ID: 950199374

View in Genome Browser
Species Human (GRCh38)
Location 3:11032291-11032313
Sequence CTGGAGACTCAGAAGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1190
Summary {0: 6, 1: 13, 2: 91, 3: 247, 4: 833}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950199374 Original CRISPR CTGGAGACTCAGAAGGGTGG GGG (reversed) Intronic
900118299 1:1037952-1037974 GTGGAGACTCAGCACAGTGGTGG + Intronic
900137204 1:1122606-1122628 CTGGCGACTCAGCGAGGTGGGGG + Intergenic
900161907 1:1227856-1227878 CTCGGGACTCAGCAGGGTGGGGG + Intronic
900724415 1:4206233-4206255 ATAGAGACTCAGAAGTGTGAGGG - Intergenic
901084657 1:6603078-6603100 GGGGAGACGCAGAAGGGCGGAGG - Intronic
901198001 1:7451086-7451108 CTGGAGCCTCAGCAGGGTCTGGG - Intronic
901314023 1:8293333-8293355 GTGTAGACTCTGGAGGGTGGGGG - Intergenic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
901781372 1:11596934-11596956 CTTGGGACTCAGGAGGGTGTTGG + Intergenic
902403854 1:16172545-16172567 CAGGAGAAACAGTAGGGTGGAGG - Intergenic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904598212 1:31659796-31659818 TTGGAGACTCAGTAGGGCTGAGG - Intronic
904756362 1:32770795-32770817 CTGGTGGCTCAGAAGGGGCGGGG + Exonic
905483485 1:38278104-38278126 TTAGAGAATAAGAAGGGTGGGGG - Intergenic
905975074 1:42168610-42168632 CTGGAGGTTCAGAGGGGAGGGGG - Intergenic
906312237 1:44762163-44762185 CTGGAGAGTCAGCTGGGTGAGGG + Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
907944922 1:59127115-59127137 CTGAAGACACAGAAAGGTGTGGG + Intergenic
907960361 1:59274148-59274170 TTAGAGACTCAGAAGGCAGGGGG + Intergenic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
908809802 1:67968819-67968841 CTAGAGGCTGAAAAGGGTGGGGG - Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909416265 1:75409168-75409190 CTGGAGACTCTAAAAGATGGGGG + Intronic
909872202 1:80755732-80755754 TTGGAGACTCAGGAGGTTGGGGG - Intergenic
910836555 1:91518722-91518744 CCAGAGGCTGAGAAGGGTGGTGG + Intronic
911425686 1:97708083-97708105 CTGGCTACTCAGAAGGCTGAGGG - Intronic
911685231 1:100768197-100768219 CTAGAGACTGGGAAGGGTGGAGG + Intergenic
911685731 1:100775109-100775131 CTAGAGCCTGAGAAGGGTAGAGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912897194 1:113604807-113604829 TTGAAGATTCAGAAGGGAGGAGG + Intronic
913035228 1:114958273-114958295 CTGGAGGCTGGGAAGGGTAGTGG + Intronic
914665562 1:149829616-149829638 CGGAAGACTCAGAAGGGTCAAGG + Intergenic
914670203 1:149864178-149864200 CGGAAGACTCAGAAGGGTCAAGG - Intronic
914953677 1:152142805-152142827 CTAGAGGCTGAGAAGGGTAGTGG + Intergenic
915043524 1:152989964-152989986 CTAGAGGCTGGGAAGGGTGGGGG + Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
916577736 1:166082217-166082239 CTAGAGAGCCAGAAGGGAGGGGG - Intronic
916790199 1:168118442-168118464 ATGGAGACTCACGAGGGTGAGGG + Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
918091315 1:181297479-181297501 CTGAAGCATCAGAAGGGAGGGGG + Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918689624 1:187465119-187465141 CTGCAGGGTCAGAATGGTGGAGG + Intergenic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919590908 1:199500824-199500846 ATGGAAACTCAGAGGGGTGGGGG + Intergenic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
920268121 1:204742208-204742230 AAGGAGACTCTGAAAGGTGGAGG - Intergenic
920492304 1:206426130-206426152 CTGGAGACTGGGAAGGGTAGCGG - Intronic
920542420 1:206789341-206789363 CTGGATCCTCAGAAGGGCAGGGG - Intergenic
920596111 1:207271864-207271886 CCAGAGACTGGGAAGGGTGGTGG - Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920894667 1:210034596-210034618 CTGAAGATTCAGAAAAGTGGAGG - Intronic
920990599 1:210935353-210935375 CTAGAGACTGAGAAGGGGAGAGG + Intronic
921339612 1:214121711-214121733 ATGGAGACTCAGTGGGGTAGGGG + Intergenic
922202162 1:223413835-223413857 CAGGAGACTCAAAAGTGAGGAGG + Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922461459 1:225817167-225817189 CTGGAGACTCAGGATGGAAGAGG - Intronic
922575711 1:226659513-226659535 GTGGATACACAGAAGGGAGGAGG - Intronic
922575749 1:226659668-226659690 GTGGATACGCAGAAGGGAGGAGG + Intronic
922624009 1:227018945-227018967 CTGCTGACTGAGCAGGGTGGTGG + Intronic
922645426 1:227281542-227281564 CTGGAGACTGGCAAGCGTGGGGG - Intronic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922898582 1:229119222-229119244 CCTGTGAGTCAGAAGGGTGGGGG + Intergenic
923060644 1:230469827-230469849 GTAGAGACTCAGAAGGGGCGGGG - Intergenic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
923561108 1:235042745-235042767 GTGAAGACTCAGAACGGAGGCGG - Intergenic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924643935 1:245859652-245859674 CTGGAGACCAAGGAGGGTGCAGG + Intronic
1062897356 10:1114380-1114402 CTGCTGACTGATAAGGGTGGTGG - Intronic
1063078507 10:2741425-2741447 ATGGAGACTGGGAAGGGTGAGGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063288539 10:4716137-4716159 TTGGAGACCCAGAAGCGTGGAGG - Intergenic
1063699374 10:8369800-8369822 CTGGTGACTCAGAAGGCTCCTGG - Intergenic
1063780632 10:9318462-9318484 CAGGAGCTTGAGAAGGGTGGTGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064864895 10:19868274-19868296 CTGGAGACTATTGAGGGTGGCGG - Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065413874 10:25463095-25463117 CTGCTGACTGATAAGGGTGGTGG - Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066695025 10:38069629-38069651 CTGGAGAATCAGAAGACTTGGGG + Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1066997486 10:42577550-42577572 CTGGAGAATCAGAAGCCTTGGGG - Intronic
1067182079 10:43995867-43995889 CCGGAGACTCACAAGTGGGGAGG + Intergenic
1067195762 10:44116692-44116714 CGGGAGACTCACGAGGGTGATGG + Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1067968518 10:50942282-50942304 ATGGAGCCTCAGAAGTGTGAGGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070434474 10:76376154-76376176 CTGGAGGCTCCAAAAGGTGGAGG - Intronic
1070715191 10:78715289-78715311 ATGGAGACTTAGATGTGTGGAGG - Intergenic
1071142085 10:82521298-82521320 CTGGTGATTCATCAGGGTGGTGG + Intronic
1071249043 10:83797130-83797152 CTGGAGACTCAGAGGGCATGAGG - Intergenic
1071256761 10:83878431-83878453 CTGGACACTGAGTAGGGTGGTGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072234847 10:93444882-93444904 CTTGAGCCTCAGAGGGGTGGAGG - Intronic
1072270471 10:93771504-93771526 TGGGAGACTGAGAAGGGTGGGGG + Intronic
1072699927 10:97633319-97633341 CTGGAGGCGCAGGAGGGAGGGGG - Intronic
1073275883 10:102310960-102310982 CTGGGGACTCAGCAGTGTGCAGG + Intronic
1074173464 10:110970209-110970231 CTAGAGGCTGAGAAGGGTGGCGG - Intronic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074370547 10:112897736-112897758 ATGGGGACTCAGAGAGGTGGAGG + Intergenic
1074543975 10:114388158-114388180 GTGGCCACTCAGATGGGTGGCGG + Intronic
1074630389 10:115248007-115248029 CTAGAGTCTGAGGAGGGTGGGGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075642552 10:124075284-124075306 ATGGAGCCTCAGATGTGTGGAGG - Intronic
1075962097 10:126576985-126577007 CTAGAGGCTGAGAAGGGTAGGGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076008323 10:126966022-126966044 CTAGAGCCTAAGAAGGGTAGGGG - Intronic
1076514107 10:131033533-131033555 CTGGATACGCAGAAAGATGGAGG + Intergenic
1076520926 10:131080800-131080822 CTGGAGATTCAGAAATGTGGAGG + Intergenic
1076677321 10:132153813-132153835 CTGGAGAGCGAGAAGGTTGGTGG + Exonic
1077227974 11:1446651-1446673 CTGGAGCCTCTGCTGGGTGGGGG + Intronic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1077734585 11:4775952-4775974 CTGGAGACTTGGAAGGGTAGGGG - Intronic
1077917516 11:6621242-6621264 CAGGAGGCACAGAGGGGTGGTGG - Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079252897 11:18800409-18800431 CTGGAGACTTGGAAGGGTGAAGG + Intergenic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080333805 11:31174013-31174035 CTGAAAACTCAGAAGGGTGTAGG - Intronic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080830919 11:35892628-35892650 CTGAAAAATCAGAAGGGTAGTGG + Intergenic
1081011622 11:37820317-37820339 CCAGAGGCTGAGAAGGGTGGGGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082901510 11:58258474-58258496 TTGGAGACTCAGAGGGGAAGAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083710537 11:64545691-64545713 CTGGAGAGGCAGAAGCCTGGGGG - Intergenic
1083929222 11:65830510-65830532 CTGGAGGCCAGGAAGGGTGGAGG + Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084461823 11:69300437-69300459 CTGGAGACAGAGAGGGGTGGAGG + Intronic
1084721357 11:70907459-70907481 CAGGAGCCTGAGAAGGGGGGAGG - Intronic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1084942808 11:72622687-72622709 CTGGAGACAGAGGAGGATGGGGG + Intronic
1085048866 11:73369190-73369212 TTGGAGACCCAGAAGAGTGCTGG + Intergenic
1085717591 11:78886688-78886710 CTGGAGAGTCAGCAAGGTGTTGG - Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1087537307 11:99465775-99465797 CTGGAGACTTAAAATTGTGGTGG + Intronic
1087705591 11:101487536-101487558 TTGGAGACTTAGAAAAGTGGGGG - Intronic
1088046973 11:105464784-105464806 CCAGAGACTGAGAAGGGTAGTGG + Intergenic
1088056400 11:105585182-105585204 CTAGAGACTGAGAAGGGTAGGGG - Intergenic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1089126213 11:116178277-116178299 CTGGAGACGCAGAAGAGCTGAGG - Intergenic
1089549099 11:119256722-119256744 TTAGAGACTCAGAAGCGGGGAGG - Intronic
1089813606 11:121152564-121152586 CTGGAGATTCAGATGGGCGGTGG + Intronic
1090190033 11:124761428-124761450 CTGGAAACCAATAAGGGTGGTGG + Intronic
1090855071 11:130603691-130603713 GTGGAGACTCAGGATGATGGTGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091782102 12:3220435-3220457 CTGGAGAGTCAGGAAGGTGACGG - Intronic
1092007447 12:5081254-5081276 CTGGTGACCCAGCAGGGCGGAGG + Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092860526 12:12716355-12716377 CTGGTGAGAGAGAAGGGTGGAGG + Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1092948118 12:13475554-13475576 CGGGAGCCTCGGGAGGGTGGTGG - Intergenic
1093320810 12:17711931-17711953 AGAGAGACTCAGAAGGGTAGTGG - Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094281332 12:28743006-28743028 CTGGAGTCACAGAAGCATGGAGG - Intergenic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1094747065 12:33357238-33357260 CAGTAGACTCTGGAGGGTGGTGG - Intergenic
1094763697 12:33565485-33565507 CTAGAGGCTGGGAAGGGTGGGGG + Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1095739179 12:45588375-45588397 CTGGAGAGCCAGAAAGCTGGTGG - Intergenic
1096097207 12:48943616-48943638 CTGCAAACTGAGAAGGGTGGTGG - Intronic
1096487387 12:51992720-51992742 CCAGAAACTCAGAAGGGAGGAGG + Intronic
1096958900 12:55557445-55557467 ATGGAAACTCATAAGGGTGGGGG - Intergenic
1097226490 12:57479443-57479465 CTGGAGACCCAGAAGGGAATAGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098109359 12:67105505-67105527 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1098354940 12:69603577-69603599 CTGGGGACTCCAAAGTGTGGAGG - Intergenic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099193000 12:79580035-79580057 CTAGAGACTGGGAAGGGTGAGGG + Intronic
1099582571 12:84469689-84469711 ATGGAGATTCAAAAGGGTGAAGG + Intergenic
1099607209 12:84819328-84819350 CTAGAGGCTAAGAAGGGTTGAGG + Intergenic
1099609221 12:84845329-84845351 CTGTTGACTGAGCAGGGTGGTGG - Intergenic
1100354316 12:93814691-93814713 CTGGAGGCTCAGAGAGTTGGTGG - Intronic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1102037863 12:109782531-109782553 CTGGAGTGTCAGCAGGGTGCTGG - Intergenic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1102946370 12:116992557-116992579 CTAGAGACTCAGAAGGGTACTGG - Intronic
1103207353 12:119140503-119140525 CTAGAGACTGGGAAGGGTAGTGG - Intronic
1104074719 12:125378955-125378977 CTGGGGACTGAGGGGGGTGGGGG - Intronic
1104394549 12:128421154-128421176 CTAGAGACTCGGAAGGGGAGAGG - Intronic
1104483460 12:129128755-129128777 CTGGAGACTCCCAAGGGTGGGGG - Intronic
1104536616 12:129623432-129623454 TTAGAGACTCAGAAGAGGGGAGG - Intronic
1104651030 12:130534208-130534230 CTGGAACCTTAGAAGGGTGGTGG + Intronic
1105020413 12:132812825-132812847 CTGCTGACTCATCAGGGTGGTGG - Intronic
1105346977 13:19582347-19582369 CCAGAGGCTGAGAAGGGTGGTGG - Intergenic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106070523 13:26406963-26406985 CTGGACAGCCAGAAGGGGGGAGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110094257 13:71496547-71496569 ATTGAGACTCAGAAGGGTGTGGG + Intronic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111197273 13:84891579-84891601 CTAGAGGCTGAGAAGGGTAGCGG + Intergenic
1111394831 13:87651779-87651801 CTGGGGACTCCAAAGGGGGGAGG - Intergenic
1112137371 13:96596101-96596123 CTGGAGATTCACAAGGGGAGAGG - Intronic
1112227883 13:97558280-97558302 CTGCAGGCTCAGAAGGCTGGAGG + Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112622844 13:101069509-101069531 CTGCTGACTGAGCAGGGTGGTGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113053737 13:106243653-106243675 CTAGAGGCTGGGAAGGGTGGAGG + Intergenic
1113335577 13:109373057-109373079 CTGTAGGCTCAGAGGGTTGGAGG + Intergenic
1113937942 13:114005110-114005132 CTGAGGCCTCGGAAGGGTGGAGG + Intronic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114136768 14:19861413-19861435 CTGGAGACTAGGAAGGGTAGTGG + Intergenic
1114506102 14:23215181-23215203 CAGGAGAGGCAGAGGGGTGGGGG - Intronic
1114567881 14:23645799-23645821 CTGGGGGCTCAGCAAGGTGGTGG + Intergenic
1114648809 14:24270325-24270347 CTGGAGACTCAGAAGTGCGTAGG - Exonic
1114862097 14:26536199-26536221 CCAGAGGCTCGGAAGGGTGGTGG + Intronic
1115308360 14:31955186-31955208 CTGCTGACTCATCAGGGTGGTGG - Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116342859 14:43748281-43748303 TTGGATACTCAAAAGGGTGAGGG + Intergenic
1116401254 14:44510389-44510411 ATGGAGACTCAGAAGTGTGTGGG - Intergenic
1116422464 14:44748793-44748815 CTAGAGACTAAGAAGGGTGGGGG + Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1116914610 14:50511392-50511414 CTAGAGGCTGAGAAGGGTAGGGG + Intronic
1117074518 14:52088952-52088974 CTAGAGACTCAGAAGACTGGAGG - Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1117749717 14:58908613-58908635 CTGGAGACTTGGAAGGGTGAGGG + Intergenic
1118473596 14:66097163-66097185 ACGAAGACTCAGAAGAGTGGCGG + Intergenic
1118586042 14:67354049-67354071 CTGGAGGCTGAGAAGGGTGAGGG - Intronic
1118747738 14:68786076-68786098 CTGGAGGCCCTGGAGGGTGGGGG - Intergenic
1118754425 14:68828965-68828987 CTGGAGGCTGAGAAGGGTAAGGG + Intergenic
1118819004 14:69332996-69333018 GGGGAGACTCCGAGGGGTGGTGG + Intronic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119817081 14:77579332-77579354 GTGGAGACTTGGAAGGGTGAGGG - Intronic
1119998529 14:79278737-79278759 CTGGGGACTCCAAAGGGTGAAGG - Intronic
1120126463 14:80749617-80749639 CTAGAGACTGGGAAGGGTAGTGG + Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120918864 14:89736083-89736105 TTGGAGACTCAAAAGGTTTGTGG - Intergenic
1120929233 14:89831647-89831669 CTGGAGAATGAGAATGGTGAAGG + Intronic
1121317072 14:92968653-92968675 CTGGGATTTCAGAAGGGTGGGGG - Intronic
1121784124 14:96642275-96642297 CTGGAGACTGATAAGTGGGGTGG - Intergenic
1122059732 14:99128993-99129015 CTGGAGGCTCAGGTGGGTGAAGG + Intergenic
1123038723 14:105481774-105481796 CTGGAGGCTCCCAAGGGAGGGGG - Intergenic
1124064913 15:26333387-26333409 CTGGAGACTCTAAAGGATGGGGG + Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124348496 15:28938123-28938145 CTGGAGGCTCCTAAGGGTGCTGG - Intronic
1124615437 15:31238385-31238407 CTGGAGGCTGGGAAGGGTAGGGG - Intergenic
1124938492 15:34195416-34195438 ATGGAGACTCAGAGAGGTAGGGG + Intronic
1125214730 15:37258422-37258444 CTGGAGACTGGGAAGGGTAGTGG + Intergenic
1125552973 15:40561534-40561556 TTGGAGATTCAGAAGTGGGGAGG + Intronic
1125710353 15:41780337-41780359 CTTCAGACTCAGAGGGTTGGTGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126834932 15:52652354-52652376 CTGAAGACAAAGAAGGGTTGTGG + Intronic
1127052475 15:55099250-55099272 CGGGAGACTCAGAAACGTGGCGG + Intergenic
1127456398 15:59159475-59159497 CTGGAGTGTCAGGAGGGAGGTGG + Intronic
1127564679 15:60175640-60175662 CTGGGGACTCAGCAAGGTGTGGG + Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127970229 15:63952959-63952981 CCAGAGCCTCAGAAGGGTAGAGG - Intronic
1128092024 15:64925787-64925809 GTGGAGGCTCAGAGAGGTGGAGG + Intronic
1128804103 15:70517906-70517928 CTGGAGACTTTGAGGGGTGCAGG - Intergenic
1129253877 15:74323054-74323076 CTGGAGACTTAGAAGGTAAGAGG - Intronic
1129555669 15:76506087-76506109 CCAGAGACTGAGAAGGGTAGTGG + Intronic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1129698260 15:77752914-77752936 CTAGAGAGGCAGAAGGGAGGGGG - Intronic
1130031886 15:80322970-80322992 CTGGAGACAGAGTGGGGTGGAGG - Intergenic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130303735 15:82699401-82699423 CTGGAGGCTCTGAGGGGAGGAGG - Intronic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130712278 15:86294911-86294933 ATGGAGACTCGGAAGGGTCAGGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131239511 15:90726593-90726615 CTGGAGGCTGGGAAGGGTAGGGG - Intronic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131572089 15:93548780-93548802 TTGGAGACTCAGAAGGGTACAGG + Intergenic
1132586733 16:708837-708859 CTGGAGACTGATATGGGAGGCGG + Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712324 16:8413216-8413238 CTAGAGGCTGGGAAGGGTGGGGG + Intergenic
1133777006 16:8904407-8904429 CCGGAGTCCCAGAAGGGCGGGGG + Intronic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135118838 16:19747644-19747666 GTGAAGACTCGGAAGGGTGAAGG - Intronic
1135151016 16:20005734-20005756 CTGGAGACTGTGAAGGGTAAGGG - Intergenic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135376469 16:21951882-21951904 ATGGAGACTCCGAAAGGTGGAGG + Intergenic
1135520140 16:23170354-23170376 CCAGAGACTGGGAAGGGTGGTGG + Intergenic
1135799604 16:25480351-25480373 CTGGAAACTCAGAAAGGGAGGGG + Intergenic
1135831061 16:25773802-25773824 CGGGAGACTCAGAAGAGAGGAGG - Intronic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1135904166 16:26495500-26495522 ACAGAGACTCAGAAGGGTGAAGG + Intergenic
1135956254 16:26958903-26958925 CTGCAGAGTCAGAAGGGTCCGGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136113966 16:28082963-28082985 CTGGAGCCTCCGGAGGGAGGTGG - Intergenic
1137337395 16:47563814-47563836 CTGGAGGCTCAGAAGACTGGAGG - Intronic
1137442302 16:48507775-48507797 CTGGAGACTGGGATGGGTTGAGG + Intergenic
1137550696 16:49435552-49435574 ATGGAGTTTCAGAAGGGTAGAGG - Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137959478 16:52867586-52867608 CTGGAGACCTGGAAGGGCGGAGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138741742 16:59318603-59318625 ATGGAGATTCTGAAGGGTGAGGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1138966697 16:62093298-62093320 CTGGAGACTCCAAAAGGGGGAGG - Intergenic
1139002796 16:62534170-62534192 CTGGTGACTAATCAGGGTGGTGG + Intergenic
1139126110 16:64079539-64079561 CTGCTGACTCATCAGGGTGGTGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1140598916 16:76451033-76451055 CTGGGGACACACAGGGGTGGTGG - Intronic
1141793565 16:86253003-86253025 CTGGCGTCTCTGAAGGGTGGGGG - Intergenic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1143052155 17:4135097-4135119 CTGGAGACTATTAAGGGTGGAGG + Intronic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1144634028 17:16892690-16892712 CTGGGGACTCAAAAAGTTGGGGG + Intergenic
1144767606 17:17741191-17741213 GAGGGGACTCAGGAGGGTGGTGG - Intronic
1145198033 17:20912991-20913013 ATGGAGACTTGGAAGGGTTGGGG - Intergenic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1147180857 17:38684776-38684798 CTGGAGACGCAGTCTGGTGGGGG + Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148627003 17:49077226-49077248 CTGGTGACTCAGAAAGGATGCGG - Intergenic
1148799212 17:50212593-50212615 CTGTAGAGTCAGAAGGGCCGAGG + Intergenic
1149043682 17:52219999-52220021 GTAAAGACTCAGAAGGGTAGAGG - Intergenic
1149147910 17:53519797-53519819 CTGCTGACTAAGTAGGGTGGTGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1150483965 17:65531474-65531496 CAGGAGACTCAGGACAGTGGGGG + Intronic
1150509218 17:65731492-65731514 CTGCTGACTAATAAGGGTGGTGG + Intronic
1150559549 17:66282790-66282812 CTGGAGGCTAAAGAGGGTGGAGG - Intergenic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1150738748 17:67762497-67762519 GGGGAGGCTAAGAAGGGTGGAGG - Intergenic
1150964835 17:69956229-69956251 ATGGAGACTTGGAAGGGTGGGGG + Intergenic
1151469594 17:74309754-74309776 CTGGGGCCACGGAAGGGTGGGGG + Intronic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1152401029 17:80066208-80066230 GTGGAGACTACGAAAGGTGGAGG - Intronic
1152404060 17:80086628-80086650 CTTGGGCCTCAGAAGGGTTGGGG - Intronic
1152715278 17:81896894-81896916 CTTTGAACTCAGAAGGGTGGGGG - Intronic
1153113940 18:1631517-1631539 CTAGAGACTGGGAAGGGTAGGGG + Intergenic
1153326159 18:3822489-3822511 CTGGTGAATCTGGAGGGTGGAGG + Intronic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153959311 18:10127276-10127298 CTGCAGACTCACAACGGTAGCGG - Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154138898 18:11805513-11805535 CAGGAGACTCAAAAGGGTGAGGG - Intronic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154461027 18:14586411-14586433 CTGGAGATTAGGAAGGGTAGTGG + Intergenic
1154496575 18:14965685-14965707 CTGGAGTCTCTGGTGGGTGGTGG - Intergenic
1155064999 18:22261223-22261245 CTGGGTACTCCAAAGGGTGGAGG - Intergenic
1155116374 18:22772443-22772465 CTAGAGGCTGGGAAGGGTGGTGG + Intergenic
1155236940 18:23829777-23829799 CTGGAGACTATGAAAAGTGGAGG - Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155552107 18:26975432-26975454 ATGGAGACTCGGAGTGGTGGGGG - Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156077084 18:33292408-33292430 CTAGAGACTAGGAAGGGTAGGGG + Intronic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1156895193 18:42238299-42238321 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
1158200377 18:54932550-54932572 CTGGAATCTCTGGAGGGTGGAGG - Intronic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158440091 18:57467834-57467856 CTGGAGATGCTGGAGGGTGGGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158629297 18:59098388-59098410 CTGGAGGCTGAGAAGGGTATGGG + Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158859440 18:61578030-61578052 GTGGACACTCAGAAGGGTGGAGG + Intergenic
1159936416 18:74371657-74371679 CTGGAGATGCAGAAGGCTAGGGG + Intergenic
1160076871 18:75685755-75685777 ATGGAGACTTGGAAGGGTGGCGG - Intergenic
1160345216 18:78127152-78127174 CTGGAGCCTCTGAGGGCTGGTGG - Intergenic
1161050432 19:2161015-2161037 CTGGGACCTCAGCAGGGTGGTGG - Intronic
1161227734 19:3154971-3154993 CTGGAGACTGAGACGGGAGTGGG - Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1163090291 19:15014711-15014733 CAGGAGACTCAGTGGGGGGGCGG + Intronic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164729599 19:30493008-30493030 CTGCAGACTCAAAATGCTGGCGG - Intronic
1164773295 19:30830039-30830061 TTGGATACTCAGAAGGTAGGAGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164934677 19:32201565-32201587 AAGGAGAATCAGCAGGGTGGAGG + Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165258148 19:34592402-34592424 AGGGAGACTCAGAGGGATGGAGG + Intergenic
1165654435 19:37520831-37520853 CTGGATTCTCAGAATGGTGGTGG + Intronic
1165712372 19:38021149-38021171 CTGCAGACTCTCCAGGGTGGTGG + Intronic
1165806943 19:38586205-38586227 CTGGCCAGTCAGGAGGGTGGGGG + Intronic
1165934565 19:39381312-39381334 ATGATGACTCAGAGGGGTGGGGG - Intronic
1166168672 19:41010798-41010820 GTGAAGACTCAGAAGAGTGAGGG - Intronic
1166169910 19:41020616-41020638 CCAGAGACTGGGAAGGGTGGAGG - Intergenic
1166207366 19:41280199-41280221 ATGGAGACTCAGAAGTGTTAGGG + Intronic
1166254345 19:41591929-41591951 ATAGAGACGCAGAAGTGTGGGGG - Intronic
1166343301 19:42151133-42151155 CTGGGGACCCAGATGGGAGGAGG + Intronic
1166392654 19:42418427-42418449 CTGCTGACTCACGAGGGTGGTGG - Intronic
1166545964 19:43635123-43635145 ACGGAGACTAAGCAGGGTGGGGG + Intronic
1167121705 19:47521160-47521182 CTGGAGAGGCCGAAGGGAGGAGG + Exonic
1167359069 19:49020319-49020341 CTGGAGACCCAGAAAGATAGGGG - Intergenic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1167408936 19:49333701-49333723 GTGGAGACTCAGCAGGCAGGAGG + Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1167882309 19:52470259-52470281 CTAGAGGCAAAGAAGGGTGGTGG - Intronic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925740233 2:6999291-6999313 TTGAAGATTCAGAAGGGAGGAGG + Intronic
925853798 2:8110139-8110161 CTGGGGGCTCAGGAGGGTGAGGG + Intergenic
926211960 2:10878013-10878035 TTGGAGGCTCAGCAGGGTGTGGG - Intergenic
926617994 2:15018125-15018147 CTGAAGACTGGGAAGGGTAGGGG + Intergenic
926875845 2:17477730-17477752 TTGGAGACACAGAAGTGAGGAGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927153557 2:20209292-20209314 CTAGAGACTCTGAAAGGTGAGGG + Intronic
927524441 2:23724108-23724130 CTAGAGACTGGGAAGGGTAGAGG + Intergenic
928042601 2:27893259-27893281 CTGGAAACTCATAGGGCTGGGGG - Intronic
928123061 2:28597902-28597924 ATGGGCACTAAGAAGGGTGGGGG + Intronic
928179326 2:29056872-29056894 CTCAAGAGTCAGAAGAGTGGAGG - Exonic
928478082 2:31651950-31651972 ACTGTGACTCAGAAGGGTGGGGG - Intergenic
928812343 2:35244345-35244367 ATGGAGACTCCAAAGGGTGGAGG - Intergenic
928870123 2:35965977-35965999 CTGGAGACCCAGGAAGCTGGTGG - Intergenic
930041051 2:47124416-47124438 CCAGAGACTAAGAAGGGTAGTGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930774428 2:55158579-55158601 CTGGAGTGACAGAGGGGTGGTGG - Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
932072762 2:68637282-68637304 CTGGGGACTCAGAACGGTTTGGG - Intergenic
932815725 2:74860151-74860173 ATGGAGACTTGGAAGGGTGAGGG + Intronic
932871362 2:75402280-75402302 CTAGAAACTGAGAAGGGTAGTGG - Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934131531 2:88953526-88953548 CGTGAGACTAAGAACGGTGGTGG + Intergenic
934157285 2:89215122-89215144 CAGGACAGTCACAAGGGTGGAGG + Intergenic
934210033 2:89967622-89967644 CAGGACAGTCACAAGGGTGGAGG - Intergenic
934576603 2:95405688-95405710 CTGGAGACAGGGAATGGTGGAGG + Exonic
934794826 2:97091555-97091577 CTGGAGACAGGGAATGGTGGAGG - Exonic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
934895098 2:98111112-98111134 CTGGAGAATCCAAAAGGTGGGGG - Intronic
934949638 2:98567489-98567511 CTGGAGCCCCAGCAGGGAGGTGG + Intronic
935081085 2:99795373-99795395 CTGGGGACTCAGAAGGGCAATGG + Intronic
935125058 2:100215546-100215568 CAGGAGACCCAGACTGGTGGGGG - Intergenic
935476811 2:103532331-103532353 TTGGAGATTCAGAAGTGGGGAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937091538 2:119209636-119209658 CTGGAGGCTGAGCGGGGTGGTGG - Intergenic
937708588 2:124950668-124950690 CTGGAGACTGAGTAGAGTGCAGG - Intergenic
937987059 2:127642676-127642698 CTTGAGACTCAGGAGGCGGGTGG - Intronic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939130338 2:138228222-138228244 ATGGAAATGCAGAAGGGTGGGGG - Intergenic
940024102 2:149186949-149186971 CTGCTGACTCATCAGGGTGGTGG - Intronic
940581028 2:155581192-155581214 CTAGAGACTGGGAAGGGTAGTGG - Intergenic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
942271503 2:174280281-174280303 CAGAAGGCTCAGAAGGGAGGAGG - Intergenic
942736915 2:179125063-179125085 CTGGAGGTTCAGGATGGTGGTGG - Intronic
942907831 2:181205407-181205429 CTAGAGACTGGGAAGGGTTGGGG + Intergenic
943196127 2:184752464-184752486 CTGGAGACTCCAAAATGTGGGGG + Intronic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
943924284 2:193752004-193752026 ATGAAAACTCAGAAGGGTGAGGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944261615 2:197684188-197684210 CTAGAGGCTGAGAAGGGTAGAGG + Intergenic
944274093 2:197816182-197816204 CTGGTGACTGATCAGGGTGGTGG - Intronic
944338617 2:198568065-198568087 CTGCTGACTGAGCAGGGTGGTGG - Intronic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945464068 2:210146141-210146163 CTAGAAACAAAGAAGGGTGGGGG - Intronic
945958233 2:216106067-216106089 CTGGAGACTCAGTACAGTGAAGG - Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946331344 2:219010705-219010727 CTGGGGAGTTAGGAGGGTGGGGG + Intronic
946638638 2:221758599-221758621 ATGGAGACTCAAAAGGCTCGGGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946875545 2:224126139-224126161 CTGGAGCCTCAGCAAGGAGGTGG + Intergenic
946906740 2:224424621-224424643 TTTGAGACTGAGAAGGATGGAGG + Intergenic
947084046 2:226430847-226430869 CAGGAGACTTCAAAGGGTGGGGG - Intergenic
947140258 2:227013868-227013890 CTGGTCCCTCAGTAGGGTGGGGG - Intronic
947329743 2:229015958-229015980 CTGGAGGCTGAGAAGAATGGTGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948852079 2:240713408-240713430 CTAGAGACTCTGAAGGGTCCAGG + Intergenic
948983199 2:241505488-241505510 CTGAAGAGTCGGAGGGGTGGTGG - Intronic
1168957540 20:1844895-1844917 CAGCAGCCCCAGAAGGGTGGGGG - Intergenic
1169050462 20:2572587-2572609 GTGGAGACCCAGAAGGGCTGTGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169292283 20:4362982-4363004 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169938826 20:10915092-10915114 ATGGAGACTTGGAAGGGTGAGGG + Intergenic
1170048665 20:12115053-12115075 CTGAAGAGTCAGAAGTGTGGAGG + Intergenic
1170075572 20:12415280-12415302 CTGCAGACACAGAATGCTGGAGG - Intergenic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171047079 20:21819435-21819457 CTGGAGACTAGGAAGGGTAAAGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171236573 20:23530995-23531017 CTGCTGACTGAGCAGGGTGGTGG + Intergenic
1171313308 20:24164246-24164268 CTGCTGACTCATCAGGGTGGTGG - Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171820265 20:29829893-29829915 AAGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172052434 20:32128584-32128606 TTGGAGGCTCTGAAGGGTAGGGG - Intronic
1172749952 20:37243819-37243841 CTGCAGACTCAGATGGGAGCTGG + Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173554903 20:43959013-43959035 CTGGAGACCCAGGAGGGCAGTGG - Intronic
1173772408 20:45672962-45672984 CTGCTGACTCATCAGGGTGGTGG + Intergenic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174149601 20:48476760-48476782 CTGGAGACCCAGAAAGGAGCTGG - Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1174821191 20:53727809-53727831 CTGGGGGCTCAGATGGGTGAGGG - Intergenic
1175003254 20:55653373-55653395 TAGGAGACTCAGAGGGCTGGTGG - Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175617556 20:60414020-60414042 CTTGAGAATCAGAAAGGGGGAGG - Intergenic
1175973325 20:62698271-62698293 CTGAAGACTTAGAAGTGCGGGGG + Intergenic
1176673663 21:9757309-9757331 CTCGAGACTCAGAAAGCTGCCGG + Intergenic
1176813475 21:13571429-13571451 CTGGAGATTAGGAAGGGTAGTGG - Intergenic
1177112192 21:17042023-17042045 ATGGAGGCTCAGAAGGATTGGGG + Intergenic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177883849 21:26725004-26725026 ATGGAGACTTAGAAGTGGGGAGG - Intergenic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1179014751 21:37586984-37587006 CTGGCGACTATGAAGGGTGGAGG - Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1179406057 21:41126816-41126838 CTAGAGGCTGAGAAGGGTAGGGG - Intergenic
1179642868 21:42758780-42758802 CAGGCCACTCAGATGGGTGGGGG - Intronic
1179998624 21:44985191-44985213 GTGGGGACTGAGGAGGGTGGAGG + Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1180720395 22:17903611-17903633 AATGGGACTCAGAAGGGTGGTGG - Intronic
1180926109 22:19556085-19556107 CTTCAGACACAGGAGGGTGGTGG + Intergenic
1180926796 22:19560774-19560796 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1181821565 22:25479848-25479870 CTGCTGACTCATTAGGGTGGTGG + Intergenic
1181886034 22:26023126-26023148 AAGGAGACCCAGAAGGGCGGTGG - Intronic
1181906406 22:26200674-26200696 CTGGAGGCTGAGAAGGCTGATGG - Intronic
1182109310 22:27711498-27711520 CTGGGGACTGAGACTGGTGGGGG + Intergenic
1182208144 22:28649196-28649218 TTGGAGACTCAGGAGGTAGGAGG + Intronic
1182347826 22:29679208-29679230 CTGCAGAGTCAGATGGGTGAGGG - Intronic
1182426870 22:30278247-30278269 CTGGAGAGCCAGCAGGGTGGGGG + Intergenic
1182859963 22:33551033-33551055 ATGGAAACTCAGAAGGGTAAAGG + Intronic
1182921043 22:34079533-34079555 GTGGAGACTTGGAAGGGTAGGGG + Intergenic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183742960 22:39678591-39678613 CTGGGGGCTCTGCAGGGTGGGGG - Intronic
1184751817 22:46490663-46490685 CTGCAGACTCAGGAAAGTGGTGG + Intronic
1184831051 22:46987737-46987759 CTGCAGACTGATCAGGGTGGTGG + Intronic
1184918942 22:47592114-47592136 CTGAAAACTCAGATGGGTCGAGG - Intergenic
949160998 3:881790-881812 ATGGAGACCCACAAGGGTGAGGG - Intergenic
949516354 3:4810716-4810738 ATGGAGACTCAGAGGGGATGAGG + Intronic
949750302 3:7344755-7344777 CTTGAGGCTCAGAAGGTTAGGGG + Intronic
949937416 3:9126758-9126780 ACAGAGACTCAGAAGGGTGAGGG + Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950654580 3:14428676-14428698 CAGGAGACTCAGCAGCCTGGAGG - Intronic
951007269 3:17632637-17632659 CTGCTGACTCATCAGGGTGGTGG - Intronic
951456849 3:22902501-22902523 CTGGAGAGTGATAAGGGTAGTGG - Intergenic
951491327 3:23272756-23272778 CTGGAGACTCAGGAGAGCTGTGG + Intronic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
951823662 3:26843109-26843131 TTGGAGACTTTGAAGGGTGGGGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952899868 3:38103144-38103166 ACGGAGACTCGGAAGGGTGAGGG - Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953298896 3:41751520-41751542 CCAGAGACTGAGAAGAGTGGAGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953510904 3:43537960-43537982 CTACAGACTAAAAAGGGTGGGGG + Intronic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954167816 3:48774585-48774607 CCAGAAACTGAGAAGGGTGGTGG - Intronic
954842932 3:53528235-53528257 CTGGATACCCACAAGGGAGGTGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956042063 3:65155151-65155173 CTGGAGGCTGGGAAGGGTAGGGG - Intergenic
956447772 3:69342890-69342912 CTAGAGGCTAGGAAGGGTGGGGG + Intronic
956751840 3:72349667-72349689 CTGGAGACTCTGCTGGGTGGGGG - Intergenic
957086661 3:75685952-75685974 ATGGAGACACAGCAGGGTGAGGG - Intergenic
957481023 3:80793961-80793983 GTGGAGACTTGGAAGGGTGAGGG + Intergenic
957768278 3:84655446-84655468 CTAGAGACACAGAAAGGTGAAGG + Intergenic
957771681 3:84701413-84701435 ATGAAGACTCAGAAGGGTGTGGG + Intergenic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
958933400 3:100231603-100231625 CTGAAGACTGATCAGGGTGGTGG - Intergenic
959092229 3:101915955-101915977 CTAGAGGCTGGGAAGGGTGGAGG - Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959363823 3:105430751-105430773 CTCCACACTCAAAAGGGTGGAGG - Intronic
959995659 3:112677696-112677718 CTAGAGACTTGGAAGGGTGGGGG - Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960639478 3:119812336-119812358 CAGGAGACTCAGAAGGTTTAGGG - Intronic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961715149 3:128852870-128852892 GTGTAGACTCAGAAGGCTGGGGG + Intergenic
961732507 3:128976619-128976641 CTGGAGACTCAGGAGTCTGAAGG + Intronic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961826905 3:129603915-129603937 CGCCAGACTCAGATGGGTGGAGG + Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962174115 3:133134781-133134803 CTACAGACTCAGAAGCGGGGAGG - Intronic
962870463 3:139486151-139486173 CTTGAGACTCAGAAATGGGGAGG - Intergenic
962895556 3:139710708-139710730 CAGGAGCCTATGAAGGGTGGGGG - Intergenic
963178493 3:142327839-142327861 ATAGAGACTTGGAAGGGTGGGGG - Intronic
963466847 3:145692858-145692880 TTGAAAACACAGAAGGGTGGAGG + Intergenic
963765531 3:149331725-149331747 ATGAAGACTCACGAGGGTGGTGG - Intronic
963941631 3:151101686-151101708 CTGGAGCCCCAGCAGGTTGGGGG + Intronic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965255771 3:166408823-166408845 CAGGTGACTCAGAAGGTTGCTGG - Intergenic
965595754 3:170409114-170409136 CTGCTGACTGATAAGGGTGGTGG - Intergenic
965608554 3:170520939-170520961 TTGGAGAGACTGAAGGGTGGAGG - Intronic
965795710 3:172436711-172436733 CTGGTAAATCAGAAGTGTGGAGG - Intergenic
966499305 3:180620921-180620943 CGGAAGACTCAGAAGCATGGTGG - Intronic
967224158 3:187275063-187275085 CTGGAGTCCCAGAAGGGGTGAGG - Intronic
967728501 3:192884336-192884358 TTGGAGACTCAGGTAGGTGGAGG + Intronic
967920312 3:194609435-194609457 CAGGAAACACAGAAGAGTGGGGG + Intronic
968232836 3:197014342-197014364 CTGCAGACTGGGAAGGGTAGGGG + Intronic
968346838 3:198015679-198015701 TAGGGGACTCTGAAGGGTGGAGG - Intronic
968736747 4:2301235-2301257 CTTGAGACACAGATGAGTGGGGG + Intronic
969166739 4:5322641-5322663 CTGGAGACTAAGAAAGGTCTAGG + Intronic
969296749 4:6274732-6274754 CTGCAGAAACAGAAGTGTGGAGG + Intronic
969405212 4:6987116-6987138 CTGGAGACTCCCAAGGGGGCGGG - Intronic
969586652 4:8097800-8097822 ATGGAGACCCAGAGGAGTGGGGG - Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970432598 4:16002449-16002471 AAGGAGCCTCAGAAGGGTGTGGG + Intronic
970578958 4:17456147-17456169 CTGGTGACTGATCAGGGTGGTGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
972366070 4:38375891-38375913 GTGGAAACTCTGAAGGGTGAGGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972776483 4:42246078-42246100 CTGCTGACTCATCAGGGTGGTGG - Intergenic
972889456 4:43538363-43538385 CTGGAGATTCAGAAAGGGAGAGG + Intergenic
972993178 4:44847472-44847494 CTGGAGACTGAGAATGGTAAAGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974112554 4:57542569-57542591 CTGGAGAACTAGAAAGGTGGTGG + Intergenic
974310861 4:60208768-60208790 AGAGAGAGTCAGAAGGGTGGGGG + Intergenic
974504614 4:62752618-62752640 TTGGAGACTTGGAAGGGTCGAGG + Intergenic
974889123 4:67857695-67857717 CTAGAGACTGGGAAGGATGGAGG + Intronic
975126579 4:70789027-70789049 CTGGAGGATCAGATGGGAGGAGG - Intronic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975457730 4:74612360-74612382 CTGGAGGCTGGGAAGGGTGTGGG + Intergenic
975531946 4:75408614-75408636 CTAGAGGCTGAGAAGGGTAGGGG - Intergenic
975596607 4:76052601-76052623 GTGGAGACTTGGAAGGGTTGGGG - Intronic
975802647 4:78077597-78077619 ATGGAGACTCGGAAGGGTGTGGG - Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976070911 4:81238825-81238847 CTGGAGGCTGAGGAGGGAGGAGG - Intergenic
976117999 4:81748787-81748809 CTAGAGGCTGGGAAGGGTGGTGG - Intronic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
976465271 4:85360799-85360821 CTGCTGACTGAGCAGGGTGGTGG + Intergenic
976563987 4:86532720-86532742 TTGGAGATTCAGAAAAGTGGAGG - Intronic
977103233 4:92845585-92845607 AAGGAGATTGAGAAGGGTGGAGG - Intronic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977249728 4:94676380-94676402 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
977252849 4:94708239-94708261 CTGGAGACTTGGAAGGGCAGGGG - Intergenic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977814002 4:101392265-101392287 TTAGAGACTCAGAAGTGGGGAGG + Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977915880 4:102592433-102592455 CTGCTGACTGATAAGGGTGGTGG - Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978067997 4:104429594-104429616 CTGAAGACCAAGGAGGGTGGTGG - Intergenic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
978994061 4:115128116-115128138 ATGGTGACTCAGAAGGGTTAGGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979325953 4:119379719-119379741 TGGGAGACTCAGAAGTGGGGAGG - Intergenic
979663850 4:123289172-123289194 CTGGAGATTCAGAACGGGGTAGG - Intronic
979760787 4:124401229-124401251 TTGGAGACTCAGAATAGTGGGGG - Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980421556 4:132566707-132566729 CTGGAGACCCAGTTTGGTGGGGG + Intergenic
980548569 4:134302958-134302980 TTGGAGACTCAAAAGCATGGAGG - Intergenic
980669821 4:135990286-135990308 CTGGAGTCTGGGAAGGGTAGTGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
980749627 4:137071161-137071183 CTGGAGGCCCAGGAGGGTTGAGG + Intergenic
980775995 4:137437245-137437267 CAGGAGACTCAGAAGGCTATTGG + Intergenic
980979734 4:139644024-139644046 ATGGAGACTTGGATGGGTGGGGG - Intergenic
981154538 4:141418169-141418191 CCAGAGACTGAGAAGGGTAGTGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981923287 4:150110639-150110661 TTAGAGACTCAGAAGTGGGGAGG - Intronic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982039455 4:151381337-151381359 TTGGAGACTCAGAAGGGTATAGG + Intergenic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982610919 4:157574272-157574294 CTGCTGACTCAGAAGGGAGTGGG - Intergenic
982682856 4:158452873-158452895 CCAGAGACTGAGAAGGGTTGTGG - Intronic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
982896423 4:160933287-160933309 CTGGAGACTTGGAAGGGTTAGGG + Intergenic
983243812 4:165264376-165264398 TGGGAGACTCAGAAGTGGGGAGG - Intronic
983290127 4:165791756-165791778 CTGTTGACTGATAAGGGTGGTGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983506969 4:168564016-168564038 ATGGAGACTGGGAAGGGTGAAGG - Intronic
983595045 4:169457049-169457071 CTAGAGGCTAGGAAGGGTGGTGG + Intronic
983799772 4:171912703-171912725 CTAGAGGCTGGGAAGGGTGGAGG - Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984424316 4:179563789-179563811 CTGAAGCCTCAGGAGGATGGGGG + Intergenic
984586977 4:181576108-181576130 GTGGAGACTAGGAAGGGTAGGGG - Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985401045 4:189594360-189594382 CTCGAGACTCAGAAAGCTGCCGG - Intergenic
985505654 5:278820-278842 CTGGGGACACAGGAGGGTGCTGG + Intronic
985728297 5:1526954-1526976 CTGGGGACTGCGAGGGGTGGGGG + Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986065083 5:4227623-4227645 CTGGAGACTCTGGGGGATGGGGG - Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
986351702 5:6886182-6886204 ATGGAGACTCAGGGGGTTGGGGG - Intergenic
986384297 5:7216593-7216615 CTGGAGACTAAGAAGGAAAGAGG - Intergenic
986454848 5:7907163-7907185 CTGGAGGCTGGGAAGGGTAGAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
987095754 5:14547836-14547858 CTGCTGACTCATCAGGGTGGTGG + Intergenic
987208252 5:15650443-15650465 CTGCTGACTCATCAGGGTGGTGG + Intronic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987262838 5:16221071-16221093 GTGGAGACTAGGAAGGGTGAAGG + Intergenic
987615573 5:20269705-20269727 TTGTAGACTTAGAAGGGTGAAGG + Intronic
987659226 5:20850924-20850946 CTAGAGACTCAGAAGCGAGGAGG + Intergenic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988231087 5:28480321-28480343 CTGCTGACTGACAAGGGTGGTGG + Intergenic
988348539 5:30070644-30070666 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
988390158 5:30617163-30617185 CTGGGGACTGTGAGGGGTGGGGG - Intergenic
988422230 5:31020334-31020356 TTGAAGACTCAGAAGGGTACAGG + Intergenic
988764444 5:34355057-34355079 CTAGAGACTCAGAAGCGAGGAGG - Intergenic
988976988 5:36525573-36525595 CCAGAGACTGAGAAGGGTAGTGG + Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989081223 5:37624207-37624229 CTAGAGGCTGAGAAGGGTAGAGG - Intronic
989392227 5:40912957-40912979 TTGGAGACTCAGAAGAGTTGGGG - Intronic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
989953213 5:50325943-50325965 CTAGAGACTTGGAAGGGCGGAGG - Intergenic
990311853 5:54547928-54547950 CTGGAGAGTTTGAAGAGTGGTGG + Intergenic
990998398 5:61757012-61757034 CCAGAGTCTGAGAAGGGTGGTGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992257914 5:74940560-74940582 CTGGAGACTTGGAAGAGTGGAGG + Intergenic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992755084 5:79896622-79896644 CTAGAGACTGGGAAGGGTAGTGG - Intergenic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993195709 5:84742544-84742566 TTGGAGACTCAAAAGTGGGGAGG - Intergenic
993262598 5:85679015-85679037 TTGGAGACTTAGAAGTCTGGGGG + Intergenic
993322757 5:86494319-86494341 CTGGACACTTAGAAGGGTGGAGG - Intergenic
993501754 5:88674213-88674235 ATGCAGACAGAGAAGGGTGGGGG + Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
993741879 5:91551480-91551502 GTGGAGACTTGGAAGGGTGTGGG + Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
995016186 5:107312262-107312284 CTGGCCACTCAGAAGTGAGGAGG - Intergenic
995254927 5:110035210-110035232 CTGGGTGCTCAGAAGGCTGGTGG + Intergenic
995791473 5:115892646-115892668 CTAGAGACTTGGAAGGGTAGTGG + Intronic
996444985 5:123537412-123537434 GTGGAGACTTGGAAGGGTGAGGG + Intronic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997207670 5:132059571-132059593 CAGGAAACCCAGAAGGGCGGGGG - Intergenic
997824548 5:137094659-137094681 CTGCTGACTGATAAGGGTGGTGG + Intronic
997886729 5:137637115-137637137 GTTGAGACTCAGAGAGGTGGTGG - Intronic
998138361 5:139686181-139686203 CTCTAGACACAGAACGGTGGGGG + Intergenic
998161507 5:139815202-139815224 GTGGAGACTGAGGAGGGTGGAGG - Intronic
999007825 5:148002057-148002079 CCTGTGACTCATAAGGGTGGGGG + Intergenic
999372368 5:151063833-151063855 CTGGAGCCTCAGAAGCCAGGCGG - Intronic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
1000245677 5:159446854-159446876 CTGGAGACTCTGAGGGCAGGTGG - Intergenic
1000268213 5:159658104-159658126 CTGGGGTCACAGGAGGGTGGGGG + Intergenic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1000747449 5:165052146-165052168 CTGGAGACTTGGAAGGGTAAGGG + Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1000878980 5:166674587-166674609 CCAGAGACTGAGAAGGGTAGTGG + Intergenic
1001111563 5:168900937-168900959 ATGGAGCCTCAGAAGCGTGAGGG + Intronic
1001161277 5:169317352-169317374 CTGGAGACTCGGAAGGGTCCAGG + Intergenic
1001166415 5:169373297-169373319 TTGGAGACTAAGAAGTGGGGAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001529045 5:172449435-172449457 CTGCAGATTCAGAGAGGTGGAGG - Intronic
1001652309 5:173324561-173324583 CTGGAGAGTCAAAAGAGAGGGGG - Intronic
1001740880 5:174051869-174051891 CTGAGCCCTCAGAAGGGTGGAGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002769817 6:281327-281349 TTGCAGACTCAGAGGCGTGGTGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003118367 6:3298516-3298538 CTAGAGGCTGGGAAGGGTGGGGG + Intronic
1003747765 6:9022447-9022469 CCAGAGACACAGAAGGGAGGGGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004675572 6:17838760-17838782 ATGGAGACTTGGAAGGGTGAGGG + Intronic
1004822419 6:19381985-19382007 GTGGAGATACAGCAGGGTGGTGG - Intergenic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005285184 6:24318558-24318580 TTAGAGACTCAGAAGGATGCTGG - Intronic
1005394866 6:25370920-25370942 TTGGTGACTCAGAAGAGGGGAGG - Intronic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006447006 6:34085226-34085248 CTGGAGACTCAAGCTGGTGGAGG + Intronic
1006664343 6:35679758-35679780 CTAGAGACTCAGAAGAGGGCAGG + Intronic
1007350064 6:41265870-41265892 ATAGAGACTCAGAAGAGTGAGGG + Intergenic
1007621347 6:43216680-43216702 CTTGACACTCTAAAGGGTGGTGG + Intronic
1008117523 6:47569240-47569262 ATGGAAACTCAGAAGAATGGTGG + Intronic
1008439246 6:51513876-51513898 CTGGGGAGTCAGTAGGGTGGGGG + Intergenic
1009030440 6:58050970-58050992 CTAGAGGCTGAGAAGGGTGTGGG - Intergenic
1009205972 6:60802138-60802160 CTAGAGGCTGAGAAGGGTGTGGG - Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009387267 6:63100238-63100260 CTGCTGACTCACAAGGGTGGTGG + Intergenic
1009514503 6:64597694-64597716 CTGGAGACTTAAAAGGGTGGGGG + Intronic
1009691320 6:67036796-67036818 CCAGAGGCTCAGAAGGGTAGTGG - Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011310551 6:85975366-85975388 CTCCTGACTCAGAAGGGTCGGGG + Intergenic
1011428966 6:87264707-87264729 CTGAAGAAGCAGATGGGTGGTGG + Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1011737196 6:90322923-90322945 CTGCTGACTCATCAGGGTGGTGG + Intergenic
1011969505 6:93204889-93204911 CTAGAGACTGGGAAGGGTGGTGG - Intergenic
1012012989 6:93815233-93815255 ATAGGGACTCAGAAGGGTGGGGG + Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012351813 6:98260744-98260766 CTGGAGATTCAGAAGTGAGGAGG - Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1012924386 6:105252972-105252994 CTGGAGAACAAGATGGGTGGTGG + Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013858448 6:114604544-114604566 TTGGAGTCTCAGAAGTGGGGAGG + Intergenic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014069932 6:117169089-117169111 CTGAAGCCTGAGAAGGATGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015287075 6:131497862-131497884 TTGGGGAGTAAGAAGGGTGGTGG + Intergenic
1015365920 6:132398052-132398074 ATAGAGACTCAAAAGGGTGAAGG - Intronic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015678094 6:135772909-135772931 CCAGAGGCTGAGAAGGGTGGTGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018049108 6:159992370-159992392 CTGGAGACTCAGAAAGGTTGGGG - Intronic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019136782 6:169913765-169913787 CTGGAGACTGTGGGGGGTGGGGG - Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019408152 7:894624-894646 CTGGAGAGTCAGAAGAGTCAGGG - Intronic
1019645133 7:2124891-2124913 CTGGAGCTTGAGAAGGGTGCAGG + Intronic
1019708651 7:2508353-2508375 CTGGAGACTCCGGAAGGAGGAGG - Intergenic
1019822463 7:3255548-3255570 CTGCTGACTGAGCAGGGTGGTGG - Intergenic
1019892729 7:3959572-3959594 ATGGGGACTCACAAGGGTGTGGG - Intronic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020632093 7:10651737-10651759 CTGGGGACTCCAAAAGGTGGAGG + Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021416529 7:20392681-20392703 ATGGAGACTTGGAAGGGTGAGGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021565675 7:22014301-22014323 CTATACACTCAGAAGGGTGCTGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1021891887 7:25194293-25194315 CTGGAGAGTCAGGAGGGCTGAGG + Intergenic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1023693944 7:42825449-42825471 CAGGAAGCTCAGAGGGGTGGGGG - Intergenic
1023840365 7:44093715-44093737 ATGGAGACTGAGAGGGGCGGGGG + Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024284348 7:47744409-47744431 CTGGACGCCCAGAGGGGTGGAGG + Intronic
1024592967 7:50905680-50905702 CTGGAGACTACTATGGGTGGAGG + Intergenic
1024659867 7:51483189-51483211 CTCCAGACTCAGCAGGGTGGCGG - Intergenic
1024932360 7:54677287-54677309 CTGCTGACTGAGCAGGGTGGTGG - Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1025736939 7:64158931-64158953 CTGAAGACTCAGGCGAGTGGTGG - Intronic
1026070995 7:67119483-67119505 CCGAAGACTCAGAAGGGAGAAGG - Intronic
1026663967 7:72326015-72326037 CTGGCCACTCAGAAGGCTTGAGG - Intronic
1026940930 7:74287598-74287620 TTGGAGACTAATAAGGGAGGAGG - Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029361138 7:100089277-100089299 CTGGGGACTACTAAGGGTGGAGG - Exonic
1029650330 7:101886956-101886978 GTGGGGGCTCAGCAGGGTGGGGG - Intronic
1029805036 7:102987139-102987161 CTGGAGACTCTGAAAGGGAGAGG + Intronic
1030110997 7:106026855-106026877 CTGGAGAATGGGAAGGGTGGGGG + Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030407760 7:109136152-109136174 CTGGAGGCTGGGAAGGGTAGTGG - Intergenic
1030686685 7:112494148-112494170 CTGGGAACTCCGAAGGGTGAGGG + Intergenic
1030688057 7:112506729-112506751 CTGGAGACTTGCAAGGGTAGGGG - Intergenic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1033064283 7:138138683-138138705 TTAGAGACTCAGAAGGGAAGAGG + Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034339773 7:150344754-150344776 CTGGCTACTCAGGAGGCTGGCGG + Intergenic
1034739509 7:153460871-153460893 CTAGAGGCTGGGAAGGGTGGTGG + Intergenic
1035046108 7:155967587-155967609 CTGGAGGCTGGGAAGGGTAGGGG - Intergenic
1035124792 7:156600739-156600761 CTGGAGCCTCGGAAGGGCGGGGG + Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035518187 8:254665-254687 CTGGGGACTGACAAGGGTGGGGG + Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037478470 8:19280474-19280496 TTGGAGACTCAGAAGTGCAGAGG - Intergenic
1037581960 8:20250689-20250711 CAGGAGAATCAGAGGGGAGGCGG - Intronic
1037712393 8:21365314-21365336 TTGGAGACTTGGAAGGGTGGAGG - Intergenic
1037808364 8:22070824-22070846 ATGGCAACTCAGAAGGGTGTGGG - Intronic
1038397604 8:27258613-27258635 CTGGAGAACCAGAGGGGTGAGGG + Intergenic
1038527091 8:28284604-28284626 CTGCTGACTCATCAGGGTGGTGG - Intergenic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1038946451 8:32366351-32366373 CTAGAGGCTGAGATGGGTGGAGG - Intronic
1039020197 8:33196827-33196849 CTGGAGACTAAGTATGATGGCGG - Intergenic
1039052428 8:33507044-33507066 GTGGAGACTCAGGAATGTGGAGG + Intronic
1039071772 8:33655424-33655446 CTAGAGGCTGGGAAGGGTGGTGG - Intergenic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039241746 8:35564751-35564773 CTGGATTCTCAGAAGTGGGGAGG - Intronic
1039304802 8:36249838-36249860 CTGGAGACCCAGGAGGGTTGTGG + Intergenic
1039619917 8:38987376-38987398 ATTTAGACTCAGAAGGTTGGCGG + Intronic
1039836131 8:41257714-41257736 CTGGAGACTCAGAAGATCAGAGG - Intergenic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1039983997 8:42432692-42432714 CTGCTGACTCATCAGGGTGGTGG - Intronic
1040102658 8:43519289-43519311 CATGAGATTCAGAAGGGTCGAGG + Intergenic
1040362143 8:46676067-46676089 CCAGAGGCTGAGAAGGGTGGTGG + Intergenic
1040363396 8:46689234-46689256 CCGGAGGCTAAGAAGGGTAGTGG - Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040883920 8:52238842-52238864 TGGGAGACTCGGAAGGGTGGGGG + Intronic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041432422 8:57798171-57798193 CTGATGACTGAGTAGGGTGGTGG - Intergenic
1041499583 8:58525933-58525955 CTGGAAAGTCAGAAAGGTGAGGG + Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1042008837 8:64215614-64215636 CTAGAGACTGAGAAGGGTAATGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042482737 8:69322568-69322590 CTGGAGACCCAGAAAGGAGCTGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043389096 8:79774162-79774184 TCGGAGACTCGGAAGGGTTGGGG - Intergenic
1043389190 8:79775420-79775442 AAGGAGACTCAGAAGAGTAGGGG - Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1043747048 8:83887457-83887479 CCAGAGACTGAGAAGGGTAGTGG - Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045884160 8:107076600-107076622 CCTGAAGCTCAGAAGGGTGGGGG - Intergenic
1046202327 8:110943312-110943334 CTAGAGGCTCAGAAGGGTAGTGG + Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1046825875 8:118690799-118690821 TTGGAGTCTCAGAAGTGGGGAGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046985686 8:120385801-120385823 TTGGCAACTCAGAAGGGTGAAGG - Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047059673 8:121210741-121210763 TGGGAGACTCAAAAGGGAGGAGG - Intergenic
1047102531 8:121694111-121694133 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1047508445 8:125497856-125497878 ATGGAGAGTCAGCAAGGTGGGGG + Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047899866 8:129408413-129408435 CTGGAGATTCAGAAGGGTTGGGG - Intergenic
1047934138 8:129760197-129760219 CCTGAGACTGGGAAGGGTGGTGG + Intronic
1048714330 8:137251155-137251177 AGGGAGACTCAGAAGGGTGCAGG + Intergenic
1048861986 8:138730351-138730373 CTGGAGACCCAGTATGGCGGTGG + Intronic
1048998576 8:139809804-139809826 CTGGTGGCTCAGCAGGGTGGTGG - Intronic
1049133168 8:140867604-140867626 CTGGGGACTAACAAGAGTGGTGG + Intronic
1049482775 8:142834808-142834830 CGGGAGGCTCAGATGGCTGGAGG + Exonic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1051127535 9:13821433-13821455 CTGGAGTGGCAGAAGGGTAGTGG - Intergenic
1051304763 9:15697788-15697810 CTGCTGACTCATCAGGGTGGTGG + Intronic
1052060150 9:23950212-23950234 CTAGAGGCTGGGAAGGGTGGTGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052208163 9:25869004-25869026 GTGAAGACTCAGAAAGGAGGAGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052733314 9:32314988-32315010 CCAGAGACTGGGAAGGGTGGTGG + Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053217514 9:36284445-36284467 CTGGTGACTGATCAGGGTGGTGG + Intronic
1053301905 9:36958449-36958471 CTGGAGACTTGGAGGGTTGGTGG + Intronic
1053475498 9:38379335-38379357 CTGGAGCCTCAGAAAGGAGCAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053590596 9:39510669-39510691 GTGGGGACTCAGAATTGTGGGGG + Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053848457 9:42266058-42266080 GTGGGGACTCAGAATTGTGGGGG + Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054575706 9:66854620-66854642 GTGGGGACTCAGAATTGTGGGGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1055309178 9:74960737-74960759 CTGTTGACTCATCAGGGTGGTGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1056455254 9:86753532-86753554 CAGGAAACTCAGAAGAGTGGGGG + Intergenic
1057250322 9:93495714-93495736 CTGCTGACTGATAAGGGTGGTGG + Intronic
1057977146 9:99618137-99618159 CTGGAGACTCAGAAGAGTAGGGG + Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058634958 9:107029444-107029466 CTGGTGACTAAGTAAGGTGGGGG + Intergenic
1058660586 9:107263866-107263888 CTGGAGATTCATATGGGTGTTGG + Intergenic
1059236395 9:112764011-112764033 AAGGAGACTCGAAAGGGTGGAGG - Intronic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1059973528 9:119692108-119692130 CTGGGGACTCAGAAGAGGAGAGG - Intergenic
1059990082 9:119856775-119856797 ATGGAGACTGGGAAGGGTGAAGG - Intergenic
1060187813 9:121574722-121574744 CAGGAGACCCAGTGGGGTGGTGG - Intronic
1060208139 9:121694550-121694572 CTGGAGAAGCAGCAGGGTTGTGG + Intronic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1061238914 9:129358014-129358036 CTGGAATCCCAGATGGGTGGAGG - Intergenic
1062344532 9:136108850-136108872 CTCCAGGCTCAGGAGGGTGGAGG + Intergenic
1062560320 9:137138743-137138765 CTGGAGCTCCAGAGGGGTGGGGG - Intronic
1062604110 9:137336124-137336146 CTGGAGGCTCAGAGGTGGGGAGG + Intronic
1062725189 9:138069015-138069037 CTGGACACCCAGCAGGTTGGGGG + Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1203375609 Un_KI270442v1:373678-373700 ATGGAGACTCGGCAGGGTGAGGG + Intergenic
1185487025 X:489807-489829 CTGGAGACTGAGATGGGTACGGG + Intergenic
1185783142 X:2866511-2866533 CTAGAGACTAGGAAAGGTGGGGG + Intronic
1185863460 X:3601240-3601262 CTAGAGGCTGGGAAGGGTGGGGG + Intergenic
1185867630 X:3637444-3637466 CAGGAGACTGAGAAGGCTTGGGG + Intronic
1185913671 X:4010375-4010397 CTGGAGACCCAGGAAGCTGGTGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186638545 X:11430890-11430912 ATGGACACTCAGAAGGGCAGTGG - Intronic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187070057 X:15879278-15879300 CTGCAAAGCCAGAAGGGTGGAGG - Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187760256 X:22575667-22575689 CTGTTGACTCATAAGGGTGGTGG - Intergenic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188220903 X:27540554-27540576 CTAGAGGCTAAGAAGGGTGTGGG + Intergenic
1188577335 X:31667494-31667516 CAGGAGACTGGGAAGGGTAGTGG + Intronic
1188699771 X:33243870-33243892 ATGGGGAATCAGAAGGGTGGAGG + Intronic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189424597 X:40886762-40886784 CTGCTGACTGAGCAGGGTGGTGG + Intergenic
1189494377 X:41495827-41495849 ATGGAAATTCAGAAGGGTGAGGG - Intergenic
1189507582 X:41627561-41627583 CTAGAGACTCAGAATAGGGGAGG - Intronic
1189607026 X:42689720-42689742 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
1190580234 X:51886112-51886134 CCAGAGGCTGAGAAGGGTGGGGG + Intronic
1190713138 X:53083493-53083515 CTGGAGATGATGAAGGGTGGTGG + Intronic
1190935428 X:54995009-54995031 ATGGAGATTTAGGAGGGTGGAGG + Intronic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191704204 X:64076514-64076536 CTGGAGGCTCGGAAGAGTAGTGG + Intergenic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192068096 X:67907964-67907986 CCAGAGACTGAGAAGGGTAGTGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192549319 X:72041565-72041587 CTGCAGCCTCAGGAGAGTGGAGG + Intergenic
1192688908 X:73338488-73338510 CTAGAGACTGAGAAAGGTAGGGG + Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193065207 X:77252544-77252566 CTGGAAACTCAGAAGTGAAGAGG + Intergenic
1193100403 X:77604985-77605007 ATGGAGACTTGGAAGGGTCGGGG + Intronic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1193692477 X:84663488-84663510 GTGGATATTCAGAAGGGTGATGG + Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194832074 X:98635651-98635673 CTAGAGCCTGAGAAGGGTAGTGG + Intergenic
1194874478 X:99169671-99169693 CTGGAGACTCAAAAGCAAGGAGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195452206 X:105028167-105028189 CCAGAGACTGGGAAGGGTGGTGG + Intronic
1195484137 X:105383261-105383283 CCAGAGGCTCAGAAGGGTAGTGG - Intronic
1195648133 X:107255717-107255739 CTGGAGGCTGTGAAGGGTAGAGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1196993408 X:121353777-121353799 CAGGAAACTTAGAATGGTGGTGG - Intergenic
1197142937 X:123136709-123136731 CTGGGGACTGGGAAAGGTGGAGG + Intergenic
1197339405 X:125247355-125247377 CTGGAGACTTGAAAGGGGGGTGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197653439 X:129089902-129089924 CTAGAGTCTGGGAAGGGTGGAGG + Intergenic
1197708496 X:129650404-129650426 CTGCAGGCTCAGAAGCCTGGGGG - Intronic
1198004800 X:132482062-132482084 CTAGAGCCTGGGAAGGGTGGGGG + Intronic
1198319684 X:135507590-135507612 TTGGCGACTCAGAAGTGGGGAGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199326733 X:146507430-146507452 TTGGAGAATCAGAAGGGGAGAGG + Intergenic
1199492352 X:148414513-148414535 ATGGAGATTAAGGAGGGTGGGGG - Intergenic
1200182963 X:154162366-154162388 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200188617 X:154199480-154199502 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200194266 X:154236621-154236643 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200200022 X:154274424-154274446 CAGGAGGCCCAGGAGGGTGGCGG + Intronic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201145241 Y:11061156-11061178 CAGGAGACTCAGAAGTGTGATGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202057395 Y:20849204-20849226 CTGGAGCCTTTGAGGGGTGGAGG - Intergenic