergenic
1047947591 8:129897601-129897623 CTACTCAGAAGCTAAATTCTTGG - Intronic
1048002517 8:130390907-130390929 ATACCCAGAAGTGGAATTGCTGG - Intronic
1048011575 8:130461148-130461170 ATACTCAGAAGTGGGATTGCTGG - Intergenic
1048022359 8:130551134-130551156 AGACCCAGAAGAAGAATTGCTGG + Intergenic
1048188769 8:132268741-132268763 ATACTGAGGAGCACAATTGCTGG + Intronic
1048585975 8:135774349-135774371 ATACTCAGTAGTGGAATTGCTGG - Intergenic
1049033622 8:140057317-140057339 ATACCCATAAACAGAATTGCTGG - Intronic
1049940602 9:542540-542562 ATACCCAGAAGTAGGATTGCTGG - Intronic
1049953107 9:664686-664708 ATACTCAGTAGTGGAATTGCTGG + Intronic
1050219806 9:3374305-3374327 ATACTGAGAAGCGGAATTGCTGG - Intronic
1050323384 9:4477043-4477065 ATACCCAGAAGCATAATTACTGG - Intergenic
1050383557 9:5058564-5058586 ATACCTAGAAGTAGAATTGCTGG + Intronic
1050390606 9:5139756-5139778 CTAATCAGAATCAGAAGAGCTGG - Intronic
1050429868 9:5551512-5551534 CTACTCAGACAAAGAATTTCAGG + Intronic
1050890935 9:10823750-10823772 CTTCTCAGAAGGAGAACTGATGG - Intergenic
1051319520 9:15886595-15886617 ATACCCAGAAGTAGGATTGCTGG - Intronic
1051368893 9:16341548-16341570 GTCCCTAGAAGCAGAATTGCTGG + Intergenic
1051508833 9:17855085-17855107 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1051600927 9:18872851-18872873 ATACCCAGTAGCAGGATTGCTGG + Intronic
1051809188 9:21031222-21031244 TTTCTCAGACGCAGAGTTGCGGG - Intronic
1051832156 9:21291709-21291731 ATACTCAGAAGTGGAATTGCTGG - Intergenic
1051869329 9:21718417-21718439 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1052132988 9:24872937-24872959 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1052511747 9:29431031-29431053 ATACCCAGAAGAGGAATTGCTGG + Intergenic
1052530125 9:29672394-29672416 ATACTCAGTAACGGAATTGCTGG + Intergenic
1052530502 9:29677831-29677853 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1052594280 9:30538279-30538301 ATACACAGTAGCAGAATTGCGGG + Intergenic
1052628922 9:31011912-31011934 CTACTCAGATGCAGAAGAACTGG + Intergenic
1052715685 9:32114198-32114220 GTAGCCAGAAGCAGAATTTCTGG - Intergenic
1052779514 9:32766304-32766326 ATACTTAGGAGCAGAATTTCTGG + Intergenic
1052926165 9:34018488-34018510 CTACCCAGAATTGGAATTGCTGG - Intronic
1053086579 9:35228938-35228960 AGATTCAGAAGTAGAATTGCTGG + Intronic
1053119295 9:35533970-35533992 ATACCTAGAAGCAGAATTGCTGG + Intronic
1053254213 9:36602081-36602103 ATATTCAGAAGCGGAGTTGCTGG + Intronic
1053262386 9:36679741-36679763 ATACCTAGGAGCAGAATTGCTGG + Intergenic
1053427434 9:38019719-38019741 ATACTGAGAAGTAAAATTGCTGG - Intronic
1053728922 9:41032778-41032800 GTATTCAGAAGCAGAATTATTGG - Intergenic
1054699590 9:68399305-68399327 GTATTCAGAAGCAGAATTATTGG + Intronic
1054708494 9:68486784-68486806 ATACTTAGGAGCGGAATTGCTGG + Intronic
1054729668 9:68688421-68688443 CTATCTAGAAGTAGAATTGCAGG - Intergenic
1054933565 9:70662871-70662893 ATACCCAGTAGCAGGATTGCTGG - Intronic
1055006333 9:71511569-71511591 GTACTCAGTAGTGGAATTGCTGG - Intergenic
1055154709 9:73046144-73046166 ATGCTAAGAAGCAGAATTTCTGG + Intronic
1055211582 9:73801343-73801365 ATACCCAGAAGCAGAATTGCTGG - Intergenic
1055531341 9:77187241-77187263 ATACCCAGAAGCAGAATTACTGG + Intronic
1055536585 9:77252990-77253012 ATACTCAGAAGTAGAATTGCTGG + Intronic
1055984487 9:82042723-82042745 ATACCCAGAAGCAAGATTGCTGG + Intergenic
1056145715 9:83727015-83727037 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1056462351 9:86820054-86820076 ATACATAGAAGTAGAATTGCTGG + Intergenic
1056713520 9:89010326-89010348 CTACTCAGAGGCAGCCTTGGAGG + Intergenic
1056774876 9:89504302-89504324 CTATCCAGAAGAGGAATTGCTGG - Intergenic
1056825763 9:89875303-89875325 CTAAGAAGAAGCAGCATTGCAGG - Intergenic
1056962172 9:91135158-91135180 ATACCCAGAAGTCGAATTGCTGG - Intergenic
1056984431 9:91348377-91348399 ATAGTCAGAAGTAGAATTACTGG - Intronic
1056993124 9:91429221-91429243 CAACTCAGAAGCTGAAATTCTGG + Intergenic
1057080914 9:92173920-92173942 CTACTGAGAAGCACATGTGCAGG - Intergenic
1057246266 9:93457253-93457275 ATACTCAGAAGTAGGATTGCTGG + Intronic
1057358449 9:94351477-94351499 ACACCCAGAAGTAGAATTGCTGG + Intergenic
1057426876 9:94958401-94958423 ATACCCAGAAGTGGAATTGCTGG + Intronic
1057582963 9:96303752-96303774 CACCCTAGAAGCAGAATTGCTGG + Intergenic
1057649301 9:96906133-96906155 ACACCCAGAAGTAGAATTGCTGG - Intronic
1057705070 9:97390182-97390204 CTAATTTGAAGCAGAACTGCTGG + Intergenic
1057707874 9:97410572-97410594 ATACCCAGGAGCAGAATTGCTGG + Intergenic
1057963819 9:99483384-99483406 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1058030041 9:100186053-100186075 ATACCCAGTAGTAGAATTGCTGG + Intronic
1058165474 9:101614241-101614263 GGACTCAGGAACAGAATTGCTGG - Intronic
1058395457 9:104548219-104548241 TTACTCAGAAGTGGGATTGCTGG - Intergenic
1058456690 9:105144331-105144353 ATACTCAGAAGTAGAATTGCTGG - Intergenic
1058465014 9:105218284-105218306 CTACCCAGCAGGAGAATCGCTGG + Intergenic
1058771209 9:108234167-108234189 ATACCCAGTAGCAGGATTGCTGG - Intergenic
1058804040 9:108572952-108572974 AGTCTTAGAAGCAGAATTGCTGG - Intergenic
1059036547 9:110760191-110760213 ATACTCAGTAGCGGAATTGCTGG - Intronic
1059071159 9:111137638-111137660 ATACCTAGGAGCAGAATTGCTGG - Intergenic
1059085498 9:111297776-111297798 ATACTCAGAAGTGGAATTGCTGG + Intergenic
1059213341 9:112535592-112535614 ATGCCCAGAAGTAGAATTGCTGG + Intronic
1060133363 9:121127330-121127352 ATGCTCAGAAGCAGAACTGTGGG + Intronic
1060473684 9:123969571-123969593 GTACTCAAAAGTGGAATTGCTGG + Intergenic
1060529110 9:124337753-124337775 CTACCTAGGAGCGGAATTGCTGG + Intronic
1060699052 9:125734822-125734844 ATACCCAGAAGTAGAATTGCTGG - Intergenic
1060770857 9:126331116-126331138 ATACCCAGAAGTGGAATTGCTGG + Intronic
1061530476 9:131208204-131208226 CTACCCCAGAGCAGAATTGCTGG - Intronic
1061611953 9:131752863-131752885 ATACACAGAAGTAGAATTACTGG + Intergenic
1061640029 9:131946259-131946281 ATACCCAGTAGCAGAATTGCTGG + Intronic
1062159613 9:135073084-135073106 GTACTCAGAAGTGGAATTGCTGG + Intergenic
1062685312 9:137809677-137809699 ATCCTCAGAGGCAGGATTGCTGG - Intronic
1185749012 X:2595449-2595471 GTGCCCAGAAGCAGAATTGCTGG - Intergenic
1185895030 X:3850499-3850521 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1185900148 X:3888924-3888946 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1185905264 X:3927352-3927374 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1186195191 X:7104027-7104049 ATACCCAGAAGTGGAATTGCTGG - Intronic
1186226203 X:7401576-7401598 ATACTCAGTAACAGGATTGCTGG - Intergenic
1186373807 X:8976017-8976039 ATACTCAGAAGTGGAATTACTGG - Intergenic
1186557252 X:10572927-10572949 CTAATAAGTAGCAGAACTGCAGG - Intronic
1186680917 X:11873013-11873035 ATACCTAGAAGTAGAATTGCTGG - Intergenic
1186946149 X:14569735-14569757 ATACTAAGAAGTGGAATTGCTGG - Intronic
1186996306 X:15126964-15126986 ATACTCAGAAGTAGGATTACTGG + Intergenic
1187000965 X:15177309-15177331 ATACTTAGAAGTAGAATTTCTGG + Intergenic
1187119477 X:16390340-16390362 CTAAAAAGGAGCAGAATTGCTGG - Intergenic
1187365666 X:18664038-18664060 CTACTTAGGAGTGGAATTGCTGG - Intronic
1187477658 X:19626287-19626309 CTACAAAGAAGCAAAATTCCTGG + Intronic
1187654604 X:21456725-21456747 ATACTCAGAAGTGGGATTGCTGG + Intronic
1187671308 X:21668516-21668538 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1187928485 X:24272353-24272375 ATACGTAGGAGCAGAATTGCTGG - Intergenic
1187961355 X:24569426-24569448 ATACTGAGAAATAGAATTGCTGG - Intronic
1188064501 X:25641951-25641973 ATACCCAGTAGTAGAATTGCTGG + Intergenic
1188065397 X:25653084-25653106 ATACCCAGAAGAGGAATTGCTGG + Intergenic
1188086999 X:25911550-25911572 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1188103588 X:26121146-26121168 CTATTCAGAAAGAGAATTGAAGG + Intergenic
1188176618 X:26998726-26998748 TTACTCAGTAGTAGGATTGCTGG - Intergenic
1188875087 X:35419630-35419652 ATACGCAGAAGTAGAATTGTCGG + Intergenic
1188899859 X:35717474-35717496 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1188902941 X:35757436-35757458 ATACTCAGTAGTAGAATTTCTGG + Intergenic
1188990178 X:36809289-36809311 GTACCCAGAAGTAGAATTGCTGG + Intergenic
1188991398 X:36824996-36825018 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1189073783 X:37894306-37894328 ATACTCAGGAGTAGAATTGTTGG + Intronic
1189131399 X:38501589-38501611 CTACCCAGAAGTGGGATTGCTGG - Intronic
1189229097 X:39438202-39438224 CTACTGAGAGGCAGAATAGGAGG - Intergenic
1189254589 X:39627965-39627987 ATGCCCAGAAGCAGGATTGCTGG - Intergenic
1189405275 X:40716639-40716661 ATACTCAGCAGTGGAATTGCTGG - Intronic
1189425169 X:40893577-40893599 ATACCCAGAAGTAGAATTGCTGG + Intergenic
1189441715 X:41042156-41042178 ATACCCAGCAGCAGGATTGCTGG - Intergenic
1189662810 X:43321015-43321037 ATACCCAGTAGCAGGATTGCTGG + Intergenic
1189870573 X:45378704-45378726 ATTCTCAGAAGTGGAATTGCTGG - Intergenic
1189873738 X:45412247-45412269 ATACTCAGCAGTGGAATTGCTGG + Intergenic
1189914670 X:45844952-45844974 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1190531359 X:51380847-51380869 ATACCCAGAAGTAAAATTGCAGG - Intergenic
1190803922 X:53817214-53817236 ATGCCCAGAAGCAGGATTGCTGG + Intergenic
1190905633 X:54724585-54724607 ATACCCAGTAACAGAATTGCTGG + Intergenic
1190994184 X:55589223-55589245 ATACTCAGAAGTAGCATTGCTGG - Intergenic
1191130320 X:57001101-57001123 ATACTGAGAAGTAGAATTACTGG + Intergenic
1191590403 X:62876991-62877013 ATACTTAGAAGTTGAATTGCTGG + Intergenic
1191725363 X:64274542-64274564 CTACCCAGAAGTGGGATTGCTGG - Intronic
1191777469 X:64831619-64831641 ATACTCAGAAGTGGGATTGCTGG + Intergenic
1191989837 X:67022646-67022668 GTACCCAGAAGTAGAATTGCTGG + Intergenic
1192062419 X:67841852-67841874 ATACTCAGCAGTGGAATTGCTGG - Intergenic
1192617103 X:72637561-72637583 ATACTCAGAAGTGTAATTGCTGG + Intronic
1192659921 X:73031305-73031327 ATAGCCAGAAGCAGACTTGCTGG + Intergenic
1192722648 X:73715983-73716005 ATACCCAGTAGTAGAATTGCTGG + Intergenic
1192725417 X:73746091-73746113 ATACTCAGCAGAGGAATTGCTGG + Intergenic
1192805798 X:74507503-74507525 ATACTCAGTAGCAGGGTTGCTGG - Intronic
1192819769 X:74632476-74632498 CGACTCAGGAACAAAATTGCTGG + Intergenic
1192906211 X:75553947-75553969 GTACCCAGAAGAGGAATTGCTGG + Intergenic
1192985009 X:76388755-76388777 ATACCCAGTAGTAGAATTGCTGG + Intergenic
1193181472 X:78463054-78463076 ATACCCAGAAGCGGAATTTCTGG + Intergenic
1193268435 X:79500914-79500936 ATACTCAGTAGTGGAATTGCTGG - Intergenic
1193397859 X:81006631-81006653 ATACTCAGTAGTGGAATTGCTGG + Intergenic
1193460346 X:81784153-81784175 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1193548099 X:82853579-82853601 ATACTCAGAAGAGGAAGTGCTGG - Intergenic
1193633051 X:83913049-83913071 CTACCCAGAAGTGGGATTGCTGG - Intergenic
1193704157 X:84800600-84800622 ATACTCAGCAGTAGGATTGCTGG + Intergenic
1193784921 X:85749163-85749185 CTACCCAGTAGTGGAATTGCTGG + Intergenic
1193963822 X:87958673-87958695 ATACTCAGTAGTAGAATTACTGG - Intergenic
1194035988 X:88872852-88872874 ATACTCAGAAGTAAAGTTGCTGG - Intergenic
1194124579 X:89999494-89999516 ATACTAAGGAGCAGAATTTCTGG + Intergenic
1194329626 X:92565264-92565286 GTACCCAGCAGTAGAATTGCTGG - Intronic
1194336190 X:92649551-92649573 ATACTCAGTAGCGGAATTGCTGG - Intergenic
1194395792 X:93384106-93384128 ATACCCAGCAGTAGAATTGCTGG - Intergenic
1194517204 X:94869720-94869742 GTACCCAGAAGTGGAATTGCTGG - Intergenic
1194547255 X:95252540-95252562 ATACTCAGTAGTAGGATTGCTGG + Intergenic
1194791111 X:98150975-98150997 ATACCCAGAAGTAGAATTTCTGG + Intergenic
1194929810 X:99873109-99873131 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1194931484 X:99893086-99893108 GTACTCAGAAGTAGGATTGTTGG - Intergenic
1194956082 X:100182310-100182332 ATACCCAGTAGCAGGATTGCTGG - Intergenic
1195097598 X:101519681-101519703 ATATACAGAAGTAGAATTGCTGG + Intronic
1195259622 X:103119190-103119212 GTACCCAGTAGCAGGATTGCTGG + Intergenic
1195263575 X:103158211-103158233 GTGCTCAGAGTCAGAATTGCAGG + Intergenic
1195282445 X:103348970-103348992 CCACTCACAAGCAGAACAGCAGG + Intergenic
1195431224 X:104791559-104791581 CTACTCAGAATCAGAACACCAGG + Intronic
1195501091 X:105600763-105600785 CTACTAAGAAGTAGAATTGCTGG + Intronic
1195635579 X:107111523-107111545 ATACTCAGAAATGGAATTGCTGG - Intronic
1195805464 X:108760788-108760810 CTACCTAGAAGTGGAATTGCTGG + Intergenic
1195935482 X:110121697-110121719 GTACCTAGAAGTAGAATTGCTGG + Intronic
1196121151 X:112052134-112052156 ATACTCAGAAGCAAAACTGCTGG + Intronic
1196290235 X:113931825-113931847 AAACCCAGAAGGAGAATTGCTGG + Intergenic
1196317567 X:114246936-114246958 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1196324494 X:114386717-114386739 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1196357145 X:114808477-114808499 CTACTCAGCAGTGGGATTGCTGG + Intronic
1196523170 X:116697710-116697732 ATACCCAGAAGTGGAATTGCTGG + Intergenic
1196676306 X:118424110-118424132 ATACCCAGAAGTGGAATTGCAGG + Intronic
1196727152 X:118906054-118906076 ATACCCAGAAGCAGGATTGCTGG + Intergenic
1196913342 X:120506588-120506610 ATACCCAGCAGCAGAATTGCTGG + Intergenic
1196943417 X:120799928-120799950 ATACTCAGAAGTAGAATTGCTGG - Intergenic
1196977263 X:121173613-121173635 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1197062802 X:122201531-122201553 ATACCAAGAAGCAGGATTGCTGG - Intergenic
1197071349 X:122301665-122301687 ATACCAAGAAGCATAATTGCTGG + Intergenic
1197144384 X:123155217-123155239 ATTCTCAGAAGTAGGATTGCTGG - Intergenic
1197197796 X:123720541-123720563 GTACTCAGAAGTAGGAATGCTGG - Intronic
1197235068 X:124052684-124052706 ATACCCAGAAGTGGAATTGCTGG + Intronic
1197398107 X:125952756-125952778 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1197564902 X:128070979-128071001 ATACTCAGCAGTGGAATTGCTGG + Intergenic
1197646235 X:129020431-129020453 ATACTCAGAAGTGGGATTGCTGG - Intergenic
1197651316 X:129067849-129067871 ATACACAGAAGTGGAATTGCTGG - Intergenic
1198027795 X:132725641-132725663 ATACTCAGCAGTGGAATTGCTGG - Intronic
1198083156 X:133258479-133258501 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1198123482 X:133619313-133619335 ATACCTAGGAGCAGAATTGCTGG - Intronic
1198367545 X:135957075-135957097 ATACCGAGGAGCAGAATTGCTGG - Intergenic
1198505078 X:137293539-137293561 ATACCCAGAAGCTGGATTGCTGG + Intergenic
1198623169 X:138536405-138536427 ATACTCAGCAGTAGGATTGCTGG - Intergenic
1198724491 X:139663154-139663176 ATACCCAGTAGCAGGATTGCTGG + Intronic
1198874806 X:141212534-141212556 ATACCCAGAAATAGAATTGCTGG - Intergenic
1198931034 X:141860428-141860450 ATACTCAGAAGTAGAATTACTGG - Intronic
1198994865 X:142562818-142562840 ATAACCAGAAGCAGGATTGCTGG + Intergenic
1199073626 X:143506463-143506485 CTACCCAGAAGAAGGATTGCTGG - Intergenic
1199092649 X:143709911-143709933 CTACCCAGAAGAAGGATTGCTGG - Intergenic
1199179213 X:144833919-144833941 ATACCCAGAAGTAGGATTGCTGG - Intergenic
1199288417 X:146079130-146079152 ATACCCAAAAGTAGAATTGCTGG - Intergenic
1199346914 X:146751888-146751910 GTACTCAGAAGTGAAATTGCTGG - Intergenic
1199351474 X:146806599-146806621 ATACCCAGAAGAGGAATTGCTGG - Intergenic
1199352433 X:146817894-146817916 ATACCCAGAAGAGGAATTGCTGG + Intergenic
1199568347 X:149241895-149241917 ATACTCAGAAGAAGGATTGATGG - Intergenic
1199795168 X:151188424-151188446 ATACTCAGAAGTAGAATTGCTGG + Intergenic
1199937732 X:152592328-152592350 CCCTACAGAAGCAGAATTGCTGG + Intergenic
1199964104 X:152804637-152804659 ATACTTAGAAGTAGAATTTCTGG - Intergenic
1200048510 X:153415609-153415631 ATACCCAGAAGTGGAATTGCCGG + Intergenic
1200184314 X:154171962-154171984 ATAATCAGGAGTAGAATTGCTGG - Intergenic
1200189966 X:154209095-154209117 ATAATCAGGAGTAGAATTGCTGG - Intergenic
1200195719 X:154246904-154246926 ATAATCAGGAGTAGAATTGCTGG - Intergenic
1200201373 X:154284020-154284042 ATAATCAGGAGTAGAATTGCTGG - Intronic
1200224022 X:154406918-154406940 ATACCCAGAAGTGGAATTGCTGG + Intronic
1200307681 X:155044839-155044861 ATACTCAGAAGAGGAATTGCTGG - Intronic
1200313766 X:155108441-155108463 GTACACAGAAGTGGAATTGCTGG + Intronic
1200319481 X:155171841-155171863 ATACCCAGAAGTAGGATTGCTGG + Intergenic
1200363850 X:155639723-155639745 ATACTCAGAAGTGGGATTGCTGG + Intronic
1200638327 Y:5684456-5684478 GTACCCAGCAGTAGAATTGCTGG - Intronic
1200644622 Y:5766298-5766320 ATACTCAGTAGCGGAATTGCTGG - Intergenic
1201348587 Y:13013216-13013238 GTACCCAGAAGTAGAATTACTGG + Intergenic
1201382993 Y:13404898-13404920 ATACCCAGTAGCTGAATTGCTGG - Intronic
1201567291 Y:15379761-15379783 ATACCCAGAAGTGGAATTGCTGG - Intergenic
1201909782 Y:19122162-19122184 CTACTCAAGAGTGGAATTGCTGG - Intergenic
1201917704 Y:19199963-19199985 GTACCCAGAAGTGGAATTGCTGG - Intergenic
1202050039 Y:20771133-20771155 ATACTCAGAAGTGGGATTGCTGG + Intronic