ID: 950207738

View in Genome Browser
Species Human (GRCh38)
Location 3:11093403-11093425
Sequence GAGCCAGGTGTGGAACGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950207738_950207746 25 Left 950207738 3:11093403-11093425 CCTCACCGTTCCACACCTGGCTC No data
Right 950207746 3:11093451-11093473 CGAGCCAAGTGCAGCCCTCCAGG No data
950207738_950207742 -7 Left 950207738 3:11093403-11093425 CCTCACCGTTCCACACCTGGCTC No data
Right 950207742 3:11093419-11093441 CTGGCTCACCCTTGAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950207738 Original CRISPR GAGCCAGGTGTGGAACGGTG AGG (reversed) Intergenic
No off target data available for this crispr