ID: 950197627

View in Genome Browser
Species Human (GRCh38)
Location 3:11020298-11020320
Sequence CCAGAACTCCACCACAGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 218}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950197627_950197631 -10 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197631 3:11020311-11020333 GGAGTTCTGGGAGTGAGTATGGG 0: 1
1: 0
2: 1
3: 16
4: 183
950197627_950197634 0 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197634 3:11020321-11020343 GAGTGAGTATGGGGCCATCAGGG 0: 1
1: 0
2: 0
3: 16
4: 131
950197627_950197641 15 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197641 3:11020336-11020358 CATCAGGGGATGGCAGGGACGGG 0: 1
1: 0
2: 4
3: 42
4: 383
950197627_950197638 10 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197638 3:11020331-11020353 GGGGCCATCAGGGGATGGCAGGG 0: 1
1: 1
2: 1
3: 32
4: 352
950197627_950197632 -9 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197632 3:11020312-11020334 GAGTTCTGGGAGTGAGTATGGGG 0: 1
1: 0
2: 2
3: 19
4: 267
950197627_950197637 9 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197637 3:11020330-11020352 TGGGGCCATCAGGGGATGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 296
950197627_950197636 5 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197636 3:11020326-11020348 AGTATGGGGCCATCAGGGGATGG 0: 1
1: 0
2: 1
3: 16
4: 175
950197627_950197633 -1 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197633 3:11020320-11020342 GGAGTGAGTATGGGGCCATCAGG 0: 1
1: 0
2: 0
3: 12
4: 135
950197627_950197635 1 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197635 3:11020322-11020344 AGTGAGTATGGGGCCATCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 129
950197627_950197640 14 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197640 3:11020335-11020357 CCATCAGGGGATGGCAGGGACGG 0: 1
1: 0
2: 6
3: 56
4: 463
950197627_950197642 16 Left 950197627 3:11020298-11020320 CCAGCGCTGTGGTGGAGTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 950197642 3:11020337-11020359 ATCAGGGGATGGCAGGGACGGGG 0: 1
1: 0
2: 0
3: 25
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950197627 Original CRISPR CCAGAACTCCACCACAGCGC TGG (reversed) Exonic
900517549 1:3090185-3090207 CCCGAACGCCACCACGGGGCTGG + Intronic
900660332 1:3778900-3778922 CCAGAACTCCAGCAGAGTCCTGG + Exonic
900853628 1:5163257-5163279 CCGGCACTCCAGCACAGGGCGGG - Intergenic
901843164 1:11966274-11966296 CCAGAACTACACCAAAGCCCTGG + Exonic
909904550 1:81178776-81178798 CGAGAAATCGAGCACAGCGCTGG + Intergenic
910034751 1:82776950-82776972 CAAGAAATCGAGCACAGCGCCGG + Intergenic
912315945 1:108667667-108667689 CGAGAAATCGAGCACAGCGCCGG - Intergenic
913647328 1:120871008-120871030 CCAGCCCCCCACCACAGAGCAGG + Intergenic
914079316 1:144391852-144391874 CCAGCCCCCCACCACAGAGCAGG - Intergenic
914099863 1:144574650-144574672 CCAGCCCCCCACCACAGAGCAGG + Intergenic
914174217 1:145260399-145260421 CCAGCCCCCCACCACAGAGCAGG - Intergenic
914203420 1:145506039-145506061 CGAGAAATCGAGCACAGCGCCGG + Intergenic
914482542 1:148079193-148079215 CGAGAAATCGAGCACAGCGCCGG + Intergenic
914528881 1:148501583-148501605 CCAGCCCCCCACCACAGAGCAGG - Intergenic
914637512 1:149565525-149565547 CCAGCCCCCCACCACAGAGCAGG + Intergenic
915699870 1:157781777-157781799 ACAGAGCTCCACCACAGCAGTGG - Intergenic
916741609 1:167651337-167651359 CCAGAACTCCAGTACAGATCGGG - Intronic
918853196 1:189718467-189718489 CGAGAAATCAAGCACAGCGCTGG + Intergenic
920150240 1:203900426-203900448 CGAGAAATCGAGCACAGCGCCGG - Intergenic
921897112 1:220412623-220412645 CGAGAAATCGAGCACAGCGCCGG - Intergenic
922417091 1:225431562-225431584 CGAGAATTCCAGCACAGCGCTGG - Intergenic
923765783 1:236891208-236891230 CCAGAACCCAACCACACCCCGGG - Exonic
924083208 1:240420804-240420826 CCAGAACTCCATCTCAGTCCCGG + Intronic
924834277 1:247633220-247633242 CCAGAACTTGATCTCAGCGCTGG - Intergenic
1063511398 10:6648037-6648059 CCAGAGCTCAACCACTGGGCAGG - Intergenic
1065743260 10:28815842-28815864 CGAGAAATCCACCGCAGCGCCGG + Intergenic
1066293637 10:34035578-34035600 CGAGAATTCCAGCACAGTGCTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067351941 10:45484376-45484398 CCAGACCTTCACCTCACCGCAGG - Intronic
1071037465 10:81265083-81265105 CGACAAATCCAGCACAGCGCCGG + Intergenic
1071497703 10:86180112-86180134 CCACCACTCCACCACTGGGCTGG - Intronic
1071963767 10:90832346-90832368 CTAGAAATCTAGCACAGCGCAGG + Intronic
1076207008 10:128611599-128611621 CCAGATCTCCAGGACAGCACTGG - Intergenic
1077121116 11:909004-909026 CAAGCACTCCATCACAGAGCGGG - Intronic
1078077783 11:8177215-8177237 CCAGAACCACACCACAGAACTGG - Intergenic
1079343215 11:19630021-19630043 CCAGAAGTTCACCACAGAGTTGG - Intronic
1079343224 11:19630064-19630086 CCAGAAGTTCACCACAGAGTTGG - Intronic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084523684 11:69682835-69682857 CCAGACCTCCACCCCAACCCAGG - Intergenic
1084946529 11:72641835-72641857 CCAGGACTCCACCTCAGAGCCGG - Intronic
1086397733 11:86433690-86433712 CGAGAAATCGAGCACAGCGCTGG + Intergenic
1086903540 11:92394045-92394067 CTAGAAACCCACCACAGCACTGG + Intronic
1087683792 11:101241418-101241440 CAAGAAGTCAAGCACAGCGCCGG + Intergenic
1089098249 11:115937806-115937828 CCAGAACCCAAACACAGCCCAGG - Intergenic
1089373556 11:117978656-117978678 CAAGAAATCGAGCACAGCGCCGG + Intergenic
1090229239 11:125089688-125089710 CGAGAAATCAAGCACAGCGCAGG - Intronic
1090279388 11:125443030-125443052 AGAAAACTCCACCACAGGGCCGG - Intergenic
1091233436 11:134003031-134003053 CGAGAAATCGAGCACAGCGCCGG + Intergenic
1093381584 12:18500337-18500359 CGAGAAATCCAGCGCAGCGCTGG - Intronic
1093583262 12:20807609-20807631 CGAGAATTCCAGCGCAGCGCTGG + Intergenic
1096515433 12:52152724-52152746 CCAGGACTCCAGCACAGGCCAGG - Intergenic
1100584709 12:95969326-95969348 CGAGAAATCGAGCACAGCGCTGG - Intergenic
1103146130 12:118597344-118597366 CGAGAAATCGAGCACAGCGCCGG + Intergenic
1103244958 12:119448779-119448801 GCAGAAGCCCACCACAGCTCTGG - Intronic
1104041593 12:125134464-125134486 CGAGAACCCCATCACAGGGCAGG - Intronic
1104546424 12:129716962-129716984 GCACAACTCCACCTCAGCGTTGG - Intronic
1105425663 13:20292608-20292630 CGAGAAATCTACCGCAGCGCCGG - Intergenic
1105477379 13:20740098-20740120 CGAGAATTCAAGCACAGCGCAGG + Intronic
1105701527 13:22938806-22938828 CGAGAATTCAACCACAGCGCGGG + Intergenic
1105777626 13:23677994-23678016 CGAGAATTCGAGCACAGCGCCGG + Intergenic
1105871128 13:24506975-24506997 CGAGAAATCTAGCACAGCGCTGG + Intronic
1109854281 13:68107886-68107908 CGAGAATTCCAGCGCAGCGCCGG + Intergenic
1110751383 13:79119804-79119826 CGAGAAATCCAGCACAGCGCCGG + Intergenic
1111466719 13:88622752-88622774 CCAGAACTCCACCCCATTTCTGG + Intergenic
1111635126 13:90893279-90893301 GCAGAACTCAATCACAGTGCTGG - Intergenic
1112226515 13:97545468-97545490 CAAGAAATCGAGCACAGCGCTGG - Intergenic
1112705866 13:102068665-102068687 CGAGAAATCGAGCACAGCGCCGG - Intronic
1113506652 13:110821351-110821373 CGAGAAATCGAGCACAGCGCCGG - Intergenic
1113510741 13:110853273-110853295 CCAGCACTCCTCCCCAGCACTGG - Intergenic
1113723042 13:112575067-112575089 CCAAAACTCCATCACAAGGCTGG + Intronic
1119038858 14:71254488-71254510 CGAGAAATCCAGCGCAGCGCCGG - Intergenic
1119486794 14:74994340-74994362 CGAGAAATCGAGCACAGCGCCGG - Intergenic
1119645897 14:76348280-76348302 CCAGACACCCACCACAGGGCTGG - Intronic
1119673436 14:76536919-76536941 CGAGAAATCGAGCACAGCGCAGG + Intergenic
1122205939 14:100147970-100147992 CTTGAACTTCACCACAGCCCAGG - Intronic
1122493443 14:102135680-102135702 CGAGAAATCGAGCACAGCGCCGG + Intronic
1126025384 15:44441377-44441399 CCAGCACTGCACCACAGAGGAGG + Intronic
1127916462 15:63459277-63459299 CGAGAATTCCAGCGCAGCGCCGG - Intergenic
1128066398 15:64767432-64767454 CCAGAACTGAACTACAGTGCTGG - Intronic
1128141040 15:65301240-65301262 CAAGAAATCCAGCACAGCGCCGG + Intergenic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1139365434 16:66429529-66429551 CCAGAACACCCACACAGCACAGG - Intronic
1139959788 16:70710929-70710951 CCGGAACTCCTTCAGAGCGCAGG - Intronic
1142066981 16:88068314-88068336 CCTGCACTCCACGACAGCACAGG - Intronic
1144804657 17:17956660-17956682 CGAGAATTCCAGCACAGCACTGG + Intronic
1144824584 17:18098615-18098637 CCCCAACACCACCACAGCTCTGG + Intronic
1146313415 17:31788578-31788600 CCCCAACTCCACCCCAGCTCAGG + Intergenic
1148855740 17:50578428-50578450 CCAGAAGGCCAGCACAGAGCTGG - Exonic
1149916399 17:60613806-60613828 CGAGAAATCCAGCGCAGCGCCGG - Intronic
1150532671 17:66000920-66000942 CCAGCACAGCATCACAGCGCAGG - Intronic
1150625796 17:66840338-66840360 CCAGACCTCCTCCTCAGCTCTGG - Intronic
1151849400 17:76681517-76681539 CCAGAACTACCCCACAGCTGGGG + Intronic
1152007768 17:77693345-77693367 CCAGAAGCCCACCCCAGGGCTGG + Intergenic
1152619037 17:81352216-81352238 CGAGAAATCCAGCGCAGCGCCGG + Intergenic
1154085683 18:11303143-11303165 CCAGGACTCCACAACACCCCCGG + Intergenic
1155271941 18:24149722-24149744 CGAGAAATCAAGCACAGCGCCGG + Intronic
1155806290 18:30175286-30175308 CGAGAATTCGAGCACAGCGCTGG + Intergenic
1156511684 18:37641987-37642009 CCCCAACTCCATCACAGCCCTGG - Intergenic
1156863669 18:41865949-41865971 CGAGAAATCGAGCACAGCGCCGG - Intergenic
1157231018 18:45916144-45916166 CCAGAACTCCAACACAGCAACGG + Exonic
1158697244 18:59714261-59714283 CGAGAAATCGATCACAGCGCCGG + Intergenic
1160136231 18:76274110-76274132 CCAGGCCTCCACCACGGCCCAGG + Intergenic
1160246630 18:77164978-77165000 CTAGAAATTCACCACAGCCCTGG - Intergenic
1161954547 19:7485981-7486003 CCAGAACTCCACCAACCAGCTGG + Exonic
1162987113 19:14277798-14277820 CGAGAATTCGAGCACAGCGCCGG - Intergenic
1165696938 19:37907553-37907575 CAAGCTCTTCACCACAGCGCCGG - Intronic
1165830789 19:38729270-38729292 CCAGAACTTCATCACAGCTGAGG + Exonic
1166036207 19:40170309-40170331 CGAGAAATCGAGCACAGCGCCGG + Intergenic
925862155 2:8189471-8189493 CCACATCTCCAGCACAGCCCAGG - Intergenic
929233725 2:39585547-39585569 CGAGAAATCGAGCACAGCGCCGG - Intergenic
932486492 2:72087073-72087095 CGAGAAATCGAGCACAGCGCCGG - Intergenic
932902063 2:75711766-75711788 CGAGAAATCGAGCACAGCGCCGG - Intergenic
933487241 2:82938614-82938636 CGAGAAATCCAGCGCAGCGCCGG + Intergenic
933892984 2:86788472-86788494 CCAGGACCCCACCCCAGGGCTGG + Intronic
934519483 2:95010868-95010890 CCAGCAGTCCAGCCCAGCGCAGG + Intergenic
935694329 2:105757929-105757951 CCAGGTCTCCACCACAGCTGGGG + Intronic
936428221 2:112436883-112436905 CCAGGACTACCCCACAGCCCGGG - Intergenic
941309261 2:163909714-163909736 CGAGAAATCGAACACAGCGCAGG - Intergenic
942398931 2:175580921-175580943 CCAGGACTTCAGCACAGAGCAGG - Intergenic
942546953 2:177075431-177075453 CCAGCTCTCCACCACAGCTCCGG + Intergenic
945745793 2:213718683-213718705 CGAGAAATCGAGCACAGCGCAGG - Intronic
946199467 2:218063401-218063423 TCAGAACTCTCCCACATCGCAGG + Intronic
948449096 2:238058022-238058044 CGAGAAATCCAGCGCAGCGCAGG + Intronic
948871249 2:240799336-240799358 CCAGAACTCCTCCGCAGAACAGG + Intronic
1169395328 20:5223995-5224017 CAGGAACTGCACCACAGAGCTGG - Intergenic
1169814441 20:9641757-9641779 CGAGAAATCGAGCACAGCGCCGG + Intronic
1170246482 20:14226699-14226721 CGAGAAATCGAGCACAGCGCCGG - Intronic
1171463934 20:25314792-25314814 CCAGGACACCATCACAGCACAGG + Intronic
1171973414 20:31578731-31578753 CAAGAAATCCAGCGCAGCGCCGG + Intergenic
1172846087 20:37930717-37930739 CCAGCTCTCCACCACAGCCCAGG - Intronic
1173195514 20:40910638-40910660 CGAGAAATCGAGCACAGCGCCGG + Intergenic
1174915689 20:54651348-54651370 CCTGAACTCCAGTACAGTGCCGG - Intergenic
1176189391 20:63800730-63800752 CGAGAAATCAAGCACAGCGCCGG - Intronic
1176374030 21:6078328-6078350 CCAGGACTGCCCCACAGCCCAGG + Intergenic
1178398756 21:32265523-32265545 CGAGAAATCCAGCACAGCGCCGG - Intergenic
1178753683 21:35327556-35327578 CCAGAACACAATCACAGGGCAGG + Intronic
1179749447 21:43459915-43459937 CCAGGACTGCCCCACAGCCCAGG - Intergenic
1182439786 22:30356578-30356600 CCAGAACACCACCATAGCGCGGG + Intronic
1183422106 22:37718008-37718030 CGAGAAATCCAGCGCAGCGCTGG + Intronic
1183684326 22:39352803-39352825 CCAGACCCCTACCACAGCCCTGG + Intronic
950197627 3:11020298-11020320 CCAGAACTCCACCACAGCGCTGG - Exonic
950545178 3:13634101-13634123 CCAGAAGCCCACAACAGCTCAGG - Intronic
951448602 3:22811443-22811465 CCAGAACTACACCAAAGAGGTGG - Intergenic
952355403 3:32578944-32578966 CGAGAAATCAAGCACAGCGCCGG - Intergenic
956450497 3:69370299-69370321 CCAGAGCCCAACCACAGGGCCGG + Intronic
960669218 3:120140441-120140463 CGAGAATTCCAGCGCAGCGCCGG - Intergenic
963027462 3:140933786-140933808 GCAGAGCCCCACCACAGCGCTGG + Intergenic
965753217 3:171999039-171999061 CGAGAAATCGAGCACAGCGCCGG + Intergenic
966596262 3:181726751-181726773 CCAGATCTGCAGCTCAGCGCTGG - Intergenic
966725418 3:183103914-183103936 CGAGAAATCCAGCGCAGCGCCGG + Intronic
969418570 4:7076648-7076670 CCAGTTCTCCATCACAGTGCCGG + Intergenic
969439972 4:7211264-7211286 CCTGAACTCTGCCACAGCTCTGG - Intronic
969589974 4:8116231-8116253 CCAGAATGCCACCACAGTGATGG + Intronic
969654961 4:8491578-8491600 CGAGAAATCGAGCACAGCGCCGG + Intronic
971564182 4:28117309-28117331 CGAGAATTCCAGCGCAGCGCCGG + Intergenic
973798451 4:54451824-54451846 GCAGAACTCCAGCACTGTGCTGG - Intergenic
974641732 4:64640641-64640663 CAAGAAATCGAGCACAGCGCTGG + Intergenic
975250670 4:72174701-72174723 CCAGACCTCCTCCACAGAGGAGG + Intergenic
976520613 4:86021775-86021797 CGAGAAATCGAGCACAGCGCCGG + Intronic
976690589 4:87863836-87863858 CAAGAATTCCAGCGCAGCGCCGG + Intergenic
977264985 4:94843344-94843366 CCAGAGCTCAAACACAGGGCTGG - Intronic
977606919 4:98993654-98993676 CAAGAAATCCAGCACAGCACTGG + Intergenic
979424738 4:120550905-120550927 CGAGAAATCGAGCACAGCGCAGG + Intergenic
979991477 4:127380127-127380149 CGAGAAATCCAGCACAGCGCCGG - Intergenic
980051915 4:128047726-128047748 CAAGAAATCGAGCACAGCGCCGG + Intergenic
980815567 4:137942263-137942285 CGAGAAATCGAGCACAGCGCTGG - Intergenic
981176576 4:141690026-141690048 CGAGAAATCGAGCACAGCGCTGG + Intronic
981545338 4:145887603-145887625 CCAGCACTCCACCCCAGCAGAGG - Intronic
982408243 4:155044495-155044517 CGAGAAATCCAGCGCAGCGCCGG - Intergenic
983752859 4:171298467-171298489 CGAGAAATCGACCGCAGCGCCGG - Intergenic
985145446 4:186890306-186890328 CAAGAAATCCAGCACAGAGCCGG - Intergenic
986463875 5:8001476-8001498 CAAGAACTCTTCCACAGGGCAGG - Intergenic
986698010 5:10375349-10375371 CAAGAAATCGAGCACAGCGCCGG - Intronic
987146233 5:14993973-14993995 CGAGAAATCGAGCACAGCGCCGG + Intergenic
987283746 5:16436375-16436397 CGAGAAATCCAGCGCAGCGCTGG - Intergenic
987358238 5:17083643-17083665 CGAGAAATCGAGCACAGCGCCGG - Intronic
987944939 5:24594304-24594326 CCAGAACTCCACTATACCCCAGG + Intronic
997809473 5:136953557-136953579 GCAGAACTCCAGCACTGTGCCGG + Intergenic
999691047 5:154146138-154146160 CCAGAACTCCCCTCCAGCTCTGG - Intronic
1000692831 5:164344382-164344404 CCCTAACACCACCACAGAGCTGG + Intergenic
1001670668 5:173470696-173470718 CCAGCACACCACCACAGGACAGG - Intergenic
1002373878 5:178774860-178774882 CGAGAACCCCATCACAGGGCAGG + Intergenic
1003160917 6:3633608-3633630 CCAGAACTCCCTGACAGCACTGG - Intergenic
1003908145 6:10720782-10720804 CGAGAAATCCAACGCAGCGCCGG - Intergenic
1004915861 6:20331442-20331464 CCAGAACCACACCACAGGACTGG - Intergenic
1005749914 6:28872760-28872782 CGAGAAATCGAGCACAGCGCGGG + Intergenic
1005751301 6:28885309-28885331 CGAGAATTCGACCGCAGCGCGGG + Intergenic
1005910829 6:30308031-30308053 CCAGAACTAGAACACAGCCCAGG + Intergenic
1006352658 6:33532583-33532605 CGAGAAATCGAGCACAGCGCCGG - Intergenic
1006388609 6:33746114-33746136 CCAAGACTCCACCACTGCCCAGG + Intronic
1009407093 6:63326621-63326643 CAAGAAATCGAGCACAGCGCTGG + Intergenic
1013955327 6:115834767-115834789 CGAGAAATCGAGCACAGCGCCGG + Intergenic
1014261142 6:119218757-119218779 CCAGTACGCCATCCCAGCGCGGG - Intronic
1016558611 6:145368970-145368992 CCTGAACCCCATCACAGCCCTGG + Intergenic
1019496985 7:1345375-1345397 CCGGAAGTCCACCTCAGCGGGGG + Intergenic
1019498188 7:1350674-1350696 TCAGAACTCCAGCACACTGCTGG - Intergenic
1021686752 7:23193901-23193923 CAAGAAATCCAGCGCAGCGCCGG + Intronic
1024944869 7:54798423-54798445 ACAGAACTTCACCCCAGCCCAGG + Intergenic
1026187076 7:68090581-68090603 CGAGAAATCAAGCACAGCGCTGG + Intergenic
1027868112 7:83673511-83673533 CGAGAAATCTAGCACAGCGCCGG - Intergenic
1028852501 7:95552630-95552652 CGAGAAATCCAGCACAGTGCTGG + Intergenic
1029065332 7:97843033-97843055 CGAGAATTCGAGCACAGCGCAGG + Intergenic
1029407103 7:100381912-100381934 CGAGAAATCGAGCACAGCGCCGG - Intronic
1031838031 7:126702706-126702728 CAAGAACACCACCACAGAACTGG - Intronic
1033664090 7:143424564-143424586 CGAGAAATCGAGCACAGCGCCGG + Intergenic
1033839911 7:145360804-145360826 CGAGAAATCCAGCGCAGCGCTGG + Intergenic
1034155031 7:148949274-148949296 CGAGAAATCGAGCACAGCGCCGG - Intergenic
1037425594 8:18751210-18751232 CGAGAAATCGAGCACAGCGCTGG + Intronic
1037987042 8:23296503-23296525 CCAGAACTGTCCCACAGCACAGG - Intergenic
1040488379 8:47896350-47896372 ACAGAACTCCACCCCAGGCCAGG + Intronic
1040850939 8:51899575-51899597 CCAGAAGTTCCCCCCAGCGCCGG + Intergenic
1043540324 8:81255115-81255137 CCAGAAATACACCACGGAGCAGG + Intergenic
1044075834 8:87821027-87821049 CGAGAAATCGAGCACAGCGCTGG - Intergenic
1044897886 8:96911910-96911932 CCAGAACTCGACCAAAGGTCTGG - Intronic
1045131931 8:99163567-99163589 CGAGAAATCGAGCACAGCGCCGG + Intronic
1045656455 8:104392087-104392109 CCAAAACTCCACCATTGCTCTGG + Intronic
1051126166 9:13808164-13808186 CCCTACCTCCACCACAGGGCAGG + Intergenic
1051892707 9:21959443-21959465 CGAGAAATCGAGCACAGCGCCGG - Intronic
1054722463 9:68617216-68617238 CGAGAAATCCAGCGCAGCGCCGG - Intergenic
1057118176 9:92545441-92545463 CGAGAAATCAAGCACAGCGCCGG - Intronic
1058506770 9:105674283-105674305 CCAGAACCCAACCAGAGGGCAGG + Intergenic
1185585524 X:1239820-1239842 CCAGAACCCCACCTCTGCCCCGG - Intergenic
1187139062 X:16575645-16575667 CGAGAAATCCAGCACAGCGCTGG - Intergenic
1187304619 X:18083995-18084017 CGAGAAATCGAGCACAGCGCCGG - Intergenic
1187729006 X:22234303-22234325 GCAGAGCTCGACCACTGCGCTGG + Intronic
1190413953 X:50163499-50163521 CGAGAAATCGAGCACAGCGCCGG + Intergenic
1192111911 X:68373570-68373592 CCAGAACCCTACCTCAGCACTGG + Intronic
1193538147 X:82738372-82738394 CGAGAAATCGAGCACAGCGCCGG + Intergenic
1196185487 X:112740562-112740584 CAAGAGCTCCACCTCAGGGCTGG - Intergenic
1196728921 X:118922152-118922174 CGAGAAATCGAGCACAGCGCCGG + Intergenic
1196827261 X:119750990-119751012 CGAGAAATCCAGCACAGCGCCGG + Intergenic
1198718295 X:139586415-139586437 ACAGACCTCCACCACAGTGCTGG + Exonic
1201496925 Y:14598365-14598387 CTAGAAATCCAGCGCAGCGCCGG + Intronic
1202271484 Y:23078508-23078530 TGAGAAATCCAGCACAGCGCTGG + Intergenic
1202294542 Y:23342174-23342196 TGAGAAATCCAGCACAGCGCTGG - Intergenic
1202424479 Y:24712252-24712274 TGAGAAATCCAGCACAGCGCTGG + Intergenic
1202446310 Y:24957833-24957855 TGAGAAATCCAGCACAGCGCTGG - Intergenic