ID: 950215049

View in Genome Browser
Species Human (GRCh38)
Location 3:11153484-11153506
Sequence GTGTGGGGGTGGGGGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1874
Summary {0: 1, 1: 0, 2: 11, 3: 172, 4: 1690}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950215049 Original CRISPR GTGTGGGGGTGGGGGTCAGA GGG (reversed) Intronic
900032690 1:382234-382256 ATGTGGGGGTGTGGGTGTGACGG + Intergenic
900157425 1:1208864-1208886 GGGTGGGGGAAGGGGTCAGGTGG - Intergenic
900292471 1:1929338-1929360 GTATGGGGTTGGGGGTGACATGG + Intronic
900303301 1:1988823-1988845 GGGTGGGGGTGGGGGTGGGGGGG - Intronic
900336523 1:2166728-2166750 GGGTGGGGGTGGGGGGCTGAAGG - Intronic
900589394 1:3453064-3453086 GTGTGGGGTTGGGGGTAACTTGG + Intergenic
900602638 1:3509650-3509672 GTGTGGGGGTTGGGGACAGTGGG - Intronic
900623725 1:3598830-3598852 GGGTGGGGGAGGGGCTCTGAGGG - Intronic
900787478 1:4657714-4657736 GGGTGGGGGTGGGGGTGGGGTGG + Intronic
901002543 1:6155756-6155778 GGATGGGGGTGCAGGTCAGAAGG - Intronic
901017779 1:6241790-6241812 GTGTCGGGGTTGGGGTCGGGGGG + Intergenic
901019344 1:6248070-6248092 GTGTAGGGGTAGGGGTCTGGAGG + Exonic
901442849 1:9290067-9290089 GTGTGGGGGTGGGGTGGAGTTGG + Intergenic
901703056 1:11055745-11055767 GTCTGGGGGTGGGGGTTGGGGGG - Intronic
901738045 1:11324748-11324770 GTGTGGGGGCGGCGGTCATTAGG - Intergenic
901905616 1:12406937-12406959 GTGAGAGGGTGGGGGTTAGGGGG + Intronic
902194469 1:14788195-14788217 GTTTGGGGCTGGGGGTAGGATGG - Intronic
902255285 1:15185042-15185064 TTTGGGGTGTGGGGGTCAGATGG - Intronic
902286532 1:15411279-15411301 GGGTAGGGGTGGGGGTAACAGGG - Intronic
902370637 1:16004750-16004772 GGGGGTGGGTGGGGGTCTGATGG + Intronic
902455485 1:16530809-16530831 GGGTGGGGGTGGGGGTGGGGTGG + Intergenic
902505876 1:16938882-16938904 GGGTGGGGGAGGGAGGCAGAAGG - Intronic
902513256 1:16977267-16977289 GAGTGGAGGCGGGGGTCACAAGG + Intronic
902583007 1:17421013-17421035 CTGGGAGGGTGGGGGTCTGAGGG - Intronic
902590353 1:17469524-17469546 GGGTGGGGGTGGGGGTGGGGGGG + Intergenic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
902789444 1:18756713-18756735 GTGTGGGGGTGAGGGGTAGATGG + Intergenic
902813922 1:18905170-18905192 GTCTTGGGGTGGGGATCTGAGGG - Exonic
903126264 1:21250130-21250152 GAGTGGGGGTTGGGGCCAGTGGG - Intronic
903329123 1:22588259-22588281 ACGTGGGGCTGGGGGTCTGAGGG - Intronic
903385766 1:22925162-22925184 GTGTAGGGCTGGGGGGCTGAGGG - Intergenic
903395336 1:22997690-22997712 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
903435076 1:23343755-23343777 GGATGGGGGTGGGGGGCGGAAGG - Intronic
903738799 1:25546149-25546171 ATGTGGGGGTGGGGGTGCTAGGG + Intronic
903810916 1:26034731-26034753 GCTTGGGGATGGGGGTCAAAGGG + Intronic
903832593 1:26183859-26183881 CTGTGGAGGGGGGGGTCTGAAGG - Intronic
904005837 1:27362757-27362779 GGGTGGGGGTAGGGGGCACAGGG + Intronic
904043447 1:27597139-27597161 GTATGGGGGTGGGGGGCAGGTGG + Intronic
904253483 1:29240228-29240250 GTCGGGGGGTGGGGGTCAATTGG + Intronic
904499365 1:30905308-30905330 GGGTGGGGGTGGGGGTGGGGTGG - Intronic
904517165 1:31065513-31065535 GAGTGGTTGTGGGGGTGAGAAGG - Intronic
904664007 1:32106135-32106157 GTGTCGAGGTGGGGGACAGGAGG + Intergenic
904756548 1:32771479-32771501 GGGTGGGGGAGGGGGCCAGTTGG - Exonic
904831229 1:33307729-33307751 GGGTGGGGGTGGGGGGGAGGTGG - Intronic
904842073 1:33379322-33379344 GTGGGGGGGTGGGGGGCAGGGGG - Intronic
905435307 1:37951574-37951596 GTGTGGGGCTGGGGCTGTGAGGG - Intergenic
905549904 1:38829200-38829222 GTGTAGGGCTTGGAGTCAGAAGG + Intergenic
905892518 1:41526220-41526242 GTGTGAGGGTGGGGGTGTGGTGG - Intronic
905892598 1:41526636-41526658 GTGTGAGTGTGGGGGTGTGAGGG - Intronic
905894727 1:41538112-41538134 CAGTGGGGGTGGGTGTCAGGTGG + Intronic
905896458 1:41549019-41549041 GTTGGGGGGTGGGGGGCAGGGGG - Intronic
905898134 1:41562339-41562361 GTCTGGGGGTGGGGCTGAGAGGG + Intronic
905930455 1:41783232-41783254 GTGTGGGTGTTGGGGCCAGGAGG + Intronic
906049227 1:42856942-42856964 GGGCAGGGGTGGGGGTCACATGG - Intergenic
906279346 1:44542878-44542900 GAGTGGGGCTGGGGGCCGGAGGG + Intronic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906654335 1:47536904-47536926 GGGTGGGGGTGGGGGTCCCCTGG + Intergenic
906952970 1:50349430-50349452 GAGTGGGGGTGTGGGTCACTGGG - Intergenic
907073627 1:51559285-51559307 GTGTGGGGGTGGGGGTTGCGGGG + Intergenic
907332151 1:53678331-53678353 GGGGGGGGGTGGGGGGCAGGGGG + Intronic
907400977 1:54224635-54224657 GTGGGTGGGTGGGAGACAGAGGG - Intronic
907429262 1:54402513-54402535 GGGTGGGAGTGGGGGTGAGGTGG - Intronic
907438005 1:54461938-54461960 GAGTGGGGGCTGGGGGCAGAGGG + Intergenic
907679554 1:56550716-56550738 GTGTGGGGGTGGGTGGGAGGAGG - Intronic
908426706 1:64014498-64014520 GTGTTGGGGTGGGTGTGATAAGG + Intronic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
909171560 1:72302446-72302468 GTGTTGGGGTTGGGGCCCGATGG + Intergenic
909235109 1:73143121-73143143 AGGTGGGGTTGGGGGTCACAAGG + Intergenic
909698054 1:78489699-78489721 GTTAGGGGGTGGGGGGCAGGGGG + Intronic
909736461 1:78968502-78968524 GTGGGGGGGTGGGGGGGAGACGG + Intronic
909781969 1:79558854-79558876 CTGTGGTGGTGGTGGTCACATGG + Intergenic
909977980 1:82067709-82067731 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
910112999 1:83701896-83701918 GTGAGGGGTTGAGGGTCAGCAGG - Intergenic
910159633 1:84259331-84259353 GGGTGGGAGTGGAGGTCAGTTGG + Intergenic
910269421 1:85377705-85377727 GTATGGGGGTGGGGGGATGAGGG - Intronic
910768411 1:90806443-90806465 GTGTGGGGGTGGGGAGTAGGGGG + Intergenic
910884090 1:91947918-91947940 GGCTGGGGGTGGGGGTGGGAAGG - Intergenic
911433842 1:97829893-97829915 GTCTGGGGGTGGGGGGCTGAGGG - Intronic
911605934 1:99905200-99905222 GTGGGGGGGTGGGTCTGAGATGG + Intronic
911745621 1:101438890-101438912 GTGTATGGGTGGGGGTGAGGGGG + Intergenic
911750442 1:101490588-101490610 GTGTGTGGGTGGGGGTGGGGTGG + Intergenic
912495456 1:110088747-110088769 GCGTGGGGGTGGGGGTCCCCAGG - Intergenic
912517855 1:110227172-110227194 GTCTGGGGTTTGGGGACAGAGGG - Intronic
912633796 1:111271802-111271824 GGGTGGGGGTGGGGGACAATGGG - Intergenic
912637615 1:111312789-111312811 GTGTGGGGATGGGGGTTGGGGGG - Intronic
912638357 1:111320102-111320124 GTGTGGAGGTGGGGTGCAGTTGG - Intronic
912658482 1:111508183-111508205 GTGTGGGTGGGGGGGTCTGGTGG - Intronic
912823537 1:112885908-112885930 GTGTGGGGGTGGGGGCAGGGAGG - Intergenic
912939460 1:114032274-114032296 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
913020396 1:114783844-114783866 GTTGGGGGGTGGGGGGCAGGGGG - Intergenic
913027863 1:114863968-114863990 GTTGGGGGGTGGGGGGCAGGGGG + Intronic
913223868 1:116681388-116681410 ATTTGGGGGTGGGGATGAGATGG + Intergenic
913444298 1:118933445-118933467 TTTTGTGGGTGGGGGGCAGAGGG - Intronic
914514502 1:148362612-148362634 GGGTGGGGGTGGGGGGCGGTGGG - Intergenic
914764049 1:150622564-150622586 GGGTGGGGGTGGGGTTGAAAGGG - Intronic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
914899069 1:151702519-151702541 GGGTGGGGGTGGGGGTGGTAAGG - Exonic
915034679 1:152911694-152911716 GGGTGAGGGTGGGGGAGAGAGGG + Exonic
915217510 1:154349909-154349931 GTGTGTGTGTTGGGGGCAGAGGG - Exonic
915217890 1:154352204-154352226 GGGTGGAGGTGGGTGTCAGGTGG - Intergenic
915301317 1:154953195-154953217 GTGTGGGGCTTTGGGTTAGAGGG - Intronic
915337154 1:155151430-155151452 TTGGGGGGGTGGGGGAGAGAGGG - Intergenic
915518456 1:156427733-156427755 GTGTGTGGGTTGGGGTAAGCTGG + Intronic
915520130 1:156437074-156437096 GTTGGGGGGTGGGGGTCTGCTGG - Intergenic
915532672 1:156512134-156512156 GCGTGGGGGTGGGGGGTGGAAGG + Intergenic
915570858 1:156744444-156744466 GGGTGGGGGTGGGGGAGAGGCGG - Intronic
915594480 1:156888306-156888328 GGGTGAGGGAGGGGATCAGATGG + Intergenic
915778852 1:158522627-158522649 GTGTGGGGTTGGGGGGCAAGGGG + Intergenic
916147044 1:161749585-161749607 CTTTGGGGGTAGGGGTCAGAGGG + Intergenic
916169280 1:161988549-161988571 GTGGGTGGGTGGGTGTCAGCGGG - Intronic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916522387 1:165575877-165575899 GCGTGGGCCTGGGGGTCAGGAGG - Intergenic
916586488 1:166154225-166154247 GTGTGTGGGTAGGGGCCAGGAGG + Intronic
916719583 1:167474204-167474226 GTCTGGGGGTGGGGCTGGGAAGG + Intronic
916941494 1:169683271-169683293 GGGCAGGGGTGGGGGTCACAAGG - Intronic
916942281 1:169688516-169688538 GGGTAGGGGTGGGGGTCACAAGG - Intronic
917196932 1:172476585-172476607 GTGTGTGTGTGTGTGTCAGAGGG + Intergenic
917201191 1:172517310-172517332 GTGTGTGTGTGCGTGTCAGAAGG + Intergenic
917288653 1:173448602-173448624 GGATGGGAGTGGGGGTCACAAGG + Intergenic
917320671 1:173778216-173778238 GTCGGGGGGTGGGGGGCTGAGGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
918026603 1:180755600-180755622 TTGTGGAAGTGGGTGTCAGAAGG - Intronic
918032705 1:180831541-180831563 GTTGGGGGGTGGGGGGCAGGGGG - Intronic
918124665 1:181572487-181572509 CTGTGCTGGTGGTGGTCAGAGGG + Intronic
918222277 1:182445652-182445674 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
918333395 1:183482220-183482242 GTGTGGGGGTGGGGGGTCTAAGG + Intronic
918910104 1:190556398-190556420 TTCTGGGGGTGGGGGTCTAAGGG + Intergenic
919253538 1:195092632-195092654 GTGGGGTGGAGGGGGTCAGATGG - Intergenic
919464805 1:197914714-197914736 GGGGTGGGGTGGGGGTCAGCTGG - Intronic
919727785 1:200895174-200895196 TGGCGGGGGTGGGGGTCGGAGGG - Intronic
919805922 1:201380983-201381005 GCATGGGGGTGGGGGTTGGAGGG + Exonic
919937847 1:202266456-202266478 GGGTGGGGGTGGGGATGTGAAGG - Intronic
919962461 1:202485405-202485427 ATGTGAGGGTGGGGGGCAGGGGG + Intronic
919989791 1:202701948-202701970 GTGTGTGGCTGGGAGTCAGATGG - Intronic
920068991 1:203289216-203289238 GGGTGGGCTTTGGGGTCAGATGG - Intergenic
920176495 1:204104999-204105021 GTGGGTTGGTGGGGTTCAGAGGG + Intronic
920314338 1:205066670-205066692 GTTTGGGGATCGGGGTCTGAGGG + Intronic
920337802 1:205256959-205256981 GGGTGGGGGTGGGGGGCAAAGGG - Intronic
920432444 1:205927635-205927657 GTGTGGGGCTGGGGGGCACGGGG + Intronic
920545948 1:206818539-206818561 GAGTGGGGATGTGGGTGAGAGGG + Intronic
920687705 1:208121989-208122011 GTGTGCAGGTGGGGGTATGAGGG - Intronic
920743768 1:208606324-208606346 GTGTGGGGGTGGCGAACACATGG - Intergenic
920983175 1:210857450-210857472 GCATGGGGGTGGGGGTGAGGGGG + Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921289035 1:213637412-213637434 GGGTGGGGGTGGGAGGCAGGGGG + Intergenic
921520820 1:216152479-216152501 GGGTGGGAGTGGGGGTCGCAAGG - Intronic
921589868 1:216990933-216990955 GGGTGGGGTTGGGGGGCAGTTGG - Intronic
921882580 1:220271920-220271942 GTGTGGGGGTGGGGGGAGGGAGG + Intronic
921939841 1:220828116-220828138 GTATGGGGGTGGGGGGCAGCTGG - Intergenic
922168829 1:223138133-223138155 GTGTGGGGGTGGGGGTGGAGGGG + Intronic
922209976 1:223479181-223479203 GTGGGGGGGAGGGGGTTAGGAGG + Intergenic
922324216 1:224513344-224513366 GGGTGGGGGTGGGGGTGGGAGGG + Intronic
922702791 1:227771651-227771673 GGGTGGGGGTGGGGGTGGGCGGG - Intronic
922717498 1:227885063-227885085 GTGGGTGGGTGGGGGTCCCATGG - Intergenic
923015038 1:230120161-230120183 GGGTGGGGGTGGGGGTGAGTGGG + Intronic
923026275 1:230206964-230206986 GTTTTGGAGTGGGGGTCAGGGGG - Intronic
923740059 1:236646794-236646816 GTTGGGGGGTGGGGGGCAGGAGG - Intergenic
923886687 1:238165021-238165043 GTTTGGGGTTGGGGGAGAGATGG + Intergenic
924139756 1:241010038-241010060 GTGTGGGGCTGGGGGAGGGATGG + Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924428903 1:243979594-243979616 GTGTGGGGGGGTGGGACGGAAGG + Intergenic
924497991 1:244608577-244608599 GATTGGGGGTTGAGGTCAGAGGG - Intronic
1062771240 10:103284-103306 GCGTGGGGCTGGGGGTGAGGGGG - Intergenic
1062931265 10:1354372-1354394 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1063057431 10:2521090-2521112 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057455 10:2521202-2521224 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057467 10:2521258-2521280 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057624 10:2521866-2521888 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057967 10:2523252-2523274 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057974 10:2523280-2523302 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057986 10:2523330-2523352 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063057993 10:2523358-2523380 GTGTGGGTGTGGGTGTCACCTGG - Intergenic
1063058013 10:2523441-2523463 GTGTGGACGTGGGTGTCACACGG - Intergenic
1063058041 10:2523553-2523575 GTGTGGAGGTGGGTGTCACCCGG - Intergenic
1063292558 10:4764369-4764391 TTGTGGAGGTGGGCGTCAGGTGG + Intergenic
1063371713 10:5526595-5526617 GTGAGGGGTTGGGGGGCAGTTGG + Exonic
1063570866 10:7213461-7213483 TTGTGGGGGTGGTGGTGGGAGGG + Intronic
1063792418 10:9467806-9467828 GGGTTGGGGTGGGGGTGGGAAGG + Intergenic
1064128969 10:12690747-12690769 GTGCGGGGGTGAGGGTCATGGGG + Intronic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064475012 10:15678648-15678670 GTGTGGGAGTGAGAGGCAGAGGG + Intronic
1064645269 10:17453985-17454007 GAGTGGGGGAGGGGGTCGCAGGG - Intronic
1065442690 10:25769143-25769165 GGGTAGGAGTGGGGGTCACAAGG + Intergenic
1065585321 10:27211954-27211976 AAGTGGGGGTGGGGGTAGGAAGG + Intronic
1065617327 10:27541819-27541841 GGGTGGGGGTGGGGGTGGTATGG - Exonic
1065773244 10:29096868-29096890 GGATGGGGATGGGGATCAGATGG - Intergenic
1065833276 10:29634026-29634048 GTATGGGGGTGGAGTTCAGAAGG - Intronic
1065917354 10:30364922-30364944 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1066013391 10:31214772-31214794 GTGTGGAGGTGGGTGCCACACGG + Intergenic
1066169634 10:32827640-32827662 GTCTGGGGGTGGGGGGCTGGGGG + Intronic
1067058221 10:43064612-43064634 GTGTGGGGGTGGGGGTCACCGGG + Intergenic
1067691979 10:48507913-48507935 GGGTGGGGGTGGGGGTGGGGGGG + Intronic
1067726153 10:48772691-48772713 GTGGTGGGGTGGGGGTAAGGGGG - Intronic
1067741183 10:48897109-48897131 GTATGAGGGTCGGGGTGAGAAGG - Intronic
1067761458 10:49050951-49050973 GTGTGGAGGTGGGGGCTATAAGG - Intronic
1067782257 10:49217216-49217238 GAGTGGGGGTGGGGGACCGGAGG - Intergenic
1067807455 10:49403068-49403090 GTGTCGGGCTGGGGATCAGGAGG - Intergenic
1067854572 10:49781057-49781079 GTGTTGGGCTGGGGATCAGGAGG - Intergenic
1067893732 10:50157664-50157686 GTTTTGGGGTGGGGGGAAGAGGG + Intergenic
1068922439 10:62498809-62498831 GTGGGGGGGTGGAGGGCAGTGGG + Intronic
1068969174 10:62945285-62945307 GAGTGGGGGTGGGGGAGAGGAGG - Intergenic
1069568467 10:69479516-69479538 GGCTGGGGGTGGGGGGCACACGG - Intronic
1069619928 10:69830905-69830927 GCCTGGGGCTGGGGGTCGGAGGG - Intronic
1069633629 10:69912540-69912562 GGGTGGGGGTGGGGGGCGGTCGG - Intronic
1069723272 10:70562677-70562699 GTTTGGGGGATGGGGTGAGAAGG + Intronic
1069886233 10:71625480-71625502 GTGATGGGGTGGAGGTGAGAAGG + Intronic
1069897325 10:71687732-71687754 GTCGGGGGGTGGGGGGCACATGG + Intronic
1069904834 10:71726183-71726205 GTGTAGGGGTGGGGGTGAAGCGG - Intronic
1069950429 10:72014788-72014810 GTCTGGGGGTGGGGGAAAGGAGG - Intergenic
1070157032 10:73841484-73841506 GGGTGAGGGTGGGGGCAAGAGGG + Intronic
1070161317 10:73868309-73868331 GTGTGGGGATGGAGGTGGGAAGG - Intronic
1070367415 10:75750481-75750503 GGCGGGGGGTGGGGGGCAGAGGG + Intronic
1070829686 10:79410799-79410821 GTCTGGGGATGGGTGGCAGAGGG + Intronic
1071064449 10:81614273-81614295 GCATGGGGATGGGGGTCGGAGGG + Intergenic
1071178964 10:82960797-82960819 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1071621823 10:87127518-87127540 GTGGGGGGGGGCGGGTAAGAGGG - Intronic
1071642075 10:87319407-87319429 GTCGGGGGGTGGGGGGCAGGGGG + Intergenic
1071798977 10:89036882-89036904 GGGTGGGGGTGGGGGTGGGAGGG - Intergenic
1071918647 10:90325117-90325139 ATTTGGGGGTGGGGGGCACAGGG - Intergenic
1072018889 10:91379388-91379410 GTGGGGGGTTGGGGGGCAGTGGG - Intergenic
1072406578 10:95159769-95159791 GTGGTGGGGTGGGGGGCAGGAGG + Intergenic
1072438751 10:95436155-95436177 GTGTGGGGGAGGGTGGCAGGTGG - Intronic
1072519075 10:96214345-96214367 GTTTGGGGGTAGGGGTGACATGG + Intronic
1072624042 10:97099451-97099473 TTGGGGGGGTGGGGGACAGCAGG + Intronic
1072681274 10:97508703-97508725 GTGTGGAGGTGGTGGTCTGGGGG - Intronic
1072719061 10:97769762-97769784 GGGTGGGGTTGGGGGACAGTTGG + Intronic
1072959183 10:99913976-99913998 GTGTGGAGGTGTGGGCCTGAGGG + Intronic
1073205642 10:101767990-101768012 GTGAGGTGGAGGGGGACAGAAGG - Intergenic
1073453177 10:103621535-103621557 CTGTGAGGGTGGGGGTCACTGGG + Intronic
1073652282 10:105374306-105374328 GTCTGGGGGTGGGGGGCTAAGGG - Intergenic
1073715579 10:106102961-106102983 GTTGGGGGGTGGGGGGCAAAAGG - Intergenic
1074432245 10:113404030-113404052 GTGTGGGGGAGGGGGCCACCAGG - Intergenic
1074538396 10:114345224-114345246 GGGTGGGGGTGGGCCTCAAAGGG + Intronic
1074672027 10:115802071-115802093 GTGTGGTGGTGGGGGGCGGAAGG - Intronic
1074783260 10:116817517-116817539 GTGTGTGGGTGGGGGTGGGGGGG + Intergenic
1075030861 10:119023816-119023838 GGTTGGGGGTGGGGGGCACATGG + Intergenic
1075438198 10:122460505-122460527 GGGTGGGGGTGGAGGTTTGAGGG + Intergenic
1075834247 10:125439987-125440009 GTGGGGGGGTGGGGGTTGGGGGG + Intergenic
1076024457 10:127100519-127100541 GTGTGGGTGTTGGGCTCAGGAGG + Intronic
1076048003 10:127310266-127310288 CTGTAGGGGTGGGGGTAAGGGGG - Intronic
1076094062 10:127716069-127716091 ATCTGGGGGTGAGGGTGAGAAGG - Intergenic
1076653565 10:132006306-132006328 GGGTGGGTGTGGGGGTGGGAGGG + Intergenic
1076902645 10:133347538-133347560 GTGTGCGGGTGGGAGGGAGAAGG + Intronic
1076908071 10:133373117-133373139 GGGTGTGGGTTGGGGTCAGGTGG + Intronic
1076939569 10:133592900-133592922 GCGTGGCGGTGGGGGGCAGGCGG - Intergenic
1077002944 11:333952-333974 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1077052219 11:572059-572081 CGGTGGGGGTGGGAGTCAGGAGG + Intergenic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077201131 11:1308211-1308233 GGGTGGGTGTGTGGGTCACAGGG + Intronic
1077300761 11:1846003-1846025 GTGAGGGGGTGAAGGTCAGGGGG - Intergenic
1077317329 11:1925334-1925356 ATGTGGGGGTGGGGGAGAGGGGG + Intronic
1077339917 11:2021679-2021701 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1077440335 11:2565939-2565961 GGGAGGGTGTGGGTGTCAGATGG - Intronic
1077883047 11:6366230-6366252 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1077883853 11:6371452-6371474 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1078324250 11:10366745-10366767 GTGGGGGGATGGGGGGCACATGG - Intronic
1078337465 11:10475420-10475442 GTGTGGGCGTAAGTGTCAGAGGG - Intronic
1078535939 11:12174344-12174366 GGGTGGGGGTGGGGAGGAGAGGG - Intronic
1078610044 11:12811852-12811874 GGGTGGGGGTGGGGGTAGGGTGG + Intronic
1078632010 11:13011095-13011117 GTGTAGGGGTGGGGGGCGGGGGG + Intergenic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1078690551 11:13575753-13575775 GTTGGGGGGTGGGGGGCAGGAGG + Intergenic
1078768497 11:14323532-14323554 GTGTGCCGGTGGGGGGAAGAGGG - Intronic
1078771984 11:14359341-14359363 GTGTGGGAGTGGGTGTCAGTTGG + Intronic
1078918399 11:15802867-15802889 GTTGGGGGGTGGGGGACAGGGGG - Intergenic
1078991169 11:16647933-16647955 TTGTGGGGGAGGGGCTCACAGGG + Intronic
1079082827 11:17425830-17425852 GTCTGGGGGTGGGGGGCAAGGGG - Intronic
1079391159 11:20023272-20023294 GTGTGTGAGTGGGGGTGGGAGGG + Intronic
1079480995 11:20879581-20879603 GTGTGTGTGTGGGTGTCAGGTGG + Intronic
1079928564 11:26527881-26527903 GTGTGTGGGTGGGGATGATAAGG - Intronic
1080206528 11:29735848-29735870 GTGGGTGGGTGGGGGACAGATGG + Intergenic
1080231192 11:30018502-30018524 GTGTGGGAGTGGGGTGGAGATGG - Intergenic
1080628280 11:34051352-34051374 GGGTGGGGGTGGGGGTTGGGGGG - Intergenic
1080768499 11:35318624-35318646 GTGTGGGTTTTGGAGTCAGAGGG + Intronic
1081160562 11:39743374-39743396 TTGTGGCAGTGGGGGTCAGTGGG + Intergenic
1081199053 11:40194616-40194638 GTCGGGGGGTGGGGGGCAAAGGG + Intronic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081551668 11:44119211-44119233 CTGTGGGGATGTGTGTCAGAGGG + Intronic
1081626076 11:44655977-44655999 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
1081628945 11:44674404-44674426 GTGTGTGAGTGGGGGTGTGAGGG + Intergenic
1081667646 11:44925873-44925895 GTGAGGTGCTTGGGGTCAGAGGG + Intronic
1081691404 11:45080903-45080925 ACCTGGGGGTGGGGGTCAGGAGG - Intergenic
1081814137 11:45929216-45929238 GTCTGGGGGTGGGGGGCGGGGGG - Intergenic
1081857841 11:46315224-46315246 GGGTGGGGTGGGGGGTCAGGTGG - Intronic
1082059390 11:47847639-47847661 GTGTGGGGGTGGGGGGGGGGAGG + Intronic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1082692497 11:56323628-56323650 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1082894275 11:58173638-58173660 CTGAGGGGGTGGGGTTCAGGGGG - Intronic
1083074307 11:60020480-60020502 GGGTGGGGGCGGGGGCCAGCCGG + Intergenic
1083265797 11:61546297-61546319 GGGTGGCGGTGGGGGAGAGAGGG + Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083306375 11:61764122-61764144 AGCTGGGGGTGGGGGTCAGCAGG + Intronic
1083311459 11:61786008-61786030 CTCTGGGGGTGCGGGGCAGATGG - Intronic
1083328268 11:61884745-61884767 GTGTGGGGGTTGGGGGGACAGGG - Intronic
1083339347 11:61948878-61948900 GTGTGGGGGTGGGGGACAAGGGG + Intergenic
1083534989 11:63459304-63459326 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1083619337 11:64041328-64041350 GTGGAGGGGTGGGGGGCAGCAGG - Intronic
1083798912 11:65035115-65035137 GGGGCGGGGTGGGGATCAGAGGG - Exonic
1083843485 11:65317401-65317423 GGGTGAGGGTGGGGGTGAGGGGG - Intronic
1084000620 11:66293551-66293573 GTCTTGGGGTGGGGAGCAGATGG - Intronic
1084411093 11:69006294-69006316 GTCTGTGGGTGGGGGCCAGCCGG - Intronic
1084859944 11:72011780-72011802 GCGGGGGAGTGGGGGTCACATGG - Intronic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1084966499 11:72747318-72747340 GTGTGGGGCTCAGGGTCAGAGGG - Intronic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085081643 11:73639511-73639533 GTGTGGGGGGTGGGGCAAGAGGG + Intergenic
1085226621 11:74927225-74927247 GGGTGGGGGTGGGGGTTGTAAGG - Intronic
1085259317 11:75195352-75195374 GGGTGGGGGTGGGAGTGGGAAGG - Intronic
1085278543 11:75315320-75315342 ATGTGGGTGTGGGGGTCAATGGG - Intronic
1085281134 11:75331584-75331606 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1085281205 11:75332033-75332055 GGGTAGGGGCGGGGGTCAAAAGG - Intronic
1085329980 11:75640176-75640198 GTGGGGGGGTGGGGGTTGGTTGG - Intronic
1085385931 11:76158429-76158451 GCCTGGGGGTGGGGGCGAGAGGG - Intergenic
1085398990 11:76224358-76224380 GGTTGGGGGTGGGGGACAGCGGG + Intergenic
1085442785 11:76578979-76579001 GAGTGGAGATGGGGGTCAGAGGG + Intergenic
1085482822 11:76836939-76836961 GTGTGGGGCAGAGGGTTAGAGGG - Intergenic
1085505603 11:77056895-77056917 GGGTGGGGGTGGGGGGCATATGG - Intergenic
1085657475 11:78330141-78330163 GGGTGTGGGTGGGGGTTAAATGG + Intronic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1085848040 11:80087980-80088002 GCCTGTGGGTGGGAGTCAGAGGG + Intergenic
1086005506 11:82030801-82030823 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1086208777 11:84293146-84293168 GTGTGGGGGTGTGGGGCGGGTGG + Intronic
1086388852 11:86339890-86339912 GTCTTGGGGTGGGGGGCAGGGGG - Intronic
1086645557 11:89215366-89215388 GTTTGGGGGTGGGGGGCTGGGGG + Intronic
1086942281 11:92810646-92810668 GAGTGGGGGTGGGGGAGATAAGG + Intronic
1087278157 11:96180925-96180947 GGGTAGGAGTGGGGGTCACAAGG + Intronic
1087384045 11:97447015-97447037 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1087560521 11:99784294-99784316 ATGTGGGGGTGGGGGGCTAAGGG - Intronic
1087839890 11:102909684-102909706 GGGTAGGAGTGGGGGTCACAAGG + Intergenic
1088269502 11:108019194-108019216 GGGTGGGGGTGGGGGTGGGGTGG + Intronic
1088363844 11:109018396-109018418 GTGTCGGGATGGGGGCCAGTGGG + Intergenic
1088427293 11:109718008-109718030 GAGTGGGGGTGTGTGTGAGATGG - Intergenic
1088537042 11:110872652-110872674 GTCTGGATGTGGGGGTAAGATGG - Intergenic
1088645372 11:111912942-111912964 GGGTGGGGGTGGGGGGCAAGGGG - Intronic
1088848968 11:113690177-113690199 GAGTGGAGGTGGGGGTGGGAGGG - Intronic
1088906582 11:114159638-114159660 GTTGGGGAGTTGGGGTCAGAGGG + Intronic
1088921467 11:114262350-114262372 GTGTTGGGTTGGGGGTGAAAGGG - Intronic
1089171004 11:116511450-116511472 GGGTGGGGGTGGGGGTGTGGGGG + Intergenic
1089185997 11:116615052-116615074 GAGTGGGGGTGGGGGTCAAGTGG + Intergenic
1089196065 11:116694693-116694715 GTGAGGGGGTGGGTGTGAGGGGG - Intergenic
1089371219 11:117959750-117959772 GGGTGGGGGTGGAGGTCAGTGGG + Intergenic
1089497139 11:118913571-118913593 GAGAGGGGGTGGGGGGCACAAGG + Intronic
1089907912 11:122064205-122064227 GTGTGGGAGTGGACATCAGAAGG + Intergenic
1090172696 11:124618649-124618671 GTGGGGGGGTGGGGGAGACAGGG + Intronic
1090202010 11:124864021-124864043 GTGTGGGGGAGGGGGTAGGTGGG - Intergenic
1090627608 11:128619892-128619914 GTGTGAGGGTGGGGGGCTGAGGG - Intergenic
1090854264 11:130598337-130598359 TGGTGGGGGTCGGGGTTAGAGGG + Intergenic
1091026789 11:132148650-132148672 GTGTGGGGGTGTGTGTGAGTGGG - Intronic
1091307039 11:134542932-134542954 GAGTGGGCCTGTGGGTCAGAGGG + Intergenic
1202822902 11_KI270721v1_random:76868-76890 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1091532628 12:1374369-1374391 GTGGGGGGGCGGTGGTTAGAGGG - Intronic
1091763757 12:3104925-3104947 GTGTGGGGGTGATGGGCAGGGGG + Intronic
1091844746 12:3647185-3647207 AGGTGGGGGTGGGGGACAGCGGG - Intronic
1092072284 12:5641220-5641242 GTCAGGGGGTGGGGGGCAGGGGG + Intronic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092260841 12:6952552-6952574 GTGCTGGGGTGAGGGGCAGACGG - Intronic
1092913718 12:13171164-13171186 GTGGGTGGGTGGGGGGAAGAGGG + Intergenic
1093071498 12:14710346-14710368 GGGTAGGAGTGGGGGTCACAAGG + Intergenic
1093072933 12:14725076-14725098 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1093098443 12:14998822-14998844 ATGTGGAGGTGGCTGTCAGATGG + Intergenic
1093281690 12:17203727-17203749 GGATGGGGGGGGGGGTCACAGGG - Intergenic
1093398648 12:18715167-18715189 GTGGGGGGGGGGGGGGCGGAGGG + Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1094042668 12:26133942-26133964 GTGTGGTGGAGGGGGATAGAAGG - Intronic
1094078305 12:26503174-26503196 GTGTGTTGGTGGGGGGCAGTGGG - Intronic
1094092027 12:26661274-26661296 GTGGGGGGGGGGGGGTGGGAGGG + Intronic
1094208547 12:27866347-27866369 GGGTGGGGGTAGGGGGGAGATGG + Intergenic
1094402246 12:30074550-30074572 GTCGGGGGGTGGGGGGCAGGGGG + Intergenic
1094524685 12:31223625-31223647 ATGTGGGGGTGCGGGACAGGAGG + Intergenic
1095445595 12:42279029-42279051 GTCTGGGGGTGGGGGGCAAGGGG + Intronic
1095805947 12:46321486-46321508 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1095830569 12:46582006-46582028 GTCAGGGGGTGGGGGTCTGGGGG - Intergenic
1095916631 12:47486598-47486620 GAGTGGGGGTGGGAGAGAGATGG - Intergenic
1096285807 12:50299222-50299244 GGGTGGGGGTGGGGGTGGGGGGG - Intergenic
1096436152 12:51592042-51592064 GGGTGGGGGTGGGGGTGGGATGG - Intronic
1096887956 12:54736434-54736456 GGGTAGGGGTGGGGGTCACAAGG - Intergenic
1097296191 12:57965561-57965583 GGGTGGGGGTGGGGGCATGAGGG + Intergenic
1097768986 12:63558434-63558456 GGGTGGGGGTGGGGGGCAAGGGG - Intergenic
1098012674 12:66071353-66071375 GTGTGGGGGTGGTGGGCCGCAGG - Intergenic
1098170996 12:67747187-67747209 GCGTGGGGGTGGGGGTGGGAAGG + Intergenic
1098343628 12:69476762-69476784 GTGTGGGGGTGGGGAACTTAAGG + Intronic
1098346971 12:69515879-69515901 GTGTGGGGGTGGGGGTGGGGCGG - Intronic
1098434785 12:70457127-70457149 GTTTGGGGGTGGGAGTAGGAAGG + Intergenic
1098639989 12:72826549-72826571 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1099103319 12:78470494-78470516 GTGTGGGAGTGGGGAGCAGGGGG - Intergenic
1099176870 12:79432357-79432379 TTGTGGGGTTGGGGGGCAGGGGG - Intronic
1099201077 12:79677975-79677997 GTTTGGGGGTAGAGGGCAGATGG - Intronic
1099835620 12:87907473-87907495 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1099836400 12:87912676-87912698 GGGCAGGGGTGGGGGTCACAGGG + Intergenic
1100227001 12:92568080-92568102 GTCGGGGGGTGGGGGTCTGGGGG + Intergenic
1100619143 12:96255100-96255122 GTATGGTGGGAGGGGTCAGAGGG + Intronic
1101270423 12:103137873-103137895 GTGTGGGGGTGGGGGCATAAAGG + Intergenic
1101700381 12:107168425-107168447 GTGTAGGCGTGGGAGTCAAATGG + Intergenic
1101706612 12:107226376-107226398 TGGTGGGGGTGGGGGGCAAAGGG - Intergenic
1101781112 12:107837015-107837037 TTGTGGGGGTGGTGTTCAGTGGG - Intergenic
1101915891 12:108895751-108895773 GTGTGAGGGTGTGTGTCTGAGGG + Intronic
1102197834 12:111036888-111036910 GGGTGGGGGTGGGGGGCTGCGGG - Intronic
1102301395 12:111774162-111774184 GGGTGGGGGAGTGGGGCAGAGGG + Intronic
1102399174 12:112613696-112613718 TGGTGAGGGTGGGGGTCTGATGG + Intronic
1102740971 12:115207295-115207317 AAGTGGGGGTGGGTGCCAGAGGG - Intergenic
1102764463 12:115420407-115420429 GTGTGAGGTTTGGGGTCAGCTGG - Intergenic
1103047288 12:117747429-117747451 GTTGGGGGGTGGGGGACAGGGGG + Intronic
1103156327 12:118688204-118688226 GGGTGGGGGTGGGCTTCTGAGGG + Intergenic
1103248742 12:119481393-119481415 GTCTGGGGGTGGGGGAGAGCAGG + Intronic
1103424721 12:120823206-120823228 GTGTGGGGGTGGGGGGTGGGGGG + Intronic
1103599175 12:122043407-122043429 GTGGGTGGGTGGGGGTCAGGGGG + Intronic
1103793861 12:123490199-123490221 GTGTGGGGACGGCTGTCAGATGG - Intronic
1103873378 12:124107275-124107297 GTGCAGGAGTGGGGGTCACAAGG + Intronic
1103953425 12:124564518-124564540 GGGTGGGGGTGGGGGTGGGGTGG - Intronic
1103953529 12:124564905-124564927 GCCTGGGGGTGGGGGGCAGGGGG - Intronic
1103961642 12:124612629-124612651 GGGAGGGGCTGGGAGTCAGAAGG - Intergenic
1103994349 12:124819548-124819570 GGTTGAGGGTGGGGGTCAGGTGG - Intronic
1104041442 12:125133865-125133887 GCATGGGGCTGGGGGCCAGAGGG - Intronic
1104048818 12:125183250-125183272 GGGTGCGGGTAGGGGTGAGATGG - Intergenic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1104305532 12:127607544-127607566 GTCTGGGCGTGGGGGTCAGATGG + Intergenic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1104788429 12:131466729-131466751 GAGTGGAGGTGGGGGTGGGATGG - Intergenic
1104945094 12:132412168-132412190 GTGTCTGGCTGGGGGTCTGAGGG + Intergenic
1105031873 12:132889757-132889779 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1105040270 12:132956009-132956031 GCGCGGGGGTGGGAGGCAGAGGG - Intronic
1105253253 13:18720383-18720405 GTGTCGGGCTGGGGGACAGTCGG - Intergenic
1105260537 13:18776036-18776058 GTGGGAGGGTGGGGGTTAGTGGG - Intergenic
1105280466 13:18960002-18960024 GTCTGCGGGTGGAGGACAGATGG - Intergenic
1105401145 13:20097155-20097177 GGGTGGGGGTGGGGGTGGGGGGG + Intergenic
1105777430 13:23676825-23676847 GTGTGAGTGGGGGTGTCAGAGGG - Intergenic
1106096866 13:26654137-26654159 GTGTTGGGGCGGGGGTCGGTGGG - Intronic
1106126950 13:26908485-26908507 GTGGAGGTTTGGGGGTCAGAAGG + Intergenic
1106136190 13:26975574-26975596 GTGTGGGGGTGGGTGTCGGGCGG - Intergenic
1106343995 13:28858590-28858612 GTTTGAGGGTGGGGGATAGATGG - Intronic
1106444174 13:29809757-29809779 ATCTGTGGGCGGGGGTCAGAAGG - Intronic
1106676388 13:31963254-31963276 ATGTGGGGGTGGGAGTGTGAGGG - Intergenic
1106823481 13:33492045-33492067 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1107526581 13:41238473-41238495 GTGTGGGGTAGGAGGTGAGAAGG + Intronic
1107888849 13:44896502-44896524 CCGCGGGGGTGGGGGTCAGGAGG - Intergenic
1108300952 13:49075802-49075824 GGGTGGGGGTGGGGGTGGGGGGG - Intronic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108709478 13:53018327-53018349 CTGAGCTGGTGGGGGTCAGAAGG - Intergenic
1109286837 13:60419628-60419650 TTGTGGGGGCGGGGGGCAAAGGG + Intronic
1109656625 13:65399909-65399931 GTGTCGGGGTTGGGGGCAGGGGG - Intergenic
1109676524 13:65682895-65682917 GTGTGGGGGTGGGAGATATATGG - Intergenic
1109709203 13:66141518-66141540 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1110119897 13:71867055-71867077 GTTTGGGGGTGGGGGTGGGGCGG + Intronic
1110422524 13:75329102-75329124 GTGTGGGGGTTGGGGGGAGGTGG - Intronic
1110979000 13:81872224-81872246 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1112551789 13:100428327-100428349 GGGTGGGGGTGGGGGGTAGGGGG - Intronic
1112907803 13:104445892-104445914 CTGTCGGGGTGGGGGTCAAGGGG + Intergenic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113465030 13:110506867-110506889 GAGAGGGGTCGGGGGTCAGACGG - Intronic
1113640503 13:111953731-111953753 GTCAGTGGGAGGGGGTCAGAGGG + Intergenic
1113780491 13:112974014-112974036 CAGTGGGGGATGGGGTCAGAGGG - Intronic
1113815838 13:113170303-113170325 GGGTGGGGGTGGGGGTGGGGGGG + Intronic
1114197871 14:20494957-20494979 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1114524523 14:23359602-23359624 GTGTGGGGGTGGGGGGCTTCTGG + Exonic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114683738 14:24508010-24508032 GGGTGGGGGTGGGGGTGGGGTGG + Intronic
1114703756 14:24705421-24705443 GGGTGGGGGTGGGGAGCAGTGGG + Intergenic
1115079921 14:29437839-29437861 GTTGGCGGGTGGGGGTCAGGGGG - Intergenic
1115211742 14:30973332-30973354 GTGGGGGGGAGGGGGAGAGAAGG + Intronic
1115280925 14:31662465-31662487 GTCGGTGGGTGGGGGGCAGAGGG - Intronic
1115357732 14:32466571-32466593 GTTGGGGGGTGGGGGACAAAGGG + Intronic
1115823822 14:37241578-37241600 GTGAGGGGGTGGGGGTGGGGAGG + Intronic
1115846906 14:37546874-37546896 GGGTTGGGATGGGGGTGAGAAGG - Intronic
1116952558 14:50893402-50893424 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1117091817 14:52258714-52258736 GAGTGGGGGTGGGGGGCAATTGG + Intergenic
1117325430 14:54664591-54664613 GAGAGGGGGTGGGGGACAGGAGG - Intronic
1117588076 14:57234366-57234388 GTGTGTGGGTGGGTGTGAGTGGG - Intronic
1118297228 14:64581622-64581644 GTTTGGGGGTGGGGGTGGGGTGG + Intronic
1118456785 14:65952020-65952042 GGGTGGGGGTGGGGGTGATGGGG + Intergenic
1118721060 14:68594121-68594143 GTGTGGGGGTGGGGAGCACGGGG - Intronic
1118726832 14:68634677-68634699 GTAATGGGGTGGGGGTGAGACGG + Intronic
1119073492 14:71611551-71611573 GTCAGGGGGTGGGGGTCAAGGGG - Intronic
1119578849 14:75755980-75756002 GGGTGGGGGTGGGGGGCGGTGGG - Intronic
1119603872 14:75997749-75997771 GTTTGGGGGTGGGGGTTGGGGGG + Intronic
1119704233 14:76774095-76774117 GTGACGGGGAGGGGGTCTGATGG + Intronic
1119788211 14:77328113-77328135 GTGTGGGGGCGGGGGTGTCAAGG + Intronic
1119867796 14:77988603-77988625 GTGGGGAGGTGGAGGCCAGATGG + Intergenic
1119916490 14:78406787-78406809 GGTTGGAGGTGGGGGTGAGAGGG + Intronic
1120115279 14:80609459-80609481 GGATGGGGGTGGGGGCCAGAGGG - Intronic
1120359843 14:83485422-83485444 GCGGGGGGGGGGGGGGCAGAGGG - Intergenic
1120515092 14:85461215-85461237 GAGAGGGGGTGGGGGAGAGAAGG - Intergenic
1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG + Intergenic
1120841677 14:89091118-89091140 TTGTGAGGGTGGGGGTCCCATGG - Intergenic
1121279895 14:92690685-92690707 GGGTGGAGCTGGGGTTCAGAGGG + Intergenic
1121323188 14:93004773-93004795 GTGTGGGTGCGGGGGGCACAGGG + Intronic
1121332842 14:93059335-93059357 GGGAGGGGGTGCGGGTCACAAGG + Intronic
1121620653 14:95345854-95345876 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
1122104184 14:99439268-99439290 GTCTGGAGTTGGGGGTGAGAAGG - Intronic
1122177279 14:99930173-99930195 GTGCAGGGGTGCGGGTCTGAGGG + Intronic
1122214509 14:100193960-100193982 GGGTGGGGGTGGGGGTGGGAAGG + Intergenic
1122253116 14:100454365-100454387 GTGTGAGGGTGGAGGTGAGGAGG + Intronic
1122291890 14:100685353-100685375 GGGTGGGGCGTGGGGTCAGACGG + Intergenic
1122328579 14:100897762-100897784 GTGGGGGGGTGGGGGGCGGGGGG + Intergenic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122404788 14:101493538-101493560 GTGTGGGGGTGGGCGTCTATGGG + Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122450875 14:101806254-101806276 GTCGGGGGGTGGGGGACAGGGGG - Intronic
1122452563 14:101822073-101822095 GTGTGTGGGGGGGGGGCAGGGGG - Intronic
1122606064 14:102948256-102948278 GGGTGGGGGTGGAGGTGAGGGGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122696273 14:103554302-103554324 GGGTGGGGGTGGGGGTCACCAGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122788415 14:104174385-104174407 TGGTTGGGGTGGGGGTCAGCAGG + Intronic
1122885132 14:104707523-104707545 GGGTGGGGGTGGGGGTGGGGTGG - Exonic
1202852837 14_GL000225v1_random:31655-31677 GTGGGGAGGTGGTGGTCAGGCGG - Intergenic
1123751906 15:23363651-23363673 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124077528 15:26460575-26460597 GTGTAGGGGTAGTGGGCAGATGG - Intergenic
1124237773 15:28004464-28004486 GTGTGTGGGTGTGTGCCAGACGG - Intronic
1124284272 15:28387575-28387597 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124298425 15:28524039-28524061 GGGTGGGGGTGGTGGCCAGAGGG + Intronic
1124366488 15:29075263-29075285 GTGTGGGGGTGGGGGACCATTGG + Intronic
1124410450 15:29432541-29432563 GTGTTGGGGAGAGGGTCTGATGG - Intronic
1124681122 15:31731795-31731817 GTGTGGGGTTGGGGGTGAACAGG + Intronic
1124759887 15:32440227-32440249 GTGGGGGGGTGGGGGGCGGGAGG - Intergenic
1124827734 15:33115485-33115507 GTGTGGGGGGGGGGGGCTTAAGG - Intronic
1124938432 15:34194617-34194639 GTGTGGAGGTGGGGTTGGGAAGG + Intronic
1124959098 15:34381927-34381949 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1124975724 15:34528148-34528170 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1125647635 15:41285507-41285529 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1125953214 15:43771457-43771479 TTGTGGGGGTGGGGTTGAGTTGG + Exonic
1126240184 15:46433037-46433059 GGGTGGGGGTGGGGGTGGGGTGG + Intergenic
1126459274 15:48897750-48897772 GTGTGTGTGTGTGTGTCAGAAGG - Intronic
1126998362 15:54473005-54473027 ATGTGGGGGTGGGGGAGAGAGGG - Intronic
1127412268 15:58721550-58721572 GTGTGTGGGGTGGGGGCAGAGGG - Intronic
1127993022 15:64134641-64134663 CTGTGGGGGTGGGGTTGAGGAGG - Intronic
1128527391 15:68421717-68421739 GTGAGGGGCTGGGTTTCAGATGG + Intronic
1128538166 15:68506154-68506176 GTGTGGGCGTGGGCATCGGAAGG - Intergenic
1128580995 15:68809687-68809709 GCGTGGGGGTGCGGGTGTGAAGG + Intronic
1128657162 15:69470723-69470745 GGGTGGGGGTGAGGGGCAGAAGG - Intergenic
1128756415 15:70186613-70186635 ATGATGGGGTGGGGGCCAGAGGG - Intergenic
1128814907 15:70601334-70601356 GTGTGGGGGTGGAGGTTATCTGG + Intergenic
1129256889 15:74338850-74338872 GAGTGGGAGTGGTGGTGAGAGGG - Intronic
1129393936 15:75234249-75234271 GTGTTGGGGTGGGAGGCACAGGG - Intergenic
1129494961 15:75970652-75970674 GTGTGGAGGTGGGACTCTGATGG - Intronic
1129599258 15:76988760-76988782 GTGGGGGTGTGGCGCTCAGATGG - Intergenic
1129684166 15:77675872-77675894 GAGTGGGGATGGGGGTAACAGGG - Intronic
1130298836 15:82665310-82665332 GTGTGGGGGAGGGTGTTAGGAGG + Intronic
1130575611 15:85090683-85090705 GGGTGGGGGTGGGGGGATGATGG - Intronic
1130679162 15:85981283-85981305 GTGTGTGGGCGGGGGTGAGCGGG + Intergenic
1130991151 15:88876905-88876927 GGGTGGGAGTGGGAGGCAGAGGG + Intergenic
1131048536 15:89331761-89331783 GGGTGGGGGTGGGTGCCACATGG - Intronic
1131053635 15:89363160-89363182 TTGTGGGGGAGGGGATAAGAAGG - Intergenic
1131117495 15:89804003-89804025 CTGTGGGGGGAGGGGTCAGCTGG + Intronic
1131494958 15:92900164-92900186 GTGTGGGGGTGGGGGTCCTTAGG + Exonic
1131513682 15:93063830-93063852 CTGTGGAGGTGGGGGTCAGTTGG + Intronic
1131583877 15:93672607-93672629 GGGTGGGGGTGGGGGGCGGGGGG + Intergenic
1132064854 15:98722526-98722548 ATATGGAGGTGGGGGGCAGAGGG - Intronic
1132074690 15:98810134-98810156 GTGTGGGGGTGGCTGGCGGAGGG + Intronic
1132522403 16:397654-397676 GGGTGGGGGTGGGGGTGTGGGGG + Intronic
1132522424 16:397692-397714 GGGTGGGGGTGGGGGTGTGGGGG + Intronic
1132678713 16:1131030-1131052 GTGTGGGGGTGGGGGTGGACCGG + Intergenic
1132730114 16:1356913-1356935 GTGTGCGGGCGGGGGTCTGCGGG + Intronic
1132730122 16:1356941-1356963 GTGTGCGGGTGGCGGTCTGCGGG + Intronic
1132732094 16:1367576-1367598 GTGAGCGTGTGGGGGTGAGATGG - Intronic
1132767424 16:1541564-1541586 GCGTGGGGGTGGAGGTGGGAAGG - Intronic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1133042413 16:3067674-3067696 GTGTGGGGCTCAGGGTGAGAAGG + Intronic
1133255843 16:4514991-4515013 TTGTTGAGGTGGGGGTCAGGGGG + Exonic
1133305424 16:4805179-4805201 GTGAGGAAGAGGGGGTCAGAGGG + Exonic
1133405215 16:5518859-5518881 GTGTGGGAGTGGGGGTTAGGGGG - Intergenic
1133408925 16:5551785-5551807 GTCGGGGGGTGGGGGGCGGAGGG - Intergenic
1133555087 16:6898278-6898300 GTGGAGGGGCAGGGGTCAGATGG - Intronic
1133622377 16:7538842-7538864 GGGTGGGGGTGGGGGTGCGGGGG - Intronic
1133646188 16:7766869-7766891 GTGTTGAGGAGGGGGTAAGATGG - Intergenic
1133678985 16:8102452-8102474 GTCAGGGGGTGGGGGGCAAAGGG + Intergenic
1133699254 16:8293854-8293876 GTGAGGGGGTGGGGAGGAGATGG + Intergenic
1133699719 16:8297643-8297665 GTTTCGGGGAGGGGGTCGGAAGG + Intergenic
1133724914 16:8528417-8528439 GTTTGGGGGAGCAGGTCAGAAGG - Intergenic
1133771864 16:8871237-8871259 GGGTGGGGGTGCGGGCTAGACGG + Intergenic
1133819965 16:9227265-9227287 CTGCGGGGGTGGGGGTAAAATGG + Intergenic
1133923970 16:10179875-10179897 AAGTGGGGGTGGGGGTGGGAGGG - Intronic
1134076173 16:11293007-11293029 GCCTGGGGGTGGGGTTTAGAAGG + Intronic
1134079759 16:11316618-11316640 GTGAGGTGGAGGGAGTCAGAGGG - Intronic
1134251231 16:12575490-12575512 GTCTGGGGGTGGGGGTGATGTGG + Intergenic
1134342544 16:13358377-13358399 GTTGGGGGGTGGGGGACAAAGGG - Intergenic
1134489711 16:14687555-14687577 GGCTGGGGGTGGGGACCAGAAGG - Intronic
1134760282 16:16708671-16708693 GTTGGGGGGTGGGGGTCAAGGGG - Intergenic
1134811879 16:17174604-17174626 GCCAGGGGTTGGGGGTCAGAGGG + Intronic
1134815776 16:17204544-17204566 GGATGGGGATGGGGGGCAGAGGG + Intronic
1134897629 16:17903325-17903347 GTGTGGGGGAGTGGGGCGGAGGG + Intergenic
1134985789 16:18650534-18650556 GTTGGGGGGTGGGGGTCAAGGGG + Intergenic
1135303860 16:21352531-21352553 GTGGGGTGGTGGGGGTGGGAGGG - Intergenic
1135325185 16:21521201-21521223 ATTTGGGGGTGGGGGTCTTATGG - Intergenic
1135495215 16:22945571-22945593 GTGTGGGGGTTGTGCTGAGATGG - Intergenic
1135595028 16:23735264-23735286 GTGTGTGTGTGTGGTTCAGAAGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136153782 16:28368616-28368638 GTGGGGGCGTGGGGGTTAGTGGG - Intergenic
1136209310 16:28746654-28746676 GTGGGGGCGTGGGGGTTAGTGGG + Intergenic
1136300594 16:29331668-29331690 GTGGGGTGGTGGGGGTGGGAGGG - Intergenic
1136336669 16:29614469-29614491 ATTTGGGGGTGGGGGTCTTATGG - Intergenic
1136381497 16:29898151-29898173 GTGTGGGAGTGGGAGTATGAGGG - Intronic
1136407629 16:30057726-30057748 GTTTGGGGCTGAGGGGCAGAAGG + Intronic
1136417390 16:30112434-30112456 GTGTGGGAAAAGGGGTCAGAGGG + Intronic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1136530433 16:30864833-30864855 GTGGGGGGGTGGGGGTGGGGGGG - Intronic
1136643854 16:31591686-31591708 GTGTAGGGGTGGGGAGCAGAAGG - Intergenic
1136649704 16:31658347-31658369 GTTGGGGGGTGGGGGGCAAAGGG + Intergenic
1136661751 16:31769084-31769106 GTGTAGGGGTGGGGAGCAGAAGG + Intronic
1137509996 16:49090644-49090666 GTGGGGGGGTGGGGGTGGGCAGG + Intergenic
1137554440 16:49461698-49461720 GGGTGGAGGTGGGGGCCACAGGG + Intergenic
1137576285 16:49602414-49602436 GGGTGGGGGTGAAGGTCAGGAGG + Intronic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1138178881 16:54929371-54929393 GTCTGGGGGAGGGGAGCAGACGG + Intergenic
1138200618 16:55085524-55085546 GTTGGGGGGTGGGGGGCAAAGGG + Intergenic
1138440832 16:57034142-57034164 GGGTAGGAGTGGGGGACAGAAGG - Intronic
1138525967 16:57607384-57607406 GTGTGGGGGTGGGGGTGTATAGG + Intergenic
1138595768 16:58028187-58028209 GAGTTGGGGTAGGGGTGAGATGG - Intronic
1139269474 16:65668398-65668420 GAGTGGGGGTAGGAGTCAGAGGG + Intergenic
1139291972 16:65867591-65867613 GTGTGGGGGTGGGGGCTGGAGGG - Intergenic
1139333250 16:66210657-66210679 GTTGGGGGGTGGGGGACAAAGGG - Intergenic
1139421992 16:66854738-66854760 GTGTGGTTGTGGGGCTCAAAAGG + Intronic
1140154071 16:72403969-72403991 GTGTGTGGCTAGGGGTCAGTGGG + Intergenic
1140245290 16:73242839-73242861 GTGTGGAGGTGTGGGGTAGAGGG + Intergenic
1140426314 16:74864681-74864703 GTGTTGGTGTGTGTGTCAGAGGG + Intergenic
1140473112 16:75225947-75225969 GGGTGGGGGTAGCGGCCAGAGGG - Intergenic
1140980413 16:80103791-80103813 GGGTGGGGGTGGTGGACGGATGG - Intergenic
1141049381 16:80746699-80746721 GTGTGAGGGTGTGGGGCAGGGGG + Intronic
1141158068 16:81610635-81610657 GTGTGGGGGTGAGGATGAGAGGG - Intronic
1141570417 16:84930516-84930538 GAGTGGGTGTGGGTGTCAGTGGG + Intergenic
1141570568 16:84931168-84931190 GTGAGGGGGTCAGAGTCAGAGGG - Intergenic
1141626470 16:85264149-85264171 GTGGGAGGGTGGGGGGCAGCTGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1141986571 16:87584178-87584200 GTGTGGGGGGGGGGATGTGAAGG + Intergenic
1142037396 16:87870253-87870275 ATTTGGGGGTGGGGGTCTTATGG - Intergenic
1142125887 16:88410091-88410113 ATGTGGGGGTGGGGGAAGGAAGG + Intergenic
1142147130 16:88497392-88497414 GGGCGGGGATGGGGTTCAGAGGG + Intronic
1142147149 16:88497437-88497459 GGGCGGGGATGGGGTTCAGAGGG + Intronic
1142147169 16:88497482-88497504 GGGCGGGGATGGGGTTCAGAGGG + Intronic
1142252628 16:88999674-88999696 GGGAGGGGGCGGGGGGCAGAGGG + Intergenic
1142286491 16:89173513-89173535 TGGTGGAGGTGGGGGCCAGATGG + Intronic
1142396363 16:89833925-89833947 GTGTGGGTGTGGGTGTGAGCTGG + Intronic
1142478546 17:204365-204387 GTGGGTGGGTGGAGGACAGATGG - Intergenic
1142763478 17:2054035-2054057 GTGTGTGGGCGGGGGTCAGGAGG + Intergenic
1142771307 17:2099122-2099144 GAGTGATCGTGGGGGTCAGATGG + Intronic
1142875929 17:2852340-2852362 GGGTGGGGGTGGGGGGCACAAGG + Intronic
1142986318 17:3697136-3697158 GTGCGGGGGTGGGGGGCAGACGG + Intergenic
1143030221 17:3963667-3963689 GGGTGGGGGTGGGGGCCCCAAGG + Intronic
1143137624 17:4720542-4720564 GTGTGGGGGTGGGTGCTGGAAGG - Intronic
1143164206 17:4889844-4889866 ATCTGGGGGTGGGGGAGAGAAGG - Intronic
1143199250 17:5100705-5100727 GGGTGGGGGTGGGTGTTAAATGG - Intergenic
1143216294 17:5227656-5227678 GTGTGGGGGTTGAGGTGGGAGGG + Intronic
1143282484 17:5765251-5765273 GAGTGGGGCTGGGAGTCAGGTGG - Intergenic
1143517156 17:7425633-7425655 GGCCGGGGGTGGGGGGCAGAGGG + Exonic
1143595132 17:7909452-7909474 GAGTGGGGTTAGAGGTCAGAGGG - Intronic
1143661934 17:8330557-8330579 GGGTAGGGGCGGGGGTCAGTGGG + Intergenic
1143681013 17:8476070-8476092 TTGTGGGGGTGGCGGTACGATGG + Intronic
1143746941 17:9002117-9002139 GTGTGGGGGCGGGGGGCGGTGGG - Intergenic
1144780750 17:17807257-17807279 GCGGGGGGGTGGGAGTGAGAGGG + Intronic
1144796024 17:17891805-17891827 GTGTGTGTGTGTGTGTCAGAGGG + Intronic
1144872675 17:18380653-18380675 GTGTGGTGCTGGGTGTCAGGCGG - Intronic
1144954266 17:19011296-19011318 GGGTGTGGGTGGGTGTTAGACGG + Intronic
1145826559 17:27881283-27881305 GTGTGGGGCTGGGAGTGACAGGG - Intronic
1145846305 17:28041881-28041903 GTGGGGGGGAGGGGGGGAGACGG + Intronic
1145876788 17:28324948-28324970 GGGTGGGGGTGGGAGTGAAAGGG - Intronic
1146554295 17:33810407-33810429 GTGTGGGGGTGGGCATCAGGAGG + Intronic
1146641404 17:34544322-34544344 ATGGGAGGGTGGAGGTCAGAGGG + Intergenic
1146675247 17:34768845-34768867 GTGTGGTGGTGCAGGTGAGAGGG - Intergenic
1146817924 17:35959038-35959060 GTGTGGGGGCGGGGGTGAGGGGG - Intergenic
1146959843 17:36964745-36964767 GTGGGGGGGAGGGGGGCAAAAGG - Intronic
1147301660 17:39533713-39533735 AAATGGGGGTGGGGGTGAGATGG - Exonic
1147420939 17:40321928-40321950 GGATGGGGGTGGGGGTCATCAGG - Intronic
1147422912 17:40331407-40331429 GTGTGGGGGCTGGGGTGGGAAGG + Intronic
1147498575 17:40940743-40940765 GTGGGTGTGTTGGGGTCAGAAGG + Intergenic
1147531415 17:41281602-41281624 GTCATGGGGTGGGGGTCAGGGGG + Intergenic
1147592828 17:41695910-41695932 GTGTGGGGATGGGGGCAGGAGGG - Intergenic
1147683089 17:42266651-42266673 GTGTGGAGGTGGAGGTGGGAGGG + Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1148156150 17:45426144-45426166 GGGTGGGGCTTGGGGTCAGGGGG + Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148629070 17:49092615-49092637 GGGCGGGGGTGGGGGGCACATGG + Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148771631 17:50070750-50070772 GGGTGGGGGTGGGGGTGGGCTGG + Intronic
1148807095 17:50269392-50269414 GGTGGGGGGTGGGGGTCAGGTGG + Intergenic
1149127667 17:53254926-53254948 ATGCAGGGGTGGGGCTCAGATGG - Intergenic
1149140406 17:53426609-53426631 GGGTGGAGGTGGGGGTGAGGAGG - Intergenic
1149297910 17:55277311-55277333 GTTTGTGGGTGGGGGTGGGAAGG + Intronic
1149424561 17:56542684-56542706 GTGGGTGGGTGGGGATGAGAGGG - Intergenic
1149529095 17:57380621-57380643 GTTTGGGGGTAGGGGGCTGAAGG - Intronic
1149657640 17:58318770-58318792 GTGGGGGCTTGGGGGTCAGTCGG - Intronic
1149808117 17:59638557-59638579 GGGTGGGAGTGGGGGTGGGATGG + Intronic
1149864482 17:60143144-60143166 GTGTGAGGTTGGGGGTGAGGTGG - Intergenic
1150026293 17:61677809-61677831 GTCTGGGGGTGGGGGTCTGGGGG + Intergenic
1150368520 17:64613738-64613760 GTGTGTGGAGGGGGGGCAGAGGG + Intronic
1150603004 17:66666819-66666841 GTGTGGGGGGGGGATTCAAAGGG - Intronic
1151000358 17:70368922-70368944 GTGGGGGGGTGGGGGTGGTAGGG + Intergenic
1151062152 17:71107765-71107787 GAATGGGGGTAGGGGTGAGAAGG + Intergenic
1151198997 17:72453980-72454002 GTGGGGGGGTGGGGGGCAAGAGG - Intergenic
1151311047 17:73292593-73292615 GAGTGGGTGTGGGAGTCAGGGGG + Intronic
1151334536 17:73432140-73432162 GAGTGGGGGTGGGGTAGAGAGGG + Intronic
1151351301 17:73533670-73533692 GTGGGGGGGTGGGGGGCTGGGGG - Intronic
1151419061 17:73985558-73985580 CTGTGAGGATGGGGGTCACATGG + Intergenic
1151568839 17:74916015-74916037 GGGTGGGGGTGGGGGCGGGAGGG - Intergenic
1151619960 17:75239519-75239541 GGGTGGTGGTGGGGATGAGAGGG + Exonic
1151658659 17:75507552-75507574 GGGTGGGGGTCGGGGGCACATGG + Intronic
1151680745 17:75621448-75621470 GGGGGGCCGTGGGGGTCAGAGGG - Intergenic
1151694735 17:75708561-75708583 GTGTGTGGGTGGGGGACAGTAGG - Intergenic
1151834942 17:76576430-76576452 GTGTGGAAGTGGGTGTCGGAAGG + Intronic
1151843683 17:76636233-76636255 GTATGGGGGTGGGGTGGAGAGGG - Intronic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1151956201 17:77381395-77381417 GGGTGGGGGGTGGGGACAGAAGG - Intronic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152219907 17:79057932-79057954 GTGTTGGGTTTGGGGTCAGTGGG - Intergenic
1152234632 17:79132273-79132295 GGGGTGGGGTGGGGGGCAGAGGG + Intronic
1152250179 17:79208390-79208412 GGGTGGGGCTGGGAGTCAGTCGG + Intronic
1152439270 17:80295438-80295460 GTGTGGTGGTGGGGCACGGATGG + Intronic
1152492740 17:80648690-80648712 ATTTGGGGGTGGGGGGCACAAGG - Intronic
1152598916 17:81251665-81251687 TTGGGGGGTTGGGGGACAGAAGG + Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152784800 17:82242052-82242074 GGGTGGAGGTGGGGGTGGGAGGG + Intronic
1152883615 17:82834713-82834735 GTTTAGGGGTGGGGGTCGGGGGG + Intronic
1152933082 17:83120141-83120163 GATTGGGGGAGGGGCTCAGAGGG + Intergenic
1152947251 17:83204951-83204973 ATGTGGGGGTGTGGGTGTGACGG - Intergenic
1153233565 18:2964345-2964367 TGGTGGTGGTGGGGGACAGAGGG - Intronic
1153424295 18:4945428-4945450 GAATGGGGGTGGGGCTCACAGGG - Intergenic
1153643442 18:7174730-7174752 GTGTGGGTGTGGGGTGCTGAAGG - Intergenic
1153871948 18:9329940-9329962 GTGGGGGGGTGGGGGGTGGAGGG + Intergenic
1154240136 18:12645873-12645895 GTGTGGGAGTCGGAGTCAGAAGG - Intronic
1154425477 18:14268759-14268781 GTGGGAGGGTGGGGGTTAGTAGG + Intergenic
1154432784 18:14321122-14321144 GTGAGAGGGTGGTGGGCAGAAGG + Intergenic
1154485846 18:14870990-14871012 GTGTGTGGGTGGGGGTGGGCGGG - Intergenic
1154485869 18:14871044-14871066 GTGTGTGGGTGGGGGTGTGTGGG - Intergenic
1154485881 18:14871072-14871094 GGGTGAGGGTGGGGGTCTGTGGG - Intergenic
1154485899 18:14871134-14871156 GTGTGTGGGTGGGGGTGTGTGGG - Intergenic
1155243497 18:23885331-23885353 GGGTGGGGGTGGGGGTGGGGGGG - Intronic
1155333147 18:24738141-24738163 GTGTGGGGGTGGGGGCTGGGGGG + Intergenic
1155966733 18:32042775-32042797 GTATGGGGGTAGGGGAAAGATGG + Intronic
1156064597 18:33124991-33125013 GTGTGCAGGTGGAGGTAAGAGGG - Intronic
1156179204 18:34583323-34583345 GTTTGGGGGTGGGGGCCAACGGG - Intronic
1156237069 18:35216210-35216232 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1156261832 18:35451658-35451680 GTGTGGGATTTGGGGTCAGTGGG + Intronic
1156458019 18:37305594-37305616 GGGTGGTGCTGGGAGTCAGATGG + Intronic
1156717064 18:40024198-40024220 GTGGGGGGGTGGGGGGCGGGGGG - Intergenic
1157106796 18:44781495-44781517 AGGTGGGGGTGGGGGGGAGAGGG - Intronic
1157487220 18:48096620-48096642 GTGGAGGGGTGGGAGTCACAGGG + Intronic
1157513339 18:48294340-48294362 GAGTGGGGGTGGGGGTGTGCAGG - Intronic
1157527460 18:48395301-48395323 GTGTGTGTGTGTGTGTCAGAGGG + Intronic
1157527468 18:48395387-48395409 GTGTGTGTGTGTGTGTCAGAGGG + Intronic
1157527476 18:48395479-48395501 GTGTGTGTGTGTGTGTCAGAGGG + Intronic
1157574464 18:48734213-48734235 TGCTGGGGGTGGGGGACAGAAGG - Intronic
1157849958 18:51039476-51039498 GTGGGGGGGTGGGGGGGGGAAGG - Intronic
1157886558 18:51372828-51372850 GTCTGGGGGTGGGGGGCAAGGGG - Intergenic
1157959200 18:52133639-52133661 GTGGGGGTGGGGGGGTGAGAGGG + Intergenic
1158089174 18:53690679-53690701 GGGTGGGGGTGGGTCACAGAAGG - Intergenic
1158392153 18:57052527-57052549 GTTGGGGGGTCGGGGGCAGAAGG + Intergenic
1158484882 18:57857574-57857596 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1159834686 18:73324838-73324860 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1160380293 18:78449616-78449638 GTGTGGGGTTGTGTGTCATATGG - Intergenic
1160567549 18:79796759-79796781 GTTTGGACGTGGGGGTCTGAAGG - Intergenic
1160721653 19:599882-599904 GTGTGTGTGTGTGTGTCAGAGGG + Intronic
1160744285 19:703583-703605 GGGTTGGGGTGGGGGCCATAAGG + Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160770658 19:829263-829285 GAGAAGGGGAGGGGGTCAGATGG + Intronic
1160779839 19:872823-872845 GTGTAGGGGTGGGGCTGAGAAGG + Intronic
1160843745 19:1157570-1157592 TTGGGGGGGCGGGGGTCACACGG + Intronic
1160984392 19:1831497-1831519 GGGTGTGGGTGGGGGCCATAGGG - Intronic
1161129843 19:2581329-2581351 GTGGGGGGGTGGGGGGCGGAGGG + Intronic
1161178608 19:2864188-2864210 GTTTGGGAGTGGGTGTGAGATGG + Intergenic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161266318 19:3366349-3366371 GGGAGGGGGAGGGTGTCAGAGGG + Intronic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161351963 19:3798370-3798392 GGGTGGGGGTGGGGGTCACTGGG + Intronic
1161380936 19:3964571-3964593 GTGTGGGGGTGGGGATGGGGCGG - Intronic
1161497819 19:4597275-4597297 TTGCGGTGATGGGGGTCAGAGGG - Intergenic
1161801327 19:6418116-6418138 GTGGGGGGGTGTGGGGCAGCAGG - Intronic
1161977218 19:7613277-7613299 GTGGGCGGGTGGGGGATAGATGG + Intronic
1161978166 19:7617503-7617525 GGGAGGGGGTGGGGGGCAGCAGG - Intronic
1161979674 19:7624021-7624043 GGCTGGGGGTGGGGCTCAGGTGG - Intronic
1162736533 19:12750087-12750109 GTGTGGGGATGCGGGTGAGCTGG + Intergenic
1162904578 19:13816114-13816136 ATATGGGGGTGGGGGACAGGAGG + Intronic
1162940510 19:14006207-14006229 GGGTGGGGGTGGGGGTCGGCCGG + Exonic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163019979 19:14476681-14476703 GTGTGGGGGTGTGTGTCTTAGGG - Intergenic
1163177880 19:15577232-15577254 GTCTGGGGGTGAGGGTCCCAGGG + Intergenic
1163401733 19:17098037-17098059 GTGGGGGGGGGGGGTTCTGAAGG - Intronic
1163421699 19:17217068-17217090 GTGAGGAGGTTGAGGTCAGAAGG + Intronic
1163463886 19:17455231-17455253 GTGGGGGGGTGGGGGTGCCAGGG - Intronic
1163561184 19:18020507-18020529 GGGTGGGGGTGGGGGTGGGAGGG + Intergenic
1163618103 19:18341351-18341373 GTTTGGGGGTGGGGGGGAGTCGG - Intronic
1163667622 19:18610653-18610675 GCTTGGAGGTGGGGGTCAGCAGG + Intronic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1163888175 19:19988027-19988049 TGGTGGGGGTGGGGCCCAGATGG + Intergenic
1163943959 19:20519018-20519040 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1163976750 19:20859848-20859870 GTCAGGGGGTGGGGGTCTGGGGG + Intronic
1164245172 19:23422054-23422076 GTGTGGGAGTGAGGGTAGGATGG + Intergenic
1164685974 19:30167185-30167207 GTGGGTGGGTGGAGGCCAGAAGG + Intergenic
1164995989 19:32720546-32720568 GTGTGGGGTTGGGAGTGGGATGG - Intronic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165063288 19:33215442-33215464 GGCAGGGGGTGGGGTTCAGAGGG + Intronic
1165080350 19:33302894-33302916 GGGTAGGGGTGGGGGGCGGAGGG + Intergenic
1165167301 19:33865868-33865890 GTGTTGGAGTGGGGGCCTGATGG - Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165317941 19:35067940-35067962 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1165350216 19:35271167-35271189 CTGTGAGGGTGGTGGTCAGGGGG - Intronic
1165741591 19:38207988-38208010 GGGTGGGGGTGGGGGACGGGTGG - Exonic
1165844917 19:38812247-38812269 GTGGGGACGTGGGGGCCAGAAGG - Intronic
1166052310 19:40267656-40267678 GTCCTGGGGTGGGGGTCAGTTGG - Intronic
1166105925 19:40598098-40598120 GGGTGGGGGTGCTGGGCAGACGG - Intronic
1166199957 19:41231064-41231086 GTGGGGAGCTGGGCGTCAGAGGG + Intronic
1166254006 19:41589626-41589648 GTGAGGGGATGAGGCTCAGATGG - Intronic
1166305266 19:41933984-41934006 GTGGAGGGGTGGGGGGCAGAGGG + Intergenic
1166387200 19:42389048-42389070 GTGGGAGGGTAGGGGTCAGCTGG + Intronic
1166583123 19:43920532-43920554 GGGTGGGGGGGGGGGGCAGTGGG + Intronic
1166639434 19:44482553-44482575 GGGTGGGGGTGGTGTTCAGGAGG - Intronic
1166653305 19:44591681-44591703 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1166656544 19:44616128-44616150 GCGTAGGGGTGGAGGTCAAAGGG + Intronic
1166676762 19:44745837-44745859 GTGAGGAGGTGAGGGTCTGAGGG - Intergenic
1166929973 19:46296635-46296657 GGGTGGGATTGGAGGTCAGAGGG + Intergenic
1167027421 19:46931102-46931124 GTGAGGAGGTGAGGCTCAGAAGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167236417 19:48318665-48318687 CTGGGGAGGAGGGGGTCAGAGGG - Intronic
1167504089 19:49862331-49862353 GGGTGGGGGTGGGGATGGGAGGG - Intronic
1167558417 19:50210327-50210349 GAAAGAGGGTGGGGGTCAGATGG - Intronic
1167643476 19:50694405-50694427 GTGGGGATGTGGGGATCAGAGGG + Intronic
1167922048 19:52789959-52789981 GGGTAGGAGTGGGGGTCACAAGG + Intronic
1168287712 19:55342712-55342734 GGGTGAGGGTGGGGGTGAGGAGG - Intronic
1168295164 19:55374592-55374614 GGCCGGGGGTGAGGGTCAGAGGG - Intergenic
1168337130 19:55603065-55603087 GTCTGGGGGAGGGGGGCTGAAGG - Exonic
1168390739 19:56005850-56005872 GGGTGGGGTTGAGAGTCAGATGG - Intronic
924996945 2:370215-370237 GTTGGGGGGTGGGGGTCAAGGGG - Intergenic
925129602 2:1485052-1485074 GTCGTGGGGTGGGGGTCAGGGGG - Intronic
925361838 2:3285320-3285342 GGGTGGGGGTGGGGGTGGGGGGG - Intronic
925607558 2:5673800-5673822 GGCCGGGGGTGGGGGACAGAGGG + Intergenic
925636114 2:5942614-5942636 GTGTAGGACTTGGGGTCAGATGG + Intergenic
925800322 2:7592467-7592489 GTGTGAGGGAGTGGGACAGAGGG - Intergenic
925878703 2:8332982-8333004 GTGTGGGGGTGTGGGGGCGAGGG - Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926160956 2:10489003-10489025 ATGTGGGGGTGGGGGACACGGGG - Intergenic
926321340 2:11750132-11750154 GTGTGTGGCTAGGGGACAGAGGG - Intronic
926773004 2:16394524-16394546 GTGTGGGGGCGGGGGGCGGGGGG - Intergenic
926851650 2:17204731-17204753 GTCGGGGGGTGGGGGGCAGGGGG - Intergenic
926881369 2:17548201-17548223 GTGTGGGGGTGGGGGAAATGTGG - Intronic
927133885 2:20082786-20082808 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
927142134 2:20137720-20137742 CTGGAGGGTTGGGGGTCAGAAGG - Intergenic
927145411 2:20162331-20162353 GTTTGGTGATGGGGGTCAGGTGG + Intergenic
927413713 2:22855154-22855176 GTGGTGGGGTGGGGGGCAGGTGG + Intergenic
927492969 2:23532693-23532715 GCATGGGGGTGGGTGTCAGGTGG + Intronic
927758359 2:25727102-25727124 CTGTTGGGGTCGGGGGCAGAGGG - Intergenic
928098815 2:28423006-28423028 GGGTGGGGGTGGGGGCCCTAAGG - Intergenic
928412083 2:31062208-31062230 GTCGGGAGGTGGGGGTCAAAGGG - Intronic
928426090 2:31179216-31179238 GTCAGGGGGTGGGGGGCAGGGGG - Intronic
928434063 2:31242331-31242353 GTGTGGGTGTTGGGTACAGAAGG + Intronic
928549711 2:32358023-32358045 GCGTGGGGGTGGGGGTGGGGTGG + Intronic
928626210 2:33142467-33142489 GCGTGGTGGTGGTGGGCAGAGGG + Intronic
928902206 2:36331756-36331778 GTGTAGTGCTGGGGGTGAGAGGG - Intergenic
929052450 2:37849646-37849668 GTGTGGGGATGGGGGTGAGGTGG - Intergenic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
929309580 2:40407069-40407091 GTGTGTGGGTGTGTGTGAGAGGG + Intronic
929620480 2:43349292-43349314 GTGGAGGGGTGAGGGACAGAGGG - Intronic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
929918683 2:46156856-46156878 GTGTGTGGGAGGTGGGCAGATGG - Intronic
929942080 2:46341967-46341989 GTGTGGTGGGGGGAGGCAGATGG - Intronic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
930091496 2:47534508-47534530 GGGCGGGGGGGGGGGTTAGAAGG - Intronic
931013639 2:57949061-57949083 GAGTGGTGGTGGGGGACAGGGGG + Intronic
931551806 2:63454349-63454371 GTTTGGGGGTGGGGGACTGAGGG + Intronic
931592155 2:63896345-63896367 GTATGGGGGTGGGAGGGAGAAGG + Intronic
931829405 2:66035512-66035534 GTCAGGGGGTGGGGGGCAAAGGG - Intergenic
931893923 2:66707450-66707472 GTGTGGGGGGGGGGGGCGGGGGG - Intergenic
932049000 2:68380581-68380603 GGGTGTGGGTGGTGGTGAGAGGG - Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932375014 2:71227547-71227569 GGGTGGGGGTGGGCCTCAGTAGG + Intergenic
932439666 2:71725561-71725583 GTGTGTGTGTGTGTGTCAGAGGG + Intergenic
932485487 2:72081959-72081981 GTGTGGGGGTGGGGGCAGCAGGG - Intergenic
932695034 2:73948831-73948853 GTGATGGGGTGAGGGGCAGAAGG - Intronic
932800182 2:74734867-74734889 GTGTGGGGGTTGGGGTGGGAGGG - Intergenic
932817056 2:74870488-74870510 GACTGGAGGTGGGGGTTAGAAGG - Intronic
932842886 2:75100072-75100094 GTGTGGGGGTGTGGGTGGCATGG - Intronic
932862719 2:75311391-75311413 TGGTGGGGGGGTGGGTCAGAGGG + Intergenic
933189146 2:79313818-79313840 GTGTGTGTTTGGGGGTAAGAGGG + Intronic
933658720 2:84909326-84909348 GTGTGGTGGTGGAGGTGTGATGG - Intergenic
933689979 2:85172306-85172328 GTGTGGGGGTGGTGGCCACAGGG - Intronic
933773153 2:85756186-85756208 GGGTGGGGGTGGGGGACGGGTGG + Intronic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934493920 2:94781392-94781414 GTGTGGGGGTGGGAGAAAAAAGG - Intergenic
934663684 2:96156273-96156295 GGGTGGGGGTGGGGGACTGCTGG - Intergenic
934680128 2:96277781-96277803 GAGTGTGGGTGTGGGGCAGAGGG - Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935270442 2:101429854-101429876 GGGAGGAGGTGGGAGTCAGAGGG + Intronic
935315026 2:101824118-101824140 GGGTGGGGGCGGGGGAAAGAGGG + Intronic
935684037 2:105668084-105668106 GTGTGTGGCTGGGCATCAGAGGG + Intergenic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936111636 2:109670316-109670338 GGGTGGGGGTGGGGGTTGGTTGG + Intergenic
936233023 2:110720583-110720605 GGGTGGGGGTGGGTGGCAGATGG - Intergenic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
936387097 2:112040467-112040489 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
936793786 2:116183940-116183962 GGGCAGGGGTGGGGGTCATAAGG + Intergenic
936794566 2:116189487-116189509 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
936883791 2:117284300-117284322 GGGTAGGAGTGGGGGTCACAAGG - Intergenic
936941901 2:117892085-117892107 GTGTGGGGGTGGGGAGTATATGG - Intergenic
937027979 2:118714918-118714940 GTGGGGGTGAGGGGGTGAGAGGG + Intergenic
937196625 2:120163252-120163274 TTGGGGGGGGGGGGGGCAGAGGG - Intronic
937341549 2:121094449-121094471 GGGTTGGGGTGGGGGGCACAAGG + Intergenic
937365041 2:121255366-121255388 GTGGGGGGGAGGGGGTGAGAGGG + Intronic
937827480 2:126382375-126382397 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
938181633 2:129189886-129189908 GTGTGAGGCAGGGGGACAGAGGG + Intergenic
938379688 2:130829548-130829570 GTGTGGGGCTGGGGGCCCGGTGG - Intergenic
938777050 2:134551068-134551090 GGCTGGGGGTGGGGGTCACCAGG + Intronic
939383177 2:141462489-141462511 GTTGGGGGGTGGGGGTCAAGGGG + Intronic
939529903 2:143345459-143345481 GGGTTGGGGTGGGGTTCAGGTGG - Intronic
940030976 2:149260869-149260891 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
940214934 2:151295200-151295222 GTGTGGGGGGGGGGGGCGGCGGG - Intergenic
940756080 2:157684778-157684800 GTGGGGGGGAGGGGCTAAGAAGG - Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
940987581 2:160063763-160063785 GTTGGGGGGTGGGGGACAGCCGG + Intergenic
941050040 2:160722495-160722517 GTCAGGGGGTGGGGGTCTAAGGG - Intergenic
942136596 2:172931975-172931997 GGGTGGGGGTGGGGGGCGCATGG - Intronic
942425118 2:175851987-175852009 GGGTGAGGGTGGGGGTCGGAGGG + Intergenic
942455959 2:176138559-176138581 GTGTGGGGGTGTGGCCCTGATGG + Intergenic
942889135 2:180965541-180965563 GTCAGGGGGTGGGGGTAGGAGGG + Intergenic
943046659 2:182868135-182868157 GGGCGGGGGTGGGGGGAAGAGGG - Intergenic
943185126 2:184598195-184598217 GCGTGGGGGTGGGGGCGAGGGGG - Intergenic
943343800 2:186713155-186713177 GTGAGAGGGTGGTGGTCTGAGGG + Intronic
943347654 2:186758934-186758956 GTGTGGGGTTGGGGGAGAGTAGG - Intronic
943449838 2:188033699-188033721 GGGTTGGGGGGGGGGTCACAAGG - Intergenic
943460467 2:188166170-188166192 GTGGGGGGAGGGGGGTCACAAGG + Intergenic
943482856 2:188443186-188443208 CTGTGGGGGTGGGGGTTGGCGGG + Intronic
943532704 2:189104714-189104736 CTGTGGGGGTGGGGGTAAAGTGG - Intronic
943709151 2:191070853-191070875 GTGTGGGGGTGGGACGAAGAAGG + Intronic
944264599 2:197709506-197709528 GGGCAGGGGTGGGGGTCACAAGG + Intronic
944395097 2:199257879-199257901 GTGTTGGGGTGGGGGGTAGTGGG + Intergenic
944665212 2:201953984-201954006 GGGTTGGGGTGGGAGCCAGATGG - Intergenic
944680546 2:202073125-202073147 GGATGGGGGTGGGGGTCAAATGG - Intergenic
945099001 2:206246680-206246702 GGGTGGGGGTGTGGATCACAAGG - Intergenic
945484539 2:210379509-210379531 GTCTTGGGGTGGGGGTCGGGGGG + Intergenic
945912813 2:215669022-215669044 GTGTGGGGGGTGGGGGCGGAGGG - Intergenic
946018082 2:216620189-216620211 GGGTGAGGGTGGGGGTAACAGGG + Intergenic
946326894 2:218989274-218989296 GTCTGGGGGCTGGGCTCAGAGGG + Intergenic
946396887 2:219447829-219447851 GGGTGGGGGTGGGGGGCAGGAGG + Intronic
947034028 2:225830561-225830583 GTCAGGGGGTGGGGGTCAAGGGG + Intergenic
947375298 2:229489493-229489515 GTGTGGGGGGCGCGGACAGAGGG + Intronic
947491906 2:230602718-230602740 GTGTGGGGGCGGGGAACAGAGGG - Intergenic
947524122 2:230868217-230868239 GGATGGGGGTGGGGGCCAGCTGG + Intronic
947527422 2:230886983-230887005 GGGTGGGGGTGGGAGGCAGGGGG + Intergenic
947787717 2:232838803-232838825 GGGTGGGGGAGGGGTGCAGAGGG - Intronic
947911068 2:233801316-233801338 GGGTGGGGGTGGGGTGGAGAGGG + Intronic
947986902 2:234456111-234456133 GTCGGGGGGTGGGGGGCAAAGGG - Intergenic
948048525 2:234961880-234961902 GGGTGGGGGTGGGGGTGAGGAGG + Intronic
948180772 2:235978273-235978295 GTGGGTGGGTGGGGGCCACAGGG - Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948372766 2:237500768-237500790 GTGTGGGGTGTGGGGTGAGAGGG - Intronic
948813734 2:240499342-240499364 ATGTGGGGGTGGGGGTGAGTAGG + Intronic
948813754 2:240499395-240499417 ATGTGGGGGTGGGGGTGACCAGG + Intronic
948823992 2:240565659-240565681 GCGTGGGGGTGGTAGTGAGAAGG + Intronic
948903636 2:240967879-240967901 GTGAGGCAGTGGGGGGCAGAAGG - Intronic
948918344 2:241049796-241049818 GGCTGGGGGCGGGGGACAGAGGG - Exonic
949049060 2:241887516-241887538 GGGTGGGGGTGAGGGGCAAATGG - Intergenic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1168820030 20:766585-766607 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1168902298 20:1375348-1375370 TTGTGGGGGTATTGGTCAGATGG + Intronic
1168943605 20:1733325-1733347 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1169021249 20:2332806-2332828 TTGTGGGAGTGGGGGTGAGGTGG - Intronic
1169109387 20:3022236-3022258 ATGTGGGGGTGGGGGTACAAGGG - Intronic
1169204125 20:3730596-3730618 ATGTGGGGGTGGGGGAAGGAGGG + Intergenic
1169208378 20:3752509-3752531 GAGTAGGGGTGGGGGTGGGATGG + Exonic
1169867681 20:10218431-10218453 GGGTGGGGGTGGGGGTGGGGGGG + Intergenic
1170454160 20:16517033-16517055 GTGTGGGTGTTGTGGCCAGAGGG - Intronic
1170537885 20:17359472-17359494 GTGTGGGAATGGAGCTCAGATGG - Intronic
1170702027 20:18712389-18712411 TTGTGGGGGTGGGGGTGGGGGGG + Intronic
1170841012 20:19924492-19924514 GTGTGAAGGTGGGGGTATGAAGG - Intronic
1171046740 20:21815583-21815605 GTCAGAGGGTGGGGGTCACAGGG - Intergenic
1171076023 20:22124276-22124298 TGGTGGGGGCGGGGGTTAGATGG + Intergenic
1171122930 20:22581708-22581730 GTGTTGGGGTGGGGGTGTTATGG + Exonic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1172212745 20:33212498-33212520 GGGGAGGGGTGGGGCTCAGATGG - Intergenic
1172240630 20:33410330-33410352 GTCTGGGGGTTGGGGGCAGAGGG + Exonic
1172255011 20:33509965-33509987 GTGGTGGGGTGGGGGGCAGGGGG - Intronic
1172801276 20:37578028-37578050 GTGTGGGGTTGGGGGAAGGAAGG - Intergenic
1173014428 20:39212029-39212051 GATTGGGGGTGGAGGTGAGAGGG + Intergenic
1173177763 20:40777437-40777459 GTGGGAGGGTGGGGGTATGATGG - Intergenic
1173229802 20:41185333-41185355 GTGGGGGAGTGGGTGGCAGAAGG - Intronic
1173427808 20:42958181-42958203 GAGGTGGGGTGGGGGACAGAAGG + Intronic
1173570494 20:44072582-44072604 GTGTCGGGGTGGTGGTTAGGAGG + Intergenic
1173684119 20:44910586-44910608 GGGTGGGGGTGGGGGTCAGGCGG + Intronic
1173707928 20:45126652-45126674 GTCTGGGGGTGGGGGGAATAGGG - Intergenic
1173719010 20:45237042-45237064 GAGTGGGGGTGGGGGGCGGATGG - Intergenic
1173753161 20:45492526-45492548 GTCTGGGGGTGGGGTAGAGATGG + Intergenic
1173820830 20:46019266-46019288 GTGTGGGGATGGGGTGCAGCAGG + Intergenic
1174177334 20:48653297-48653319 GAGTGGGGGTGGGTGGCTGAGGG - Intronic
1174292495 20:49519129-49519151 GTGGGGTGGTGGGGGGCAGACGG - Intronic
1174443728 20:50576481-50576503 GTGTGAGGGAGGGTGTCAGTGGG + Intronic
1174494478 20:50930444-50930466 TTTTGGGGGTGGGGGGCGGACGG + Intronic
1175024855 20:55891073-55891095 TAGTGGGGGTGGGGGTGAGGGGG + Intergenic
1175195684 20:57241746-57241768 ATGTTGGGGTAGGGGCCAGAGGG + Intronic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175313262 20:58026469-58026491 GTGGCGGGTTTGGGGTCAGAAGG - Intergenic
1175336032 20:58197031-58197053 GTGACGGGGTGGTGGTAAGATGG - Intergenic
1175344585 20:58263620-58263642 GTATGGGGGTGGGGGTAGGTAGG - Intergenic
1175378839 20:58548803-58548825 GTTTGGGGGAGGGGGTTGGAGGG - Intergenic
1175531518 20:59676447-59676469 AGGTGGGGGTGGGGGTGAGGAGG - Intronic
1175686399 20:61031545-61031567 GGGGCGGGGTGGGGTTCAGATGG - Intergenic
1175825877 20:61936376-61936398 GTGTGGGGGAGGGGGTGTGGGGG - Intronic
1175855761 20:62120086-62120108 GGGTGGGGTGGGGGGACAGAAGG + Intergenic
1175872194 20:62213748-62213770 GAGTGGGGATGGGGGTTGGAGGG + Intergenic
1175910220 20:62401735-62401757 GTGTGGGGGAGGGGCTGAGGAGG + Intronic
1175940551 20:62535718-62535740 TTGAGGGGGTGGGGGTCAGGGGG + Intergenic
1175995267 20:62809501-62809523 GGGTGTGGGTGGGGGACATAAGG - Intronic
1176046922 20:63097516-63097538 GGGTGGGGATGGGGGTGGGAAGG + Intergenic
1176144452 20:63559371-63559393 CTGTGAGGGTGGGAGTCAGATGG + Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176311336 21:5152104-5152126 GTGGGGGGGTGGGGAACAGCCGG + Intronic
1176795403 21:13368244-13368266 GTGTGTGGGTGGGGGTGTGCAGG + Intergenic
1176795414 21:13368272-13368294 GTGTGTGGGTGGGGGTGTGCAGG + Intergenic
1176795470 21:13368446-13368468 GTGTGTGGGTGGGGGTGTGTGGG + Intergenic
1176940288 21:14915638-14915660 GTGTGTGGATGGGGGTGGGAGGG + Intergenic
1177031465 21:15985089-15985111 GGGCAGGGGTGGGGGTCACAGGG + Intergenic
1177115996 21:17087979-17088001 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1177673585 21:24267269-24267291 GTGTGGGAGGTGGGGTTAGACGG - Intergenic
1177782907 21:25639561-25639583 GTGTGGGGGTAGGGGCTAGAGGG - Exonic
1177825787 21:26081398-26081420 GGGCAGGGGTGGGGGTCACAGGG + Intronic
1178286365 21:31328705-31328727 GTCGGGGGGTGGGGGTCAAGGGG - Intronic
1178363389 21:31968515-31968537 GTGTGGGTGTGGGTGTTAGGGGG - Intronic
1178479937 21:32971158-32971180 GGGTGGGGGTGGGGGGCGGGGGG - Intergenic
1178494486 21:33075432-33075454 GTGGGGGGGTGGGGGTGGGGGGG + Intergenic
1179372960 21:40824123-40824145 GTGGGAGGCTGGGGGACAGAGGG - Intronic
1179469773 21:41602783-41602805 GTGAGAGGGAGGGGGTGAGAGGG + Intergenic
1179530172 21:42012908-42012930 GAGTGGAGGTGGGGGAAAGATGG - Intergenic
1179585469 21:42371392-42371414 GAGTGTGAGTGGTGGTCAGAGGG - Intergenic
1179712017 21:43268914-43268936 GGATGTGGGTGGGGGTCAGTTGG - Intergenic
1179835056 21:44025866-44025888 GTGTGTGTGTGTGTGTCAGAGGG + Intronic
1179845714 21:44109931-44109953 GTGGGGGGGTGGGGAACAGCCGG - Intronic
1180019320 21:45111365-45111387 GTGTGGGGGCAGGGGGCATACGG - Intronic
1180657998 22:17440753-17440775 GTGGAGGGGTAGGGATCAGAGGG - Intronic
1180728638 22:17964602-17964624 GTGTGGAGGTGGGTTACAGATGG - Intronic
1180834388 22:18922644-18922666 GTGGGGAGGAGGAGGTCAGAGGG - Intronic
1181003907 22:20000492-20000514 ATGTGGCGGTGGGAGCCAGATGG - Intronic
1181063268 22:20292044-20292066 GGGTGGGGGTTGGGGGCAGTAGG + Intergenic
1181155756 22:20918947-20918969 GGGTGGGGGTGGGGGTGGGGTGG - Intronic
1181326312 22:22051108-22051130 GTTTGGGGGTGGGGGGCTGGGGG - Intergenic
1181439215 22:22927224-22927246 GGGTGGGGGTGGGGGTGGGTGGG - Intergenic
1181631056 22:24151584-24151606 AGGTGGGGGTGGGGCTCAGAGGG + Intronic
1181805015 22:25369493-25369515 GGGGGTGGGTGGGGGTCAGCTGG - Intronic
1181860787 22:25816488-25816510 GTCTGGGGGTGGGGGGCTGGGGG - Intronic
1182096706 22:27630660-27630682 GGGTGGGGGGTGGGGGCAGAGGG - Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182422400 22:30254772-30254794 GGGTGGGGGTGGGGGACTTAGGG + Intergenic
1183008719 22:34926877-34926899 GTTGGGGGGTGGGGGGCTGAGGG + Intergenic
1183018074 22:35006295-35006317 GGGTGGGGGTGGGGGTCTGAGGG + Intergenic
1183306527 22:37085908-37085930 GGGAGGGGGTGAGGGGCAGAGGG + Intronic
1183543162 22:38441437-38441459 GGCTGGGGGTGGGGGTGAGGTGG + Intronic
1183617458 22:38954329-38954351 GTGGGGGTATGGGGGACAGAGGG + Intronic
1183705704 22:39473867-39473889 GTGTGTGGGCAGGGGGCAGATGG + Intronic
1183777032 22:39972948-39972970 GTGTGGAGTTGGTGGGCAGATGG + Exonic
1183781807 22:40003594-40003616 GTGTGGGGGTGGGGGCAGGCAGG - Intronic
1184015294 22:41781490-41781512 GTGTGTGGCTGGTGGTCATAAGG + Intronic
1184374746 22:44104664-44104686 GTGTGTGGGTAGGGGTGAGCAGG + Intronic
1184409859 22:44320199-44320221 GTGTGGGAGAGAGGGACAGAAGG + Intergenic
1184474445 22:44712916-44712938 GGGAGGGGTTGGGGGTCAGAGGG + Intronic
1184485291 22:44774833-44774855 GGGTGGGGGCGGGGGGCGGATGG + Intronic
1184520782 22:44992748-44992770 GTGGCGGGGTGGGGGACAGGAGG + Intronic
1184745629 22:46454092-46454114 GTGGGAGGGTGAGGGGCAGAAGG + Intronic
1184754428 22:46508167-46508189 GTGGGTGGGAGGGGGTCAGCTGG - Intronic
1184822377 22:46918925-46918947 GGGAGTGGGTGGGGGACAGAAGG - Intronic
1184869951 22:47231589-47231611 GTGTGGGGGTTGGGGGCTGCTGG - Intergenic
1184918585 22:47590083-47590105 ATGTGGGGGTGGGGGTCCTTGGG - Intergenic
1185110122 22:48896150-48896172 GTGTGGGAGTGAGGCTCAGGAGG + Intergenic
1185186752 22:49405672-49405694 GGGTGGGGATGGGGGTGGGAGGG + Intergenic
1185284274 22:49993400-49993422 GTGTGGGGGTGGGTTTCCGGCGG + Intergenic
1185367719 22:50444526-50444548 GGGTGGGGGTGGGGGTGGGGGGG + Intronic
1203284477 22_KI270734v1_random:147943-147965 GTGGGGAGGAGGAGGTCAGAGGG - Intergenic
949505601 3:4724750-4724772 GTGAGGGGGAAGGGGTGAGAGGG - Intronic
949652146 3:6172067-6172089 GTGTAGAGGTAGGGGTAAGATGG - Intergenic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950153075 3:10703385-10703407 ATGTGAGGGTGAGGGTCAAATGG - Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950451894 3:13070095-13070117 GGGTGGGGGTGGGGGCCCGCCGG + Intronic
950566379 3:13772142-13772164 GGGTGGGGGCGGGGGCCAGAGGG + Intergenic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950634260 3:14303846-14303868 GGGTGGGGGTGAGCGGCAGATGG + Intergenic
950709638 3:14805121-14805143 GTCTGGGGGAGGGGGTGACATGG - Intergenic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
950813647 3:15674927-15674949 GTGTAGGGGTGAGGGGGAGAAGG + Intronic
951032346 3:17896124-17896146 GTCTGTGGGTGGGTGTCAGCTGG + Intronic
951278741 3:20721227-20721249 GTGGGGGGGGGGGGGTGGGATGG - Intergenic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
951537913 3:23756374-23756396 GTGTAGGGGTGGGTGTAGGAGGG - Intergenic
951558506 3:23944839-23944861 GGGTGGGGGTGGGGGGCGCAAGG + Intronic
951984031 3:28598042-28598064 GTGTGTGGGTGGGGGTGGGTGGG + Intergenic
953422642 3:42766251-42766273 GGGTGGGTCTGGGGTTCAGAAGG + Intronic
953547915 3:43877763-43877785 GTGGGGGGGTGGGGATGACAGGG + Intergenic
953563861 3:44014614-44014636 GGGTGGGGTTGAGGGGCAGATGG - Intergenic
953726105 3:45400590-45400612 GTGCTGGGGTGGAGATCAGATGG + Intronic
953788352 3:45928303-45928325 CTGTTGGGGTGGGCTTCAGAGGG - Intronic
953974381 3:47371368-47371390 GTGGGGGGGAGGGGGTCACTTGG - Intergenic
953974382 3:47371376-47371398 GGGTGGGGGTGGGGGGGAGGGGG - Intergenic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
954704034 3:52469270-52469292 ATGTGGGGGTGGGGGGCTGAGGG + Intronic
954808743 3:53235218-53235240 GTGGGGGGGTGGGAGCCAGCTGG - Intronic
954945171 3:54417792-54417814 GTGTGGGGGGGGGGGTGGGGGGG + Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
956652827 3:71521111-71521133 GTGTGGGGGAGGGGGTGTCAGGG + Intronic
956706796 3:72006017-72006039 GTGTGGGCTCCGGGGTCAGATGG + Intergenic
957328161 3:78723649-78723671 GTGTGGGGTTGGGGGATTGAAGG + Intronic
957398251 3:79673320-79673342 GTGTGGGTGTGGGTGTGTGAGGG + Intronic
957768948 3:84662921-84662943 GTCTGGGGGTGGGGGGCAAGGGG - Intergenic
957828390 3:85481602-85481624 GTGAGGGGTTGGGGGTGAGGAGG + Intronic
958060697 3:88476247-88476269 CTGTGGGGGCGGGGGTGGGATGG - Intergenic
958676966 3:97277317-97277339 GGGAAGGGGTGGGGGTCACAAGG + Intronic
959011459 3:101081636-101081658 GTGTGGGGGTGGGGGTAGGGGGG + Intergenic
959287899 3:104440116-104440138 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
959288717 3:104445530-104445552 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
959300384 3:104591942-104591964 GTGTGGGGGCTGGGGGCATATGG + Intergenic
959439388 3:106358194-106358216 GTGTGGGGGTGGGGCACTGGTGG + Intergenic
959552753 3:107681494-107681516 GAGTGGGTGTAGGGGTCAAAGGG + Intronic
959881447 3:111448551-111448573 GTGGGCTGGTAGGGGTCAGAGGG - Intronic
960065932 3:113372575-113372597 GTTGGGGAGTGGGGGGCAGAGGG + Intronic
960478959 3:118164251-118164273 GTGGGGTGGTGGGGGGCAGGGGG + Intergenic
960713014 3:120549801-120549823 GTGGGTGGGTGGGGGTTAGTGGG + Intergenic
961376376 3:126468815-126468837 GTGTGGAAGTGGGGGTCACCTGG - Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961462739 3:127062987-127063009 GTGTGGGGGTGGTGGTGGGGGGG + Intergenic
961553014 3:127679824-127679846 GTATGGGGTTGGGGGTCGGGGGG - Intronic
961679433 3:128589284-128589306 GTGTGGGGGCAGGGGGCACATGG - Intergenic
961869534 3:129977473-129977495 CTGTGGTGGGGGGGGTGAGAGGG - Exonic
961925977 3:130481191-130481213 GTCGGGGGGTGGGGGGCAAAGGG - Intronic
962075192 3:132074099-132074121 GGGTGGGGGCAGGGGTAAGATGG + Intronic
962924356 3:139977702-139977724 GGGAGGGGGTGGGGGGCAGTGGG + Intronic
963252637 3:143117188-143117210 GTGTGGAGGGGGGGATCACAAGG + Intergenic
963285258 3:143428913-143428935 GGGTGGGGATGGGGATCAGGAGG + Intronic
963320678 3:143806093-143806115 GTGTGTGGGTGGGGGACGGGGGG - Intronic
963410821 3:144925682-144925704 GTCGGGGGGTGGGGGTCAAGGGG - Intergenic
963430548 3:145196884-145196906 GTTGGGGGATGGGGGACAGAGGG - Intergenic
963820165 3:149882285-149882307 GGGTGGGGGAGGGGGTAGGAAGG + Intronic
964663399 3:159146259-159146281 GAGTGGAGGTGAGGGTAAGAAGG + Intronic
964855198 3:161139012-161139034 GTTGGGGGGTGGGGGTCTGGGGG - Intronic
964984098 3:162718055-162718077 GAGTGGGGGGGTGGGTCACAGGG - Intergenic
965861425 3:173155408-173155430 TGGCAGGGGTGGGGGTCAGAAGG + Intergenic
966055260 3:175679038-175679060 TGGTAGGGGTGGGGGTCACAAGG + Intronic
966168587 3:177050828-177050850 GGGTGGGGGTGGGAGTGGGATGG + Intronic
966267360 3:178062770-178062792 GTCAGGGGGTGGGGGTACGAGGG - Intergenic
966560820 3:181318093-181318115 GAGGGTGGGTGGGGGTGAGAGGG - Intergenic
966889774 3:184398557-184398579 GGGTGGGGGGGGGTGTCAGAAGG - Intronic
967039215 3:185674069-185674091 AGGTGGGGGTCGGGGTGAGATGG + Intronic
967044986 3:185728190-185728212 GTGTGAGAGTGTGGATCAGAGGG - Intronic
967171979 3:186828767-186828789 GGGTGGGGGTGGGGGGCAGGGGG + Intergenic
967272043 3:187740211-187740233 GTGAGGGGGTGGGGGTCATGTGG - Intronic
967276470 3:187780330-187780352 GTGTGTGTGTAGGGGGCAGAAGG - Intergenic
967307669 3:188074830-188074852 GGGTGGGGGGTGGGGTCTGATGG + Intergenic
967451112 3:189624307-189624329 TTATGGGGGTGGGGGTGACAGGG - Intergenic
967652781 3:192007454-192007476 GTGGTGGGTTGGGGGACAGAGGG - Intergenic
967722503 3:192830260-192830282 GTGTGTGTGTGGGTGTCAAAGGG + Intronic
967763386 3:193250830-193250852 GTGCGGGGGTGGGGGGGATAGGG - Intronic
967877240 3:194275733-194275755 GTGTGGGGGTGGGGGTGGGGTGG + Intergenic
968446706 4:655762-655784 GTGTGTGTGCAGGGGTCAGAGGG - Intronic
968446715 4:655802-655824 GTGTGTGTGCAGGGGTCAGAGGG - Intronic
968512313 4:1001111-1001133 GTGGGGGGATGGGGGTGACAAGG + Intronic
968521857 4:1037758-1037780 GTGGGGGGGTGGGGGTAGGCAGG - Intergenic
968650292 4:1757722-1757744 GGGTGGGGGTGGGGGTTGGGTGG - Intergenic
968676223 4:1881892-1881914 GGGTGGGGGTGAGTATCAGATGG + Intronic
968928450 4:3562539-3562561 GCGTGGGGGTGGGTGACAAATGG + Intergenic
969038067 4:4272067-4272089 AGGAGGGGGTGGGGGTGAGAGGG + Intronic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969993045 4:11283854-11283876 CTATGGGGGTGGGGGTCTCATGG - Intergenic
970226570 4:13864544-13864566 GTGTGGGGGTGGGGGATACATGG - Intergenic
970230402 4:13904151-13904173 GTGTGGGGGTGGGGAGGAAAAGG + Intergenic
970497039 4:16636679-16636701 ATGTGGGGGTGGGGGACAAGAGG + Intronic
970877107 4:20884393-20884415 GTCAGGGGGTGGGGGTCAAGGGG - Intronic
970976752 4:22050500-22050522 GTGGAGGGGTGGAGGGCAGAGGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972355043 4:38272610-38272632 GTGTGGGGGTAGAGGGCATATGG - Intergenic
972492220 4:39598830-39598852 ATGGGGGTGTGGGGGTCACATGG - Intronic
972739602 4:41877812-41877834 GGGTGGGAGTGGGGGCCAAAAGG - Intergenic
973067891 4:45820202-45820224 GTTTGGGGGTGGGGGACTGGGGG + Intergenic
973118745 4:46491766-46491788 TGGTGGGGGTGGGCGTGAGATGG - Intergenic
973322361 4:48823390-48823412 GTGGGGGGGTAGGGGGCAAAGGG + Intronic
973561727 4:52143867-52143889 GAGTGGGGGTGTGGGTGAGAAGG - Intergenic
973797245 4:54440076-54440098 GTGTGGGGGGGGGGGGGGGAGGG + Intergenic
974172902 4:58290926-58290948 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
974253415 4:59419683-59419705 TTGTGGGGGTGGTGCCCAGATGG + Intergenic
974271367 4:59655670-59655692 ATGTGGGGGTGGGGCCGAGATGG + Intergenic
974397834 4:61362408-61362430 GTGTTGGGTTGGGGGACAGGTGG - Intronic
974858991 4:67496880-67496902 GGGTGGGGGTGGGGGTGGGGTGG - Intronic
974966042 4:68761631-68761653 GTGTTGGGGTGGGGGGCTGCAGG + Intergenic
975162776 4:71143085-71143107 GTGGGGGGATGGGGGAGAGATGG - Intergenic
975622522 4:76308319-76308341 GTGTGGGGGTGGTGGTGGTATGG - Intronic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976074262 4:81278889-81278911 GTCAGGGGGTGGGGGGCAAAGGG - Intergenic
976657458 4:87504181-87504203 GTGGTGGGGTGGGGGTGGGAGGG + Intronic
976739388 4:88343004-88343026 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
976894101 4:90086612-90086634 GTGTGGGGGGGGGGGGCTTATGG + Intergenic
976936867 4:90646947-90646969 GTGTTGGGGTGGGGGGATGAGGG - Intronic
977127256 4:93185891-93185913 GTCATGGGGTGGGGGTCAGGGGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977761222 4:100739290-100739312 GGGTGGGGGTGGGGGTGGGGCGG - Intronic
977896477 4:102371371-102371393 GTCGGGGGGTGGGGGGCAAAGGG - Intronic
977902555 4:102438819-102438841 GTGGTGGGGTGGGGAACAGAAGG - Intergenic
978066130 4:104405105-104405127 GTGTTGAGGTGGTGGTAAGATGG + Intergenic
978096496 4:104785340-104785362 GGGTGGGGGTGGGAGTAGGATGG - Intergenic
978585707 4:110273775-110273797 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
978638234 4:110837569-110837591 GGGTGGGGGTGGGGACCAGAAGG + Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979170802 4:117599451-117599473 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
979275439 4:118810122-118810144 GTGTGTGTGTGTGTGTCAGAGGG + Intronic
979729597 4:124008530-124008552 GTCTGGGGGTGGGGATCTGGGGG - Intergenic
979797511 4:124864482-124864504 GTGTGGAGGTGAAGGTCAGCTGG + Intergenic
979895458 4:126150298-126150320 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
980052328 4:128050950-128050972 GTGTGTTGGTGGGGGACACATGG + Intergenic
980070368 4:128237045-128237067 AAGTGGGGGTGGGGGTTAAATGG + Intergenic
980349272 4:131666173-131666195 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
980419958 4:132546587-132546609 GTGTGGGTGTGGGGGTAGGGCGG - Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
980769861 4:137356879-137356901 GTTGGGGGGTGGGGGTCAAGGGG + Intergenic
980841229 4:138264146-138264168 GAGAGGGGGTGAGGGTAAGAAGG - Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981042589 4:140237116-140237138 GTGAGTTGTTGGGGGTCAGAGGG - Intergenic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
981784357 4:148461176-148461198 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982181353 4:152751329-152751351 GGTTGGGGGTGGGCTTCAGAGGG - Intronic
983017285 4:162628729-162628751 CTGGGGTGGTGGTGGTCAGAGGG + Intergenic
983056602 4:163104075-163104097 GGGTAGGGGTGGGGGTCCCAAGG + Intergenic
983679838 4:170340954-170340976 GTGGGAGGGTGGGGGTGTGAGGG - Intergenic
983759656 4:171389085-171389107 GTTAGGGGGTGGGGGGCAAAGGG + Intergenic
983908385 4:173208521-173208543 GTGCGGAGGAGGGGGTAAGAAGG - Intronic
983971281 4:173877581-173877603 GTCTGGTGGTGGGGGAGAGAAGG - Intergenic
983989739 4:174103404-174103426 GTGTGGCGGTGGGGTGCAGGAGG - Intergenic
984172771 4:176380795-176380817 GGGTGGGGATGGGGGTGAGCTGG + Intergenic
984328002 4:178277352-178277374 GAGTGGTGGTGGGGGTTAGGGGG + Intergenic
984329626 4:178298069-178298091 GTGTGGGGCGGGGGGGCAGTCGG + Intergenic
984437953 4:179727896-179727918 CTGCAGGGGTGGGGGTCACAAGG - Intergenic
984652628 4:182286736-182286758 GAGAGGGGGTGGTGGTCAGTTGG - Intronic
984700260 4:182814533-182814555 GGGCAGGGGTGGGGGTCACAGGG - Intergenic
984888865 4:184473960-184473982 GTGTGGGGGTGCAGGTCAGCTGG - Intronic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985083825 4:186293077-186293099 GAGTTGGGGTGGGGCTCACAGGG - Intergenic
985265272 4:188150979-188151001 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265308 4:188151099-188151121 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265321 4:188151147-188151169 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265328 4:188151171-188151193 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265360 4:188151291-188151313 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265367 4:188151315-188151337 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265380 4:188151363-188151385 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265413 4:188151484-188151506 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265433 4:188151556-188151578 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265453 4:188151628-188151650 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265460 4:188151652-188151674 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265473 4:188151700-188151722 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265487 4:188151748-188151770 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265500 4:188151796-188151818 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265513 4:188151842-188151864 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265526 4:188151890-188151912 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265533 4:188151914-188151936 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265540 4:188151938-188151960 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265547 4:188151962-188151984 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265560 4:188152010-188152032 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265575 4:188152056-188152078 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265582 4:188152080-188152102 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265589 4:188152104-188152126 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265596 4:188152128-188152150 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265603 4:188152152-188152174 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265610 4:188152176-188152198 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265624 4:188152224-188152246 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265638 4:188152272-188152294 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265652 4:188152320-188152342 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265689 4:188152466-188152488 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265720 4:188152587-188152609 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265727 4:188152611-188152633 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265734 4:188152635-188152657 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265753 4:188152707-188152729 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265790 4:188152852-188152874 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265821 4:188152973-188152995 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265828 4:188152997-188153019 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265835 4:188153021-188153043 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265842 4:188153045-188153067 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265866 4:188153142-188153164 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265873 4:188153166-188153188 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265880 4:188153190-188153212 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265893 4:188153238-188153260 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265900 4:188153262-188153284 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265907 4:188153286-188153308 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265914 4:188153310-188153332 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265926 4:188153358-188153380 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265939 4:188153406-188153428 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265952 4:188153454-188153476 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265966 4:188153498-188153520 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265973 4:188153522-188153544 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265980 4:188153546-188153568 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985265987 4:188153570-188153592 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266000 4:188153618-188153640 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266007 4:188153642-188153664 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266014 4:188153666-188153688 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266021 4:188153690-188153712 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266028 4:188153714-188153736 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266042 4:188153760-188153782 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266049 4:188153784-188153806 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266097 4:188153978-188154000 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266104 4:188154002-188154024 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266111 4:188154026-188154048 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266140 4:188154147-188154169 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266147 4:188154171-188154193 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266160 4:188154219-188154241 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266167 4:188154243-188154265 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266186 4:188154315-188154337 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266204 4:188154388-188154410 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266229 4:188154485-188154507 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266236 4:188154509-188154531 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266249 4:188154557-188154579 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266256 4:188154581-188154603 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266263 4:188154605-188154627 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266275 4:188154653-188154675 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985266282 4:188154677-188154699 GAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985512218 5:319175-319197 GAGTGTGGGTGGGAGCCAGAGGG + Intronic
985623766 5:972501-972523 GTCTGGGGGTGGGGGTCAAGGGG + Intergenic
985712796 5:1439326-1439348 GGGTGGGGGTGGGGGTGGGGAGG + Intronic
985783243 5:1881630-1881652 GGGTGGGGGTGGGGTTCTGAGGG + Intronic
985994847 5:3592244-3592266 CTGTGGGGGTGGGGGTTGGGCGG - Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986553134 5:8981253-8981275 GTGTGGGTGTGCGGGTCAGTAGG - Intergenic
986686337 5:10278387-10278409 ATGTGGGTGTGGGGGTCAGTGGG - Intronic
986898795 5:12406008-12406030 GTGTGAGGGTAGGGGGAAGATGG - Intergenic
987013964 5:13798050-13798072 GTCTGGGGGTGGGGGGCTGGGGG + Intronic
987062694 5:14257565-14257587 GGGTGGGGAAGGGGGACAGACGG + Intronic
987197467 5:15541508-15541530 GAATAGGGGTGGGGGTAAGATGG - Intronic
987273211 5:16335014-16335036 GTGTGGGGGTATGGGGCATATGG + Intergenic
987445999 5:18020676-18020698 GGGAGGGGGTGGGGGGCAGGCGG + Intergenic
987595155 5:19988369-19988391 GTGGGGGGTTGGGGGGGAGAAGG - Intronic
987596023 5:20000074-20000096 GTGAGGGGGTGGGAGGCAGTAGG + Intronic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
987755443 5:22094853-22094875 GTGCAGGAGTGGGGGTCACAAGG - Intronic
988081986 5:26426462-26426484 TTGTGGGGGTGGGGGGGAGGGGG + Intergenic
988227535 5:28431422-28431444 GGGTGGGGGTGGGAGCGAGAAGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
988735478 5:34016215-34016237 GTGCGGGGGTGGTGGGGAGAGGG + Intronic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
989105268 5:37857242-37857264 GTGGGGGGGTCGGGGGGAGATGG - Intergenic
989661037 5:43797974-43797996 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
990500339 5:56390147-56390169 GTGTGGGGGTGTGGGACCTATGG - Intergenic
990589924 5:57252122-57252144 GGGTGGGGGTGGGGGTGGGTGGG - Intronic
991574687 5:68090674-68090696 GTGTGTGGGGGGTGGGCAGAGGG - Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992003781 5:72459318-72459340 GTGTGAGAGTGGGAGTCAGTGGG + Intronic
992038275 5:72803336-72803358 GTCTGGGGGTGGGGGGCTGGGGG - Intergenic
992190341 5:74285611-74285633 GGGTGGTGGTGGGGTTCAGGTGG - Intergenic
992215426 5:74520202-74520224 GGGTGGGGGTGGGGGGCAGGAGG + Intergenic
992314400 5:75537270-75537292 GCATGGGGGTGGGGGGCACAGGG + Intronic
992628524 5:78657866-78657888 GGGTGGGGGTGGGAGGTAGAGGG + Intronic
992695755 5:79285274-79285296 GTGGGCGGGTGGGGGGCAGGGGG - Intronic
992976330 5:82124444-82124466 GTTTGGGGGTGGGGGACAATGGG - Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993410015 5:87562506-87562528 GTCTGGGGGTGGGGGCCAAGGGG - Intergenic
993603623 5:89959485-89959507 GTGTGGGGGTAGGGGAAATATGG - Intergenic
993684663 5:90923775-90923797 GTGGTGGGGTGGGGGGCAGGGGG - Intronic
994100115 5:95882593-95882615 GGGTGGGGGTGGGGGGCGGATGG + Intergenic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
994325498 5:98441128-98441150 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
994702984 5:103161103-103161125 TTGTGGGGGTGGGGGTTGGGGGG - Intronic
994749000 5:103715359-103715381 GTGGGGGGGTGGGGGATTGAGGG + Intergenic
994971271 5:106742484-106742506 GTGGGGGGGTGGGGGTCTGGGGG - Intergenic
995039362 5:107570647-107570669 GTGTGGGGGTGGGGGCGGGCAGG + Intronic
996698270 5:126422905-126422927 GGGTGGGGGGGGTGGTTAGAGGG - Intronic
996900814 5:128539090-128539112 GTGGGGCGGTGGGGGTAGGAGGG - Intronic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997279654 5:132631956-132631978 GGGTGGAGGTGGGGGTAGGAAGG - Intronic
997391459 5:133520425-133520447 GCGTTGGGGTGGGGGTGGGAGGG + Intronic
997521202 5:134525597-134525619 GTGTTGGGGTGGGGGTGGGGTGG - Intronic
997591080 5:135072716-135072738 GTCTGGGGGTGTGAGGCAGAGGG + Intronic
997678254 5:135731185-135731207 TGGTAGGGGTGGGGGTCATAAGG + Intergenic
997680837 5:135749593-135749615 GTGGGGTGGTGGGGGTGCGATGG + Intergenic
997769397 5:136541131-136541153 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
997777472 5:136624115-136624137 GTGTGGTGGTGGTGGGCAGTGGG - Intergenic
997788625 5:136737223-136737245 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
997819950 5:137056259-137056281 ATGTGGGGGTGGGGGACAGGGGG + Intronic
998163285 5:139825679-139825701 GTGTGGGGGTGGTGGTGAGTGGG + Intronic
998352207 5:141508968-141508990 GGCTGGGGGTGGGGGCCAGCTGG + Intronic
998401347 5:141850533-141850555 GGGTGGGGGTGGGGGTGGGGGGG + Intergenic
998451112 5:142235453-142235475 GTGGGGGGGTGTGGGTAAGGGGG + Intergenic
998707736 5:144782959-144782981 GCGGGGGGGTGGGGGGAAGAGGG + Intergenic
998957653 5:147453787-147453809 GTGGGGGGGCGGGGGTGAAAGGG - Intronic
999209684 5:149877217-149877239 GAATGGGGGTGGGGTTCAGGGGG + Intronic
999231948 5:150066851-150066873 GGGTGGGGTTGGGGGTCTGAAGG - Intronic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
999484918 5:151985637-151985659 GTGTGGGGCAGGGGGTGAGGGGG - Intergenic
999620803 5:153471273-153471295 GTTGGGGGGTGGAGGGCAGAAGG - Intergenic
999939204 5:156522189-156522211 GTCAGGGGGTGGGGGGCTGAGGG + Intronic
1000108146 5:158080347-158080369 GTGAGGGGGTGGGGCACAGCAGG - Intergenic
1000205179 5:159051424-159051446 GTGGGGGGGTGGGGGGCTGCGGG - Intronic
1000291168 5:159872920-159872942 GTTTGGGGGTGGGGGGCAAGGGG - Intergenic
1000303794 5:159977729-159977751 GTGTGGGTGTTGGGGTGAGGAGG + Intergenic
1000884973 5:166740224-166740246 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1000937277 5:167317806-167317828 GTGTGGGTGTGAGTGTCTGAGGG + Intronic
1001230283 5:169980971-169980993 GTGTGGGTGTGGTGGTCACTTGG + Intronic
1001304667 5:170563011-170563033 GTGTGTGGGTGGAGGTGAGGAGG - Intronic
1001407053 5:171483778-171483800 GTGTGGGGGTTGGGGATAGGTGG + Intergenic
1001453362 5:171842932-171842954 GAGTGGGGGTGTGGGGCTGAAGG - Intergenic
1001489955 5:172148296-172148318 GTGACAGGGTGGGGGGCAGAGGG + Intronic
1001579272 5:172787940-172787962 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1001618879 5:173065277-173065299 GTGTGGGGTTGGGTATGAGATGG + Intronic
1001979728 5:176030628-176030650 GTGTGAGGGTGGGGGTGTGAGGG + Intronic
1001979734 5:176030642-176030664 GTGTGAGGGTGGGGGTGTGTGGG + Intronic
1001979854 5:176030948-176030970 GGGTGTGGGTGGGGGTGTGAGGG + Intronic
1001979860 5:176030962-176030984 GTGTGAGGGTGGGGGTGTGTGGG + Intronic
1002079763 5:176730387-176730409 GGATGGGGGTGGGGGACAGGGGG + Intergenic
1002173497 5:177388211-177388233 GGGTGAGGGTGGGGGTAACAAGG + Intronic
1002237649 5:177813031-177813053 GTGTGTGGGTGGGGGTGTGTGGG - Intergenic
1002237683 5:177813121-177813143 GTGTGAGGGTGGGGGTGTGTGGG - Intergenic
1002237689 5:177813135-177813157 GTGTGAGGGTGGGGGTGTGAGGG - Intergenic
1002275974 5:178104655-178104677 GTGTGTGGGTGGGGGTGTGTGGG + Intergenic
1002345987 5:178547734-178547756 GTGTGGGTGTGGGGGTGTGTGGG - Intronic
1002346092 5:178548062-178548084 GTGTGTGTGTGGGGGTGAGGGGG - Intronic
1002418352 5:179132550-179132572 GAGTGGGGGCCGGGGTCACAGGG - Intronic
1002724635 5:181286475-181286497 GTGTGTGGGTGGGGGTGTGTGGG - Intergenic
1002724641 5:181286489-181286511 GTGTGCGGGTGGGGGTGTGTGGG - Intergenic
1002741130 5:181436634-181436656 ATGTGGGGGTGTGGGTGTGACGG - Intergenic
1002806660 6:582627-582649 GGGTGGGGGTGGGGGTGCGGTGG + Intronic
1002833295 6:843681-843703 GTCTGGGGGTGGGGGATAGCAGG + Intergenic
1002904526 6:1438094-1438116 GGGTGGGGGTGGGGGTGGGGTGG - Intergenic
1003429714 6:6027991-6028013 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1003430544 6:6033371-6033393 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1003469700 6:6417648-6417670 GTGTGGCGGGGAGGGACAGAGGG + Intergenic
1003923500 6:10855675-10855697 GGGTGGGGATGGGGGTGGGAGGG - Intronic
1004069919 6:12288568-12288590 GTGTGGGTGTGGGTGTGGGAGGG + Intergenic
1004228644 6:13811787-13811809 ATGTGGGGGTGGGGGTGAGGAGG - Intronic
1005086812 6:22015387-22015409 GGATGGCGGTGGGGGTCAGGGGG - Intergenic
1005128454 6:22475001-22475023 GTCGGGGGGTGGGGGGCAAAAGG + Intergenic
1005284625 6:24312116-24312138 AGGCGGGGGTGGGGGTCACAAGG - Intronic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1005595848 6:27378443-27378465 GAGCAGGGGTGGGGGTCACAAGG + Intronic
1005982548 6:30847525-30847547 GTGTGGGGGTGGGGGTTGGGAGG + Intergenic
1005996894 6:30937009-30937031 GGGTGGGGGTGGGGGTTTAAAGG - Intergenic
1006017675 6:31095127-31095149 TTTTGGGGGTGGGGGACACATGG + Intergenic
1006065403 6:31457841-31457863 GTGTGGGGGTGGGAGTGAGTAGG + Intergenic
1006108025 6:31728397-31728419 GGGTGCAGGTGGGGGTCGGAAGG - Intronic
1006143166 6:31943202-31943224 CTGTGGGTGTGAGGATCAGATGG - Intronic
1006407132 6:33851906-33851928 GTTTGGGGGTGGTGGTAGGAGGG + Intergenic
1006456862 6:34136941-34136963 GGGTTGGGGTGGGGGCCAGGCGG + Intronic
1006712771 6:36089377-36089399 TTGGTGGGGTGGGGGTCAGGCGG + Intronic
1006747326 6:36352478-36352500 GACTGGGGTTGGGGGTGAGAGGG - Intergenic
1007059227 6:38921943-38921965 GGGCAGGGGTGGGGGTCACAAGG + Intronic
1007208614 6:40172974-40172996 GTGGGGGGATGGTGGTGAGAGGG - Intergenic
1007301101 6:40868521-40868543 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1007371356 6:41428444-41428466 GGGTGGGGGTGTGGGGTAGAGGG - Intergenic
1007412888 6:41674973-41674995 TTGTGGGGTTGGGGGACAGGAGG + Intergenic
1007466910 6:42058938-42058960 GTGTGTGGTTGGGGGGCAGAGGG + Intronic
1007581587 6:42963240-42963262 GGGTGGGGGTGGGGGTGGGGTGG + Intronic
1007841584 6:44720454-44720476 GGGTGGGGGTGAGGGGTAGATGG + Intergenic
1007887674 6:45249805-45249827 GTGGGGGGGTGGGGGCCAAGGGG + Intronic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1008534928 6:52500445-52500467 GTTTGGGGGGGGTGGTTAGAGGG - Exonic
1008786640 6:55175706-55175728 GGGTTGGGGAGGGGGTGAGATGG + Intronic
1008927381 6:56901146-56901168 GTATGGGTTTGGGCGTCAGATGG + Intronic
1008940352 6:57039817-57039839 GTGTGGGGGTGGGGGTTGAGGGG + Intergenic
1008963810 6:57293832-57293854 GTTGGGGGGTGGGGGTCTGGGGG + Intergenic
1010271037 6:73916300-73916322 GTTGGGGGGTGGGGGTCAATGGG - Intergenic
1010316663 6:74459295-74459317 TCGTGGGGATGGGGGTCAGTGGG - Intergenic
1010486413 6:76419837-76419859 GTGTGGGGGTTGAGGTGAGGAGG + Intergenic
1010562106 6:77363124-77363146 GGGTGGGGGTGGGGGCAGGATGG + Intergenic
1010840462 6:80643752-80643774 GTGTGGGAGTGGGGGAGAGGGGG - Intergenic
1010840817 6:80647721-80647743 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1010893972 6:81344114-81344136 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1010951996 6:82048253-82048275 GTGTGTGAGTGAGGGTTAGAAGG - Intergenic
1011035454 6:82969223-82969245 GGGTGGGGGTGGGGGTGGGGTGG + Intronic
1011650586 6:89502879-89502901 GTGTGGAGGTGGGGGTTGGCTGG + Intronic
1011885152 6:92084278-92084300 GTCGTGGGGTTGGGGTCAGAGGG + Intergenic
1011997623 6:93613120-93613142 GTGGGGCGGTGGGGGGAAGAGGG + Intergenic
1012043905 6:94244704-94244726 GTGTGGGGATGGGGAGCAAATGG - Intergenic
1012066071 6:94554105-94554127 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1012066875 6:94559347-94559369 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1012096593 6:94970236-94970258 TTCTGGGGGTGGAGGTCAGGAGG + Intergenic
1012338558 6:98090339-98090361 GTGTGTGGGTGGGGGAAAGTGGG + Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012882732 6:104810589-104810611 GTGTGTGGGTGTGGGTGTGACGG + Intronic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1013081893 6:106820546-106820568 GTGTGGGGTTTGTGGTCAGCAGG - Intergenic
1013532142 6:111029865-111029887 GAATGGGGGTAGGGGTGAGATGG - Intergenic
1013555182 6:111249706-111249728 GTGTGTGAGTGTGTGTCAGAAGG + Intergenic
1013896348 6:115093165-115093187 GTTAGGGGGTGGGGGAGAGAGGG - Intergenic
1014633091 6:123811421-123811443 GTGGGGGGGTGGGGGAGAGAGGG + Intronic
1014693388 6:124589822-124589844 GTTGGGGGGTGGGGGGCAAAAGG - Intronic
1014718259 6:124890630-124890652 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1014719354 6:124897553-124897575 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1014729575 6:125016780-125016802 GTGAGGGGGTGGGGGGCAAGGGG + Intronic
1014770267 6:125452236-125452258 GTCTGGGGGTGGGGGATTGAGGG - Intergenic
1014935457 6:127380433-127380455 GTGTGGGGGAGGGGGTGGGGTGG - Intergenic
1015098007 6:129440428-129440450 GGGTTGGGGTGGGGGTTGGAGGG - Intronic
1015301326 6:131655841-131655863 GGGTGGTGGTGGTGGTCAGAAGG + Intronic
1015601110 6:134911630-134911652 CTGTCTGGGTGGTGGTCAGAGGG - Intergenic
1015853612 6:137600155-137600177 GTGTGTGTGTGTGTGTCAGAGGG - Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016518455 6:144923398-144923420 GGGTAGGGGCGGGGGTCACAAGG - Intergenic
1016788843 6:148044558-148044580 GAGTGGGGAAGAGGGTCAGAGGG + Intergenic
1016888670 6:148983877-148983899 ATGTGGGGGTGGTGGTGATAGGG - Intronic
1017065318 6:150523588-150523610 GTCTGGGGGTGGGGGACAAGGGG + Intergenic
1017146654 6:151240771-151240793 GGGTGGGGGTGGGGGTGGGGGGG + Intronic
1017380713 6:153826044-153826066 TGGAGGGGGTGGGGGGCAGATGG - Intergenic
1017399252 6:154040089-154040111 GTCTAGGGGTGGGGGGCGGAGGG + Intronic
1017482439 6:154871133-154871155 GTGGGGGGGAGGTGGTGAGAGGG - Intronic
1017715808 6:157212224-157212246 GCGTGGGGCTTGGGGTCAGGAGG - Intergenic
1017718186 6:157226711-157226733 GGCTGGGGGTGGGGGTGGGAGGG - Intergenic
1018266412 6:162029178-162029200 GTGTGGGGGTGGAGGTGGGTGGG - Intronic
1018509273 6:164507472-164507494 GTGTTGGGTTTGGGGTCAGCAGG - Intergenic
1018579424 6:165295917-165295939 GTGTGGTGGTGGGGGTGTGGTGG - Intronic
1018651531 6:165995767-165995789 GTCTGGGGGTGGGAGGGAGATGG - Intergenic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018807085 6:167270048-167270070 GGGTGGGGGTGGGGGTGGGGGGG + Intergenic
1018902222 6:168057375-168057397 GTGCGGTGGTGGGAGTGAGAGGG - Intronic
1018990211 6:168668844-168668866 GTGTGGGGGAGGGTGACAGCAGG - Intronic
1018990267 6:168668987-168669009 GTGTGGGGGAGGGTGACAGCAGG - Intronic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019246244 6:170712331-170712353 ATGTGGGGGTGTGGGTGTGACGG - Intergenic
1019304296 7:325562-325584 GTGTGGGGGCTGGGGCCAGGAGG - Intergenic
1019329493 7:455614-455636 GCGTGGGGGCGGGGGGCAGAGGG - Intergenic
1019470736 7:1219166-1219188 GTGGGGGAGTAGGGGTCAGGAGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1019624846 7:2010891-2010913 GAGTGTGAGTGGGGGACAGAGGG + Intronic
1019701280 7:2476048-2476070 GGGTGGGGGTGGGGGTGGGAGGG - Intronic
1020098453 7:5381211-5381233 GCGCAGGGGTGGGGGACAGAGGG - Intronic
1020542086 7:9470848-9470870 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1020693284 7:11385863-11385885 GTGAGGGGGTGGAGGTAAGGGGG - Intronic
1021168135 7:17365567-17365589 GTGTGTGTGTTGGGGGCAGAAGG - Intergenic
1021432908 7:20581920-20581942 GTGAGGGGGTGGGGGAGGGAGGG + Intergenic
1021510545 7:21428181-21428203 GGGTGGGGGTGGGGGCGAGGCGG - Exonic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021938504 7:25655089-25655111 GTTTGGGGGTGGGAGTGGGATGG - Intergenic
1021941866 7:25686242-25686264 GTGTGGGGGTGGGAGTCCTCAGG + Intergenic
1022150990 7:27606166-27606188 ATATGGGGGAGGGGGTAAGATGG + Intronic
1022205117 7:28156308-28156330 GTGTGGTGGTGGTGGTCACCTGG + Intronic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022231006 7:28411560-28411582 GTGGGGGGGTGGGGGCGTGAGGG + Intronic
1022252392 7:28621190-28621212 GTTGGGGGGTGGGGGTCACAGGG + Intronic
1022514458 7:30966399-30966421 GGGTGGGGGTGGGGGCCATGGGG + Intronic
1023346028 7:39271987-39272009 GTGTGGGGGTGGGGGAGAGGGGG + Intronic
1023384755 7:39645306-39645328 GTGTGGGAGGTGGGGGCAGAAGG + Intronic
1023444145 7:40214679-40214701 GCTTGGGGGTGGGGGTCATGAGG + Intronic
1023619109 7:42051739-42051761 GGCTGGGGGTGGGGGTTATATGG - Intronic
1023836771 7:44073186-44073208 GGGTGAAGGTGGGGGTCAGGGGG + Exonic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863084 7:44227043-44227065 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863153 7:44227248-44227270 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863180 7:44227323-44227345 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1024046521 7:45589301-45589323 GTGTGGTGGTGGTGTGCAGATGG + Intronic
1024205681 7:47158227-47158249 GTTTGGGGGTGGGGGGCAAGGGG + Intergenic
1024395752 7:48864768-48864790 ATTTGGGGGTGGGGGTGGGAAGG + Intergenic
1024399482 7:48907508-48907530 ATTTGGGGGTGGGGGTGGGAAGG - Intergenic
1024697245 7:51870123-51870145 GGGTAGGAGTGGGGGTCACAAGG - Intergenic
1024813416 7:53239410-53239432 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1024861203 7:53843674-53843696 GTGTGTGTGTGTGTGTCAGAAGG - Intergenic
1025083601 7:56004945-56004967 GTGTCGGTGTGAGGGTCAGTGGG + Intergenic
1026201514 7:68218479-68218501 GGGCAGGGGTGGGGGTCATAAGG + Intergenic
1026414432 7:70163343-70163365 GTGGGGGGGGGGGGGGCAGAGGG + Intronic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026592797 7:71711276-71711298 GGGTGGGGGATGGGGTCAGGAGG - Intronic
1026936591 7:74260048-74260070 GAGTGGGGGTGGGAGAGAGATGG + Intergenic
1026945286 7:74312336-74312358 GTGGGGGGGCGGGGGTCAGGAGG + Intronic
1027188584 7:75985544-75985566 GTGTGGCGGTGGAGCTCACACGG + Intronic
1027337831 7:77173082-77173104 GTTTGGGGGTTGGGGGCCGAGGG + Intronic
1027525664 7:79266234-79266256 GGGTGGGGGTGGGGGTGGGGTGG - Intronic
1027722472 7:81761792-81761814 GAGTGGGGGTGGGGGTGGGCCGG + Intronic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1028374014 7:90126057-90126079 GGGTGGGGGTGGGGGGCAAGGGG + Intergenic
1028394970 7:90359290-90359312 GTCAGGGGGTGGGGGTCTGGGGG - Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029386747 7:100248464-100248486 GAGTCTGGGTGGGGGTCAGGGGG - Intronic
1029452244 7:100647570-100647592 AGGTGGGGGTGGGGGTCAGGTGG - Intronic
1029500717 7:100927795-100927817 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1029529781 7:101117616-101117638 GGGTGGGGGTGGAGGTCCCAGGG - Intergenic
1029777905 7:102697730-102697752 GTTTGGGGGTTGGGGGCTGAGGG - Intergenic
1030123429 7:106133038-106133060 GTGTGGGGGGGGGGGTTGGGGGG + Intergenic
1030626467 7:111850722-111850744 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1030766104 7:113411580-113411602 GGGTGGGGGTGGGGGTGGGGGGG + Intergenic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1030871736 7:114764411-114764433 GTCGGGGGGTGGGGGGCAAAGGG + Intergenic
1031155700 7:118108867-118108889 GTTTGGGGGTGGGGGGCTGAGGG + Intergenic
1031157624 7:118128194-118128216 GTCTGGGGGTGGGGGCCTGGGGG + Intergenic
1031513272 7:122673911-122673933 GGGTGGGGGTGGGGGTTGGTTGG + Intronic
1031731212 7:125303020-125303042 TTTTGGGGGTGGGGGTGAGGGGG - Intergenic
1032076483 7:128838482-128838504 GTGTGGGGGTGGGGGGAGGCTGG + Intronic
1032180281 7:129670175-129670197 GTCTGGGGGTGAGGGACAGATGG + Intronic
1032218873 7:129978860-129978882 GGGTGGGGGTGGGTGTGGGAGGG - Intergenic
1032324371 7:130913393-130913415 GAGCAGGGCTGGGGGTCAGAAGG - Intergenic
1032377564 7:131437219-131437241 GTCGAGGGGTGGGGGTCAGGGGG - Intronic
1032494313 7:132349359-132349381 GTGTGGGGGTAGGGGGCTGGTGG + Intronic
1032508805 7:132455754-132455776 GTGGGGGAGTGGGGCCCAGATGG + Intronic
1032798366 7:135297280-135297302 GTTGGGGGGTGGGGGGCAAAGGG + Intergenic
1032989805 7:137381281-137381303 GTGGGGGGGGGGGGGTGGGATGG - Intronic
1033016635 7:137678269-137678291 GTGTGTTGGTGGGGGGCAGAGGG - Intronic
1033120846 7:138665074-138665096 GCGTGGGGGTGGGGGTAGGAAGG - Intronic
1033227382 7:139572758-139572780 GGGGGGGGGGGGGGGGCAGAGGG - Exonic
1033654261 7:143362507-143362529 GGATGGGGGAGGGGGTCGGAGGG + Intronic
1033756967 7:144403823-144403845 GGGTGGGGGTGGGGGTGAGGGGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034352884 7:150428734-150428756 GAGTGTGGTTGGGGGTCGGAGGG - Intergenic
1034376525 7:150649621-150649643 GTGTGTGAGTGGGGGTCATGGGG + Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034480177 7:151313957-151313979 GTGTGAGTGTGGGTGTGAGATGG + Intergenic
1034647856 7:152664540-152664562 GTGTAGGGTTGGGGGACAGGCGG - Intronic
1034839914 7:154386294-154386316 TGGTGGGGGTGGGGGGCAGGAGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035259758 7:157653871-157653893 GGGTGGGTGTGGGGATCAGCGGG - Intronic
1035317855 7:158007944-158007966 GTGTGGGGGTGTGGGTGTGTAGG + Intronic
1035436479 7:158863702-158863724 GTGTGGGGGGGGCGGTGAGCGGG + Intronic
1035436508 7:158863776-158863798 GTGTGGGGGCGGGGGGGAGCGGG + Intronic
1035501827 8:95358-95380 ATGTGGGGGTGTGGGTGTGACGG + Intergenic
1035520736 8:273730-273752 GTGGGGGGTTGGGGGACTGAGGG + Intergenic
1035672819 8:1433109-1433131 GTGTGTGGGTGGGAGTCAGCAGG + Intergenic
1035860812 8:3026191-3026213 CTGGTGGGGTGGGGGACAGAGGG + Intronic
1037001207 8:13721547-13721569 GTTGGGGGGTGGGGGTCAAGGGG - Intergenic
1037021847 8:13982489-13982511 GTGTGGGGGTAGGGGTTATATGG + Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037401413 8:18498602-18498624 GTGTGGGGGCCGAGGCCAGATGG + Intergenic
1037521256 8:19682458-19682480 GTGTGTGGGTGAGTGGCAGAGGG - Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037728283 8:21502086-21502108 GTCTGGGGGTTGGGGGCAGGGGG + Intergenic
1037801788 8:22040023-22040045 CTGGGGGGGTGGGGTTCAGGAGG - Intergenic
1038349739 8:26765150-26765172 TTGTGGGGTTTGGGGTTAGAGGG - Intronic
1038522133 8:28242980-28243002 GTGGGGAGGTGATGGTCAGACGG - Intergenic
1038718450 8:30012282-30012304 GAGTGGGGGTGGGCATCAGCCGG - Intergenic
1038865777 8:31437248-31437270 GTGGGGGGGTGGGGGGCAAAAGG + Intergenic
1039455263 8:37701740-37701762 GTGAGGGGGTGGGTCTCTGAAGG - Intergenic
1039554590 8:38467402-38467424 GGGTGCGGGTTGGGGTCGGATGG - Intronic
1039615374 8:38951087-38951109 GGGTGGGAGTGGGGGGCAGCTGG + Intronic
1039712392 8:40068880-40068902 GTCAGGGGGTGGGGGGCAGGGGG + Intergenic
1039793761 8:40895616-40895638 GTGTGGGGGGAGGGGGCGGAGGG - Intronic
1039829338 8:41200568-41200590 GGATGGGGGTGAGGGCCAGAAGG - Intergenic
1040928941 8:52714301-52714323 GTCTGGGGCCGGGGGACAGAAGG + Exonic
1041054903 8:53974529-53974551 GGGTGGGGGTGGGGGGGGGACGG + Intronic
1041187906 8:55321011-55321033 GTGTGGTGGTGGGAGGCTGAGGG - Intronic
1041340448 8:56840442-56840464 GAGTGGGGTTGGGAGTCGGATGG + Intergenic
1041495572 8:58482086-58482108 GGGGGTGGGTGGGGGTTAGAAGG - Intergenic
1042179117 8:66067196-66067218 ATGTGGGGGTGGGGGGCGGTGGG - Intronic
1042657304 8:71113770-71113792 GTGTTGGGGTGGGGGTGGGATGG + Intergenic
1042852967 8:73235002-73235024 GTCAGGGGGTGGGGGTCTGGGGG - Intergenic
1043353989 8:79391440-79391462 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1043354962 8:79401546-79401568 GTGGGGGGGCGGGGGGCAGGGGG - Intergenic
1043368589 8:79564210-79564232 GTGAGGGGGTGGGGGGCAAGGGG + Intergenic
1043428360 8:80171172-80171194 GTGTGGGGGAGAGGGAGAGAAGG - Intronic
1044229182 8:89756068-89756090 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1044236690 8:89839537-89839559 GAGTGAGGGTGGGGGTAAGAGGG - Intergenic
1044248360 8:89977215-89977237 GTTTGGGGGTGGGGGACAAGGGG - Intronic
1044333563 8:90949182-90949204 GTGTGTGTGTGTGTGTCAGAGGG + Intronic
1044615079 8:94131822-94131844 GTCAGGGGGTGGGGGTCTGGGGG - Intronic
1044789437 8:95832692-95832714 GTGTGGGAGAAGGGGGCAGATGG + Intergenic
1044987085 8:97765290-97765312 GTGTGGGGGTAGGTAACAGAAGG - Intergenic
1045161045 8:99544309-99544331 GTTGTGGGGTGGGGGTCAGGGGG + Intronic
1045170681 8:99664462-99664484 GTTGTGGGGTGGGGGTCAGGGGG - Intronic
1045252830 8:100495827-100495849 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1045480232 8:102586104-102586126 GAGTGGGGTTGGGGAGCAGAAGG - Intergenic
1045601411 8:103721963-103721985 TTGGGGTGGTGAGGGTCAGAGGG + Intronic
1046131874 8:109975579-109975601 GTGAGGAGGTGGGGGTGGGAGGG + Intronic
1046449959 8:114375904-114375926 GTGAGGGAGTGGGGGGGAGAAGG - Intergenic
1046476541 8:114751935-114751957 GTTAGGGGGTGGGGGTCAAGGGG + Intergenic
1046783133 8:118237085-118237107 GTGTGAGGGTCTGGGTTAGATGG + Intronic
1047436961 8:124842825-124842847 CTTTGGGGGTGGGGTTGAGAAGG + Intergenic
1047584725 8:126258864-126258886 GTTAGGGGGTGGGGGTCTGGGGG - Intergenic
1047617795 8:126577423-126577445 GTGTGTTGGGCGGGGTCAGAGGG - Intergenic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1048472078 8:134712814-134712836 GGCTGGGGGTTGGGGTGAGACGG - Intronic
1048584976 8:135767377-135767399 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1048844389 8:138593213-138593235 GTCGGGGGGTGGGGGTCAAGGGG + Intronic
1048890218 8:138940483-138940505 GTGGGGGGGTGGGGGGAAGGTGG - Intergenic
1049241445 8:141539374-141539396 GTGGGGAGGTGTGGGTCAGCAGG + Intergenic
1049266469 8:141670482-141670504 GTGCGGGGGTTGGGGGCAGCAGG - Intergenic
1049298060 8:141854493-141854515 GTGTGGGGGGGGGGGGCTGTGGG - Intergenic
1049301285 8:141872074-141872096 GTGTGTGGGTGAGGGTGTGATGG + Intergenic
1049306261 8:141905881-141905903 GGGCGGGGGAGGGGGTGAGATGG + Intergenic
1049403274 8:142440359-142440381 GTGGGGAGGCAGGGGTCAGATGG + Intergenic
1049435123 8:142583035-142583057 GTGTGAGGCTGGGGGACAGAAGG + Intergenic
1049438843 8:142599997-142600019 GTGAGGAGGTGAGGCTCAGAGGG + Intergenic
1049523092 8:143104823-143104845 GAGTGGGGGTGAGGGTAAGCCGG - Intergenic
1049582242 8:143418118-143418140 GTGGGGGGTTGGGGGTGAGTTGG - Intergenic
1049582327 8:143418331-143418353 GTGGGTGGGTGGGGGTTGGAGGG - Intergenic
1049638821 8:143705232-143705254 GTGTTGGGGAGGGGGACAGCTGG - Intronic
1049674075 8:143882122-143882144 GTGTTGGGGTGGGGCAGAGAGGG - Intergenic
1049797489 8:144503332-144503354 CTGTGGAGGTGGGGCTCTGACGG + Intronic
1050036909 9:1445780-1445802 GGGTGGGGGTGAGGAACAGAGGG + Intergenic
1050099771 9:2106593-2106615 GTGGTGGGATGGGGGACAGAAGG - Intronic
1050301870 9:4267124-4267146 GTGTGGGGGTGGGTGTCTGCAGG - Intronic
1050512626 9:6412207-6412229 GAGTCGGGGTGGGGGTGAGTGGG - Intergenic
1050759196 9:9045396-9045418 GTGGGAGGGTGGGGGTAAGGTGG + Intronic
1050781205 9:9338829-9338851 GTGAGGGGGTAGGGGAGAGATGG - Intronic
1050822082 9:9891232-9891254 GTATGGGGATGGGGATGAGATGG + Intronic
1051149033 9:14060772-14060794 GTGTTGGGGTGGGGGTTACGTGG + Intergenic
1051288160 9:15517360-15517382 GTGTGGGGGTAGAGGGCATATGG - Intergenic
1051349306 9:16184122-16184144 GTGTGGAGGTGGAGGTGAGGAGG + Intergenic
1051494098 9:17699462-17699484 GTGTGGGGATTGGGGTTAGGGGG - Intronic
1051742723 9:20267288-20267310 GAGTTGGTGTGGGGGTTAGAGGG - Intergenic
1051791237 9:20804860-20804882 GGCGGGGGGTGGGGGTCACAGGG + Intronic
1052036171 9:23683629-23683651 CTGTGGGGGAGGGGGTTAGGTGG - Intergenic
1052493443 9:29195026-29195048 GTTTGGGGGTGGGGGTGGGTAGG - Intergenic
1052661655 9:31440541-31440563 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1052677346 9:31644408-31644430 CTGTCGGGGTGGGGGTCTGGGGG - Intergenic
1052732882 9:32310609-32310631 GTTGGGTGGTGGGGGTCAGTTGG - Intergenic
1052904168 9:33818369-33818391 GGGTGGGGGTGGGGGTGGGGTGG + Intronic
1052999679 9:34571087-34571109 GTGAGGGGCTGAGGGTCAGAAGG - Intronic
1053078010 9:35151409-35151431 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1053078744 9:35156422-35156444 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1053157701 9:35792028-35792050 GGGTGGGGGTGGGGGGCGGGTGG - Intergenic
1053166876 9:35851229-35851251 TGGCGGGGGTGGGGGGCAGAAGG - Intronic
1053452153 9:38202309-38202331 GGGTGGGGGTGGGGGTGGGGTGG + Intergenic
1053510848 9:38686716-38686738 GGGTGGGGGTGGGGGTGGGGGGG + Intergenic
1053803333 9:41777681-41777703 GCGTGGGGGTGGGTGACAAATGG + Intergenic
1053886774 9:42649851-42649873 GTGTGGGGGTGAGGGTGTGTGGG - Intergenic
1053886784 9:42649879-42649901 GTGTGTGGGTGGGGGTGGGCGGG - Intergenic
1054141929 9:61537443-61537465 GCGTGGGGGTGGGTGACAAATGG - Intergenic
1054191625 9:61988991-61989013 GCGTGGGGGTGGGTGACAAATGG + Intergenic
1054225793 9:62457301-62457323 GTGTGGGGGTGAGGGTGTGTGGG - Intergenic
1054225803 9:62457329-62457351 GTGTGTGGGTGGGGGTGGGCGGG - Intergenic
1054461689 9:65468621-65468643 GCGTGGGGGTGGGTGACAAATGG - Intergenic
1054646746 9:67598721-67598743 GCGTGGGGGTGGGTGACAAATGG - Intergenic
1054781280 9:69168346-69168368 TCTTGGGGGTGGGTGTCAGAGGG + Intronic
1054959139 9:70947741-70947763 GTGTGTGGGTGGGGGAAAGAAGG + Intronic
1054971591 9:71094087-71094109 GGGTGGGGGTGGGGGGCAAGGGG + Intronic
1055024338 9:71703318-71703340 CTGTGTGGGTGGGGCACAGAGGG + Intronic
1055208375 9:73761382-73761404 GTGTGTGTGTGGTGGTCACAGGG + Intergenic
1055533348 9:77210342-77210364 GTGGGTGGGTGGGGGTGAGGTGG - Intronic
1055689647 9:78815935-78815957 GTGTGGGGGGGGGGGTGGGGGGG - Intergenic
1055785326 9:79864419-79864441 GTGTGGGGCTAGGTGTCAGGGGG - Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056740546 9:89250701-89250723 GGGAGGGGGTGGGGGACAGCAGG + Intergenic
1056764390 9:89435983-89436005 ATTTGGGGGTGGGGGGCAGCGGG - Intronic
1056798978 9:89678231-89678253 GGGAGGGGGTGGGAGGCAGAGGG + Intergenic
1056861596 9:90189716-90189738 GTCAGGGGGTGGGGGGCAAAGGG - Intergenic
1057171962 9:92968402-92968424 GAATTGGGATGGGGGTCAGAGGG - Intronic
1057172562 9:92971948-92971970 GTGTGGGGGAGGGGGGTGGATGG - Intronic
1057272439 9:93658572-93658594 GTCTGTGGGTGGGGGACAGATGG + Intronic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057768543 9:97945490-97945512 GTCTGGGGGTGGGGGGCAGGGGG - Intergenic
1058847215 9:108972846-108972868 GTGTGGGTGGGGGGGTGGGAGGG + Intronic
1058929257 9:109702589-109702611 TTGTGGGGGTGGGGGTAGGGGGG + Intronic
1058942491 9:109826211-109826233 TTGTGGGGGTGGGGGTAGGGGGG + Intronic
1058993898 9:110280828-110280850 GTGTGTAGGTGGGGGTCAGAGGG + Intergenic
1059285133 9:113165907-113165929 TGGCGGGGGTGGGGCTCAGAAGG + Exonic
1059359300 9:113727887-113727909 TGGTGGGGGTGGGGGTGAGTTGG + Intergenic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1059464431 9:114458765-114458787 GGGTGGGAGTGGGAGACAGAAGG + Intronic
1059516548 9:114901056-114901078 GTGGGGAGGTGGGGTTCAGAGGG + Intronic
1059621542 9:116011185-116011207 GTGTGGGGGTGGGGGTGGGTGGG + Intergenic
1059691222 9:116687531-116687553 GGGTGGGGGTGGGGCTGCGAGGG + Intronic
1060046400 9:120344769-120344791 GTGGGGGCGGGGAGGTCAGATGG - Intergenic
1060110392 9:120902572-120902594 GGATGGGGGAGGGAGTCAGAAGG - Exonic
1060199951 9:121646505-121646527 GTGGGGGTGGGGGGGACAGAGGG - Intronic
1060385955 9:123228457-123228479 GTGTGGGGTTGGGGGACAGGGGG + Intronic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060816342 9:126637470-126637492 GTGTGGGGGTGGGGGGTTGTGGG + Intronic
1061087761 9:128409228-128409250 GTTGGGGGGAGGGGGTCAGCGGG + Intergenic
1061248188 9:129412148-129412170 GGGTGGGGGTGGGGGTGGGGTGG + Intergenic
1061306439 9:129735775-129735797 AGGTGGGGGTGGGAGACAGATGG - Intergenic
1061400525 9:130365830-130365852 TAGTGGGGGTGGGGCTGAGATGG - Intronic
1061963755 9:134001707-134001729 AGGTGGGGATGGGGGTCAGATGG - Intergenic
1062083341 9:134636094-134636116 GTGGGTGGGAGGGGGTGAGAGGG - Intergenic
1062106838 9:134759833-134759855 GTGTGGGGGTGTGCGTGAGTGGG - Intronic
1062282203 9:135757096-135757118 GGGTGGGGGTGGGGCCCAGCAGG - Intronic
1062300723 9:135866739-135866761 GGGTGGGGGTCGGGGGCAGGTGG - Intronic
1062446943 9:136599068-136599090 ATGTTGGGGTGGGGCTCACAAGG + Intergenic
1062536173 9:137022009-137022031 GTGTGGGGGAATGGCTCAGATGG + Intronic
1062536195 9:137022079-137022101 GTGTGGGGGCGTGGCTTAGATGG + Intronic
1062536206 9:137022119-137022141 GAGTGGGGGCGTGGCTCAGATGG + Intronic
1062536219 9:137022164-137022186 GTGTGGGGGCGTGGCTCAGATGG + Intronic
1062536230 9:137022204-137022226 GAGTGGGGGCGTGGCTCAGATGG + Intronic
1062559137 9:137131694-137131716 GTGTGGGGGGGGGGGGCGGGGGG - Intergenic
1062695479 9:137873664-137873686 GGATGGGGGTGGGGGACAGGGGG + Intergenic
1203607009 Un_KI270748v1:67714-67736 ATGTGGGGGTGTGGGTGTGACGG - Intergenic
1185828236 X:3273399-3273421 GTCAGGGGGTGGGGGTCTGGCGG - Intronic
1186083715 X:5962930-5962952 GTCTGGGGGTGGGGGTGGGGGGG - Intronic
1186122406 X:6377912-6377934 TAGTGGGGGTGGTGGTGAGAGGG + Intergenic
1186195988 X:7110754-7110776 GGGCAGGGGTGGGGGTCACAAGG + Intronic
1186559298 X:10593756-10593778 GTGTGTGTGTGTGTGTCAGAGGG - Intronic
1186706998 X:12151333-12151355 GTGAGGGGGTGGGGTGCACAAGG + Intronic
1186968606 X:14815166-14815188 GTCTTGGGGTGGGGGGCAGGGGG + Intergenic
1187149597 X:16669422-16669444 GGGTGGGGGTGGCGGTGAGGGGG + Intronic
1187181162 X:16945428-16945450 GTGGGGGGGTGGGGGTGGGGTGG + Intergenic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187484411 X:19688614-19688636 GTGTGTGGGTGGGTGTGGGAGGG - Intronic
1187937164 X:24347308-24347330 GGGTGGGGGTGGGGGTGGGGGGG - Intergenic
1188059027 X:25577529-25577551 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1188332472 X:28892305-28892327 GGGCAGGAGTGGGGGTCAGAAGG + Intronic
1188333330 X:28897899-28897921 GGGCAGGAGTGGGGGTCAGAAGG + Intronic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1188411227 X:29874214-29874236 GTGTGGGGGTGGGGTTCCACAGG - Intronic
1188419196 X:29975738-29975760 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1188430738 X:30103805-30103827 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1188450781 X:30306894-30306916 GTGTGTGGTTGGGGGTGGGAGGG - Intronic
1188675089 X:32929707-32929729 GTCAGGGGGTGGGGGGCAAAGGG - Intronic
1188683905 X:33045663-33045685 GTGTGTGTGTGTGTGTCAGAGGG - Intronic
1189020098 X:37326726-37326748 GTGAGGGGGTGAGGATGAGATGG + Intergenic
1189273357 X:39767300-39767322 GGGTGGGGGTGGGGGCGGGATGG + Intergenic
1189334635 X:40163575-40163597 GGGTGGGGGTGGGGGTGGGAAGG - Intronic
1190287392 X:48970538-48970560 GTGTGGGGATGGGGCCAAGAAGG + Exonic
1190375145 X:49782012-49782034 GTTTTGGAGTGGGGGTCACATGG + Intergenic
1190463807 X:50705771-50705793 GTGTGGAGTAGGGGGGCAGAAGG - Intronic
1190570771 X:51779159-51779181 GTGGGGGGGTGGTAGCCAGAGGG + Intergenic
1190582832 X:51905151-51905173 GTCAGGGGGTGGGGGACTGAGGG - Intergenic
1190641043 X:52482873-52482895 GTGTGGGGGAGGGGCTTGGAGGG - Intergenic
1190646629 X:52529992-52530014 GTGTGGGGGAGGGGCTTGGAGGG + Intergenic
1190985088 X:55492547-55492569 GGGTGGGGGTGGGGGGGAGTTGG - Intergenic
1191104630 X:56764809-56764831 GGGTAGGGGTGGGGGCCACAGGG + Intergenic
1191654140 X:63577490-63577512 TTGAGGGGGAGGGGGACAGAGGG - Intergenic
1191850496 X:65582470-65582492 GTTTGGGGGTGAGGGTGAGAAGG + Intergenic
1191908544 X:66122400-66122422 CTCTGGGGGTGGGGGTGAGGGGG + Intergenic
1191977240 X:66886938-66886960 GTGATGGGGTGGGGGTCTGGGGG - Intergenic
1192058040 X:67793222-67793244 GGGTGAGGGTGGGGGTGGGAGGG - Intergenic
1192153436 X:68726053-68726075 GTGGGGGGGTGGGGCAGAGAAGG + Intergenic
1192171828 X:68860561-68860583 GAGCGGGGGTGGGGGTGAGCAGG - Intergenic
1192199293 X:69054885-69054907 GTCATGGGGTGGGGGGCAGAGGG + Intergenic
1192204940 X:69089491-69089513 GTGTGGGGGTGGGAGTGGGGGGG - Intergenic
1192207077 X:69103478-69103500 GAGTGGGGGTGGAGGTGGGATGG - Intergenic
1192234774 X:69288929-69288951 GTTTGAAGGAGGGGGTCAGAGGG - Intergenic
1192302759 X:69923284-69923306 GTTTGGGGGTGGGGGGCAAGGGG - Intronic
1192456842 X:71283344-71283366 AGCTGGGGGTGGGGGTCGGAAGG - Intronic
1192706690 X:73533739-73533761 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1193082947 X:77423423-77423445 GGGTGGGGGTGGGGGTGGGGTGG + Intergenic
1193096698 X:77556406-77556428 AGGTGGGGGTGGGGGAGAGAGGG + Intronic
1194199205 X:90934321-90934343 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1194297665 X:92146333-92146355 TTTGGGGGGTGGGGGTGAGAGGG + Intronic
1194623244 X:96198364-96198386 GTTAGGGGGTGGGGGACAAAGGG + Intergenic
1194642980 X:96425743-96425765 GTTGGGGGGTGGGGGGCAAAGGG - Intergenic
1194786233 X:98087336-98087358 GTGGTGGGGTGGGGACCAGATGG + Intergenic
1194841171 X:98744854-98744876 GTGGGGTGGTGGGTGTGAGATGG - Intergenic
1195013062 X:100752307-100752329 GTTGGGGGGTGGGGGGCAGGGGG - Intergenic
1195225772 X:102791562-102791584 GTTGGGGGGTGGGGGTGTGAGGG - Intergenic
1195236286 X:102901843-102901865 GTGTGGGCTTTGGGGTGAGAAGG + Intergenic
1195290628 X:103429241-103429263 GGGTGGGGGCGGGGGTCACAAGG + Intergenic
1195291591 X:103435226-103435248 GGGTGGGGGCGGGGGTCACAAGG + Intergenic
1195308772 X:103609619-103609641 GGGTGGAGGTAGGGGCCAGAGGG + Exonic
1195716684 X:107825578-107825600 TTGTGGGGTTGGGGGACAGGGGG + Intergenic
1195726359 X:107921492-107921514 GGGTGGGGGTAGGGATGAGATGG - Intronic
1195756135 X:108200602-108200624 GTGTGGGGTGGGGGGAGAGATGG + Intronic
1195956254 X:110333822-110333844 GTCAGGGGGTGGGGGTCTGGGGG + Intronic
1196056383 X:111360452-111360474 TAGTGGGGGTGGGGTTGAGATGG + Intronic
1196226674 X:113176374-113176396 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1196307515 X:114121978-114122000 GTGTGGGGGTGGGGGTCTAGGGG - Intergenic
1196482675 X:116167795-116167817 GTGTGTGGGTGGAGGTGAGGCGG + Intergenic
1196496723 X:116332193-116332215 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1196685978 X:118510610-118510632 GTGTGTGGCGGGGGGTCAGCGGG + Intronic
1196909155 X:120468606-120468628 GTGTGTGGGTGGGGGACAGATGG - Intronic
1197146493 X:123178138-123178160 GTGTGGGGGTGGTGGTGATGGGG - Intergenic
1197206788 X:123797926-123797948 GTGTGGGGGGTGGGGGCAGGGGG - Intergenic
1197357251 X:125450558-125450580 TTGGGTGGGTGGGGGGCAGAGGG + Intergenic
1197382513 X:125762506-125762528 GTTGGGGGGTGGGGGGCAGTGGG + Intergenic
1197495282 X:127172253-127172275 ATGTGGGGGTGGGGGTGTGATGG + Intergenic
1197500285 X:127232820-127232842 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1197730394 X:129804863-129804885 GGGTGGGGGTGGGGGTTGGAAGG - Exonic
1198087378 X:133293899-133293921 GTCTGGGGGTGGTGGTGGGATGG - Intergenic
1198533930 X:137568684-137568706 GGGTGGGGGTGGGGGTGGGGCGG - Intronic
1198534040 X:137569217-137569239 GGGCGGGGGTGGGGGTGAGGGGG + Intronic
1198637018 X:138711794-138711816 GGGTGGGGGTGGGGGTGGGAGGG - Intronic
1198644092 X:138787704-138787726 GTTGGGGGGTGGGGGGCAAAGGG - Intronic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198708009 X:139470262-139470284 GTGTGTGGGTGGGCGAGAGAGGG - Intergenic
1198869533 X:141161194-141161216 GTCTGGGGGCGGGGGTGGGAAGG + Intergenic
1198997904 X:142596503-142596525 GTGTTCGGGTGGGTGGCAGAGGG + Intergenic
1199059538 X:143338268-143338290 GTCGGGGGGTGGGGGGCAAAGGG - Intergenic
1199141653 X:144320506-144320528 GTTGGGGGGTGGGGGTCTGGGGG + Intergenic
1199673551 X:150166059-150166081 GTGGCGGGGTGGGGGTGGGATGG + Intergenic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1199917879 X:152363926-152363948 GTCTGGGGTTGGAAGTCAGATGG + Intronic
1200015950 X:153164058-153164080 GTTGCGGGGTTGGGGTCAGATGG - Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200080008 X:153571648-153571670 GTGGGGAGGAGGGGGACAGATGG - Intronic
1200104033 X:153702573-153702595 GTGTGGGAGTGGCGTTCAGGAGG - Intronic
1200122548 X:153798002-153798024 GTGTGGGGGTGGGGAGGGGAGGG - Intronic
1200256503 X:154585602-154585624 GGGTGGGGGTGGGGGTTGGGAGG + Intronic
1200261266 X:154618801-154618823 GGGTGGGGGTGGGGGTTGGGAGG - Intronic
1200296081 X:154921875-154921897 GTTGGGGGGTGGGGGGAAGAGGG + Intronic
1200420178 Y:2956672-2956694 GGGGGGGGGTGGGGGTGAAAGGG - Intronic
1200537371 Y:4416453-4416475 GTCGGGGGGTGGGGGTCAAGGGG - Intergenic
1200615240 Y:5371232-5371254 TTTGGGGGGTGGGGGTGAGAGGG + Intronic
1200942622 Y:8801579-8801601 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1201233506 Y:11888670-11888692 GGGCAGGGGCGGGGGTCAGAGGG + Intergenic
1201581046 Y:15512516-15512538 GTGCAGGAGTGGGGGTCACAAGG - Intergenic
1202075905 Y:21037853-21037875 GAGTGGGGGGGGGGGTCACAAGG - Intergenic
1202297592 Y:23376344-23376366 ATGTGAGGGTGGGGGGCAGGGGG + Intergenic
1202573217 Y:26294253-26294275 ATGTGAGGGTGGGGGGCAGGGGG - Intergenic