ID: 950217304

View in Genome Browser
Species Human (GRCh38)
Location 3:11168734-11168756
Sequence CAGCCCGCACCCCCAGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1155
Summary {0: 1, 1: 0, 2: 4, 3: 131, 4: 1019}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950217304_950217308 4 Left 950217304 3:11168734-11168756 CCCAGGGCTGGGGGTGCGGGCTG 0: 1
1: 0
2: 4
3: 131
4: 1019
Right 950217308 3:11168761-11168783 TAAAGAACTCCTCTAATATGGGG 0: 1
1: 0
2: 1
3: 13
4: 175
950217304_950217307 3 Left 950217304 3:11168734-11168756 CCCAGGGCTGGGGGTGCGGGCTG 0: 1
1: 0
2: 4
3: 131
4: 1019
Right 950217307 3:11168760-11168782 GTAAAGAACTCCTCTAATATGGG 0: 1
1: 0
2: 0
3: 8
4: 96
950217304_950217313 24 Left 950217304 3:11168734-11168756 CCCAGGGCTGGGGGTGCGGGCTG 0: 1
1: 0
2: 4
3: 131
4: 1019
Right 950217313 3:11168781-11168803 GGGTTTACCCCATGGATTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 139
950217304_950217312 23 Left 950217304 3:11168734-11168756 CCCAGGGCTGGGGGTGCGGGCTG 0: 1
1: 0
2: 4
3: 131
4: 1019
Right 950217312 3:11168780-11168802 GGGGTTTACCCCATGGATTTGGG 0: 1
1: 0
2: 1
3: 8
4: 133
950217304_950217306 2 Left 950217304 3:11168734-11168756 CCCAGGGCTGGGGGTGCGGGCTG 0: 1
1: 0
2: 4
3: 131
4: 1019
Right 950217306 3:11168759-11168781 TGTAAAGAACTCCTCTAATATGG 0: 1
1: 0
2: 0
3: 9
4: 119
950217304_950217311 22 Left 950217304 3:11168734-11168756 CCCAGGGCTGGGGGTGCGGGCTG 0: 1
1: 0
2: 4
3: 131
4: 1019
Right 950217311 3:11168779-11168801 TGGGGTTTACCCCATGGATTTGG 0: 1
1: 0
2: 0
3: 6
4: 89
950217304_950217310 16 Left 950217304 3:11168734-11168756 CCCAGGGCTGGGGGTGCGGGCTG 0: 1
1: 0
2: 4
3: 131
4: 1019
Right 950217310 3:11168773-11168795 CTAATATGGGGTTTACCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950217304 Original CRISPR CAGCCCGCACCCCCAGCCCT GGG (reversed) Intronic
900090350 1:917605-917627 CAGCCCACACCTGCAGCACTGGG - Intergenic
900134079 1:1106872-1106894 CTGCCGGCACCCCCGGCCCTGGG + Intronic
900142814 1:1145627-1145649 CTGCCCCTGCCCCCAGCCCTCGG - Intergenic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900421243 1:2556879-2556901 CAACCCAGACCCCCAGCACTGGG + Intronic
900624647 1:3602659-3602681 CCTCCTGCACCCCCAGCCTTGGG + Intronic
901058397 1:6460289-6460311 CCCCCCGTATCCCCAGCCCTTGG + Exonic
901086269 1:6613981-6614003 CCGCCCGAGCCCCCAGCCCCGGG + Exonic
901131336 1:6963681-6963703 CAGCCCGCCCCACCAGGTCTGGG - Intronic
901250116 1:7771510-7771532 CACCGCCCACCCCCAGGCCTCGG - Intronic
901630332 1:10644891-10644913 CTGCCCGCAGCCCCAGCCCTCGG + Intronic
901671280 1:10857748-10857770 CCGCCCCCACCCCCAGCACATGG + Intergenic
901678172 1:10898734-10898756 CACCCCGCCCTCTCAGCCCTGGG - Intergenic
901814827 1:11788080-11788102 CAGCCCTTGCCCCCATCCCTCGG - Exonic
901822912 1:11841656-11841678 CAGCTCTCAGGCCCAGCCCTGGG + Exonic
901881829 1:12198645-12198667 CAGCCAGCACCCTCAGCTCCCGG - Intronic
902672285 1:17983210-17983232 CTGCCCCGACCCCCAGCCCCTGG + Intergenic
902807736 1:18871613-18871635 CAGCACCCACCCCCATCCATGGG + Exonic
903121081 1:21217548-21217570 CGGGCTGCACCCCCAGCCCTAGG + Intronic
903153399 1:21428726-21428748 CAGCCCGCAGCTCCAGCCGGTGG - Intergenic
903222325 1:21875824-21875846 CTGCCCGCACCCCTACCCCCAGG + Intronic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
903499448 1:23793386-23793408 CAGCACCAGCCCCCAGCCCTAGG + Intronic
903774216 1:25782463-25782485 CAGACAGCACCCCCACCCCTTGG - Intronic
903807817 1:26017866-26017888 CAGCCAGCATCCCCAGGGCTGGG + Intergenic
904000544 1:27336171-27336193 CAGCACTCAGCCCCAGCCCCAGG + Exonic
904217107 1:28930045-28930067 CACCCTGCAACCCCAGTCCTAGG + Intronic
904272915 1:29362215-29362237 CACCATGCAGCCCCAGCCCTGGG - Intergenic
904461861 1:30685400-30685422 CCGCCCCCTCCCCCGGCCCTGGG + Intergenic
905028946 1:34868789-34868811 CCGCCCCCACCCCCGGCCCTGGG - Exonic
905333848 1:37229699-37229721 CATCCCCCAACCCCAGCCCCTGG + Intergenic
905587630 1:39133205-39133227 CACCCCATACCCCCAGCCCCAGG - Intronic
905866488 1:41379713-41379735 CACCCCTCACCCCCAGCTCCAGG - Intronic
906204940 1:43981613-43981635 CAGCCCCCACCCTCAGCCTGGGG - Intronic
906306746 1:44724518-44724540 CAGCCCGAACCCCCGGCCCAGGG + Exonic
906745705 1:48220906-48220928 GAGCCCCCTCACCCAGCCCTTGG - Intergenic
907085776 1:51672485-51672507 CAGTCCCCAGCCCCAGCCCCCGG + Intronic
907295367 1:53448589-53448611 CAGCTCCCACCCCCACCTCTGGG - Intergenic
907327603 1:53650778-53650800 CAGGACGCTCCCCCAGTCCTGGG + Intronic
907657511 1:56359359-56359381 CAGGCCCCACCCCCAACACTGGG - Intergenic
907665216 1:56428597-56428619 CAGGCCCCACCTCCAGCACTGGG - Intergenic
908356508 1:63328812-63328834 CAGCCTGCACCCCCAGCTCCAGG + Intergenic
908439691 1:64141492-64141514 CAGGCCCCACCTCCAACCCTGGG + Intronic
910255217 1:85241214-85241236 CAGGCCCCACCTCCAGCACTGGG - Intergenic
910309821 1:85810565-85810587 CAGCCCCCACCTCCTGCACTGGG - Intronic
910685549 1:89912401-89912423 CACCCCCCACCCCCACCCTTTGG + Intronic
910746743 1:90582662-90582684 AAGTCACCACCCCCAGCCCTAGG + Intergenic
910807674 1:91204827-91204849 CAGACCCCACCTCCAACCCTGGG + Intergenic
910891380 1:92023961-92023983 CAGACCCCACCTCCAGCACTGGG - Intergenic
910948613 1:92620058-92620080 GAGCCAGCACGCCCGGCCCTTGG - Intronic
911019937 1:93375847-93375869 CACCCCCCACCCCAAGTCCTGGG - Intergenic
911412909 1:97533150-97533172 CATGCCGCACCTCCAGCACTGGG + Intronic
911698820 1:100926543-100926565 CAGGCCCCACCTCCAGCACTGGG + Intronic
912419351 1:109532662-109532684 CAGCCCTCACCCACATGCCTGGG - Intergenic
912447714 1:109750562-109750584 AAGCCTGCAGGCCCAGCCCTGGG - Intronic
912551688 1:110489308-110489330 CAGCCCTCAGCCCCTTCCCTGGG - Intergenic
912798553 1:112707052-112707074 CCGCCCGCAGCCCCGGCCCAGGG + Intronic
913111109 1:115658028-115658050 CAGGCCCCACCTCCAGCACTGGG + Intronic
913140938 1:115940833-115940855 CAGGCCCCACCTCCAGCACTGGG + Intergenic
913286429 1:117230942-117230964 CAGACCCCACCTCCAGCACTGGG - Intergenic
915472705 1:156135376-156135398 CCACCCCCACCCCCAACCCTGGG - Intronic
915524361 1:156466976-156466998 CAGCCAGCACCCACACACCTTGG + Exonic
916251469 1:162742618-162742640 CAGCCCCCACCTCCAGCATTGGG + Intronic
916343145 1:163758769-163758791 GAGCCCCCACCCCCAGCCAAGGG + Intergenic
916356208 1:163911329-163911351 CCACCCTCACCCCCAGCCCTAGG - Intergenic
916442035 1:164836649-164836671 CATCCCCCACCCCCAAGCCTGGG + Intronic
916491866 1:165309209-165309231 CGCTCCCCACCCCCAGCCCTTGG + Intronic
916532069 1:165666232-165666254 CACTCCCCACCCCCAGCCCCTGG - Intronic
916939026 1:169661315-169661337 CAGCCGGCCCCACCAGCCCTGGG + Intergenic
917027784 1:170661658-170661680 CCGCCCCCACCCCCATCCCTTGG - Intergenic
917059058 1:171017351-171017373 GAGCCCCCACCCCCAGCCAAGGG + Intronic
917073719 1:171181245-171181267 CTCCCCTCACTCCCAGCCCTTGG - Intergenic
918015763 1:180631420-180631442 CAACCCTCACCCCCAACCCCAGG + Intergenic
918276915 1:182961706-182961728 AACCCCCAACCCCCAGCCCTAGG - Intergenic
919382680 1:196878130-196878152 CAGCCCGCCCGCCCAGCGCTAGG + Intronic
920166437 1:204039534-204039556 CAGGCCCCACCTCCAGCACTGGG - Intergenic
920291567 1:204927239-204927261 CCACCTCCACCCCCAGCCCTAGG + Intronic
920303542 1:205004260-205004282 GAACCCTCACCCACAGCCCTAGG - Intronic
921134137 1:212245110-212245132 CAGGCCGCACCTCCAACACTGGG - Intergenic
921248337 1:213271405-213271427 CCACCCCCATCCCCAGCCCTCGG - Intronic
922200138 1:223394141-223394163 CAGCCGGGACTCCCAGCCCTTGG + Exonic
922616699 1:226965123-226965145 CAGTCAGCGCCCCCATCCCTGGG + Exonic
922832405 1:228610449-228610471 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922832965 1:228612690-228612712 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922833526 1:228614931-228614953 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922834086 1:228617172-228617194 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922834643 1:228619413-228619435 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922835195 1:228621628-228621650 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922835754 1:228623848-228623870 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922836312 1:228626090-228626112 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922836870 1:228628329-228628351 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922837429 1:228630571-228630593 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922837990 1:228632812-228632834 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922838548 1:228635052-228635074 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922839106 1:228637277-228637299 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922839666 1:228639518-228639540 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922840227 1:228641749-228641771 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922840787 1:228643990-228644012 CAGCCGACACCGCCAGCCCGGGG + Intergenic
922841350 1:228646221-228646243 CAGCCGACACCGCCAGCCCGGGG + Intergenic
924305933 1:242689526-242689548 CAGCCGGCACCGCCAGCCCCGGG + Intergenic
924484772 1:244470998-244471020 CAGCCCTATCTCCCAGCCCTAGG - Intronic
924610048 1:245566108-245566130 CAGGCCCCACCTCCAGCACTGGG + Intronic
924612352 1:245584055-245584077 CAGGCCCCACCTCCAGCACTGGG - Intronic
924697262 1:246413535-246413557 CAGGCCCCACCTCCAACCCTGGG - Intronic
1062928746 10:1338681-1338703 CAGCTCACAGCCCCAGCCTTAGG + Intronic
1063848694 10:10160995-10161017 CAGCCGGAGCCACCAGCCCTGGG + Intergenic
1064094545 10:12413357-12413379 CAGGCCCCACCTCCAGCACTGGG + Intronic
1064149224 10:12849048-12849070 CAGCCAGCACCCACACACCTGGG - Intergenic
1064151494 10:12869400-12869422 CAGTCCCCATCCCCAGCACTGGG + Intergenic
1064219601 10:13429174-13429196 CATCCCCCACTCCCAGCCCCTGG - Intergenic
1064234949 10:13565218-13565240 CAGGCCCCACCTCCAACCCTGGG - Intergenic
1064634119 10:17346320-17346342 GAGCCAGCACACCCAGCCCAGGG - Intronic
1065136857 10:22679857-22679879 CAACCCCTACCCCCAGCCCTAGG - Intronic
1065281951 10:24148438-24148460 CAGGCCCCACCTCCAACCCTGGG - Intronic
1065692111 10:28345219-28345241 CAGACCCCACCCCCAGCACTGGG - Intergenic
1065762655 10:28996912-28996934 GAGCCACCACACCCAGCCCTGGG + Intergenic
1065828290 10:29591824-29591846 CAGCCCTCACCCAGAGCACTTGG - Intronic
1065915517 10:30351618-30351640 CAGGCCGCACGGCCAGCACTGGG - Intronic
1065996079 10:31060693-31060715 CAGGCCCCACCCCCAACACTGGG - Intergenic
1066200175 10:33136876-33136898 CAATCCACACCCCAAGCCCTTGG - Intergenic
1066201671 10:33147782-33147804 CAGGCCCCACCTCCAGCTCTGGG - Intergenic
1066293613 10:34035493-34035515 CAGCCAGCACCACCGGCCCCGGG + Intergenic
1066648491 10:37634571-37634593 CAGCCAGCACCACCAGCCCCAGG + Intergenic
1067027781 10:42859071-42859093 CAGCCCTCCTCCCCAGCCCAAGG + Intergenic
1067047778 10:42995074-42995096 CATCCCCCACCCCTAGCCCTTGG - Intergenic
1067057118 10:43058788-43058810 CGTCCCCCACCCCCAGCCCAGGG + Intergenic
1067080988 10:43212083-43212105 CACACCACACCGCCAGCCCTGGG + Intronic
1067669465 10:48306452-48306474 CGCCCCTCACCCACAGCCCTCGG + Intergenic
1067716739 10:48696153-48696175 CAGCAGGCACACTCAGCCCTTGG + Intronic
1067806282 10:49395563-49395585 CAGCGCTCCCGCCCAGCCCTAGG + Intronic
1068820978 10:61377133-61377155 CAGCCAGCACTGCCGGCCCTGGG - Intergenic
1069258754 10:66367037-66367059 CAGCCCACACACCCGGGCCTGGG + Intronic
1069544152 10:69317354-69317376 CAGTCCCCACCCCCTGCCTTAGG - Intronic
1069642379 10:69964142-69964164 CATCCCCCACCCCCAGCCACTGG - Intronic
1069699603 10:70412391-70412413 GAGCCCCCACCCCCACCCCCCGG - Intronic
1069780180 10:70950414-70950436 CACCCTGCCACCCCAGCCCTGGG - Intergenic
1069957400 10:72060489-72060511 CAACCCCCACCCCCACCCCGAGG + Exonic
1070082763 10:73205201-73205223 CAGGCCCCACCTCCAGCACTAGG - Intronic
1070167446 10:73909552-73909574 CAGCTGGCACCCTGAGCCCTCGG + Intronic
1070324336 10:75378153-75378175 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1070581742 10:77725519-77725541 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1070655345 10:78267410-78267432 CACCCCACACCCCTAGCCCAGGG + Intergenic
1070716233 10:78723944-78723966 CAGCTCCCACACCCAGCCCCAGG - Intergenic
1070821101 10:79355034-79355056 CAGGCCCCACCTCCAGCACTGGG - Exonic
1071278421 10:84077331-84077353 CAGCCACCACACCCAGCCCCTGG - Intergenic
1071308422 10:84321063-84321085 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1071379117 10:85040029-85040051 CAGGCCCCACCCCCAACACTGGG + Intergenic
1071797075 10:89018837-89018859 CAGCCAGCCCCGCCGGCCCTGGG - Intergenic
1071805180 10:89111722-89111744 CACCCCCCACCCCCAGCCTTTGG + Intergenic
1072618758 10:97066461-97066483 CAGGCCCCACCTCCAGCACTGGG - Intronic
1072844850 10:98818292-98818314 CATCCCCCACCCCCAGCCTGTGG - Intronic
1073007048 10:100332336-100332358 CACCCCTCACCCCCAGCCTCTGG - Intergenic
1073147053 10:101288002-101288024 CAGCCCCCACTCCCACCCCAAGG + Intergenic
1073266102 10:102229414-102229436 CAGACCACACCCCCATCCCAAGG - Exonic
1073288221 10:102400931-102400953 CTGCTCGCACCCCCAGCTCCGGG + Exonic
1073357584 10:102869622-102869644 CAGCCCCCAGCCCCTTCCCTGGG + Intronic
1073359276 10:102884407-102884429 CACCCCCTACCCCCAGCCCCTGG + Intronic
1073491182 10:103854712-103854734 CTGCCCCCAGCCCCAGGCCTAGG + Intronic
1073512604 10:104052041-104052063 CAGCCCTAACCCCCTGCCCCAGG - Intronic
1073803154 10:107065800-107065822 GAGCCACCACTCCCAGCCCTAGG + Intronic
1074051969 10:109888300-109888322 CATCCTGCACACCCAGCTCTGGG - Intronic
1074771526 10:116737958-116737980 CTGCGGGCACCCCCAGGCCTGGG - Intronic
1074876805 10:117620096-117620118 CCACCCGCACCCTCAGCCCCAGG - Intergenic
1075046632 10:119151409-119151431 CCACCCCCACCCCCAGCCCTAGG - Intronic
1075107657 10:119552414-119552436 CAGCCCTCAGCCCCCGCCCCAGG - Intergenic
1075522952 10:123154862-123154884 CAGTGCGCAGCCCCAGCCCGCGG + Intronic
1075554612 10:123421383-123421405 CAGCCCACACCCCCAGACGCTGG - Intergenic
1076053181 10:127351479-127351501 CAGCACGCACCCCCAGGACAGGG - Intronic
1076064681 10:127439900-127439922 CAGCCCTCAGGCCCAGCCCCAGG - Intronic
1076224737 10:128764983-128765005 CAGCCCTTACCCCCAGCACCAGG - Intergenic
1076418037 10:130306203-130306225 CAGGCCCCACCCCCAGCATTGGG + Intergenic
1076465625 10:130679597-130679619 CAGGCCCCACCCCCAACACTGGG - Intergenic
1076584642 10:131537257-131537279 CAGCCCCCACCCCCAGCCTCTGG + Intergenic
1076761947 10:132610349-132610371 CACCCCCCACCCCCATCACTGGG - Intronic
1076993904 11:289281-289303 CGGCCCGTCCCCCCAGCCCCCGG + Intronic
1077124465 11:926207-926229 CCGCCCGCACCCTCAGGCCCCGG - Intronic
1077124503 11:926288-926310 CCGCCCGCACCCCCAGACCCTGG - Intronic
1077124530 11:926368-926390 CACCCCGCACCCCCAGACCCAGG - Intronic
1077211765 11:1374448-1374470 CAGGCCTCACCCCCAACTCTGGG - Intergenic
1077218701 11:1405784-1405806 CAGCCCGCATCTCCAGCGCTCGG + Intronic
1077299575 11:1840797-1840819 CCGCCCCCACACCCACCCCTAGG + Exonic
1077300478 11:1844300-1844322 CTGCCCACAACCCCTGCCCTGGG - Intergenic
1077327333 11:1969426-1969448 CAGCCTGCCCTCCCGGCCCTGGG + Intronic
1077439718 11:2562207-2562229 CCGCCCTCACCCCCACCCCCCGG - Intronic
1077495404 11:2884595-2884617 CGGCCGGTCCCCCCAGCCCTCGG - Intronic
1077694719 11:4383836-4383858 CATCCCAAAGCCCCAGCCCTGGG + Intergenic
1078106032 11:8358438-8358460 CAGACCTCAGCCCCTGCCCTTGG - Intergenic
1078170167 11:8923846-8923868 CACCCCCCACCCCCACCCCCCGG + Intronic
1078516867 11:12029968-12029990 CAACCAGCATCCCCAGCCCATGG - Intergenic
1079085588 11:17442690-17442712 CACCCCACACAGCCAGCCCTGGG - Intronic
1079299838 11:19268088-19268110 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1079334022 11:19555427-19555449 CAGCCAACACTCCCAGACCTGGG + Intronic
1080012367 11:27472104-27472126 CCGCCCGCACTCACAGCGCTTGG + Exonic
1080223506 11:29934261-29934283 CAGCCAGCACCGCCGGCCCTGGG + Intergenic
1080230847 11:30016794-30016816 CAGCCCCAACCCCCACCCCCAGG - Exonic
1080503089 11:32888430-32888452 CAGCCAGCCCCGCCAGCCCTGGG - Intergenic
1080688275 11:34534031-34534053 CAGGCCACTCCCCAAGCCCTAGG - Intergenic
1080858940 11:36136405-36136427 CAGGCCCCACCTCCAGCACTGGG - Intronic
1080873505 11:36257369-36257391 CTGCCCCCACCCCCTGCCCCAGG - Intergenic
1081207588 11:40293339-40293361 CCGCCCCCACCCCCAGCACCCGG + Exonic
1081699124 11:45141667-45141689 AAGCCTGCACCACCAGCCCTAGG + Intronic
1081797430 11:45830760-45830782 CACCTCACACCCCCAGCTCTAGG - Intergenic
1081937923 11:46917880-46917902 CCGCCCGAGCCCCCAGCCCCAGG + Intronic
1082274218 11:50204143-50204165 GAGCCACCACCCCCAGCCCCAGG - Intergenic
1082811785 11:57482903-57482925 CAGCCCCCTCCCCAAGCCCCGGG + Intergenic
1082924619 11:58532047-58532069 CGGCCAGCACCGCCAGCCCCAGG + Intronic
1083277287 11:61603912-61603934 CAGCCCCGCCTCCCAGCCCTGGG - Intergenic
1083385921 11:62310296-62310318 CAGGCCCCACCTTCAGCCCTGGG + Intergenic
1083492443 11:63022791-63022813 CTGCCCTCACCCCCAGCACCAGG - Intergenic
1083590117 11:63888835-63888857 GAGCCGGCAGCCCCCGCCCTAGG + Intronic
1083741046 11:64712019-64712041 CAGGCCGCACTTCCCGCCCTTGG + Intronic
1083747642 11:64744652-64744674 CAGCCCGCCCGCGCCGCCCTGGG + Intronic
1083758280 11:64802816-64802838 CCGCCCGCACCCCGCGCCCGCGG + Intronic
1083932316 11:65852799-65852821 CAGCCCCCAGCCCCAGCCTGGGG + Intronic
1084028377 11:66466881-66466903 CATCCCCCTCCCCCGGCCCTGGG + Exonic
1084041892 11:66547236-66547258 CAGCCCTCTCCTCCAGCCCTGGG - Intronic
1084184402 11:67464114-67464136 CCTGCCCCACCCCCAGCCCTTGG - Exonic
1084240702 11:67817878-67817900 CAGCCAGCCCCGCCGGCCCTGGG - Intergenic
1084333579 11:68444569-68444591 CACCCCCCACCCCCCACCCTGGG + Intronic
1084734107 11:71093428-71093450 CAGGCCCCACCTCCAGCACTGGG - Intronic
1084734237 11:71094112-71094134 CAGGCCCCACCCCCAGCACTGGG - Intronic
1084891529 11:72239330-72239352 AAGCCCGCTGCCCCACCCCTCGG - Exonic
1085024452 11:73228431-73228453 CATCCCCCACCTCCATCCCTTGG - Intronic
1085051680 11:73383187-73383209 CTGCCCCCTCCCACAGCCCTGGG - Intronic
1085435119 11:76493239-76493261 CCGCCCCCACCCCCAGACTTTGG + Intronic
1086158250 11:83692469-83692491 CACCCCCTACCTCCAGCCCTAGG - Intronic
1086301474 11:85431320-85431342 GAGCCCCCACCCCCAGCCAAGGG + Intronic
1087433199 11:98079882-98079904 CAGGCCTCACCTCCAGCACTGGG - Intergenic
1088421121 11:109648159-109648181 CAGGCCACACCTCCAGCCCTGGG - Intergenic
1089068665 11:115681667-115681689 AAGCCACCACGCCCAGCCCTGGG - Intergenic
1089165400 11:116472135-116472157 CAGCCCCAGCCCCCAGCTCTAGG + Intergenic
1089329051 11:117677269-117677291 CAGCCCCCGACCCCAGCCCTTGG - Intronic
1089356948 11:117860193-117860215 CAGCCCCAAACTCCAGCCCTTGG + Intronic
1089384560 11:118059313-118059335 CTGCCCCCACCCCCATGCCTGGG - Intergenic
1089392736 11:118113171-118113193 CATCCAGCACCCCGATCCCTAGG + Intronic
1090227996 11:125083068-125083090 CTGCCCTCCCTCCCAGCCCTGGG + Intronic
1090847874 11:130545981-130546003 AGGCCCTCACCCCCATCCCTGGG - Intergenic
1091211737 11:133866374-133866396 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1091225912 11:133956480-133956502 CCGCCCGCCCCTCCAGCCCACGG + Intronic
1202810315 11_KI270721v1_random:24606-24628 CAGCCTGCCCTCCCGGCCCTGGG + Intergenic
1091490184 12:926073-926095 CAGGCCGCACCCCCCGGCATTGG - Intronic
1091668565 12:2436498-2436520 CAGCCCAAACCCCCAGCCAAGGG - Intronic
1091761873 12:3092926-3092948 TCGCCAGCTCCCCCAGCCCTGGG - Intronic
1091771807 12:3156887-3156909 CAGCCCTTGCCCCCTGCCCTGGG - Intronic
1091876074 12:3933936-3933958 CAGTCCCCACACCCTGCCCTTGG - Intergenic
1092049312 12:5456611-5456633 CCACCCCCACCCCCAGCCCCTGG + Intronic
1092284157 12:7119213-7119235 CACCCCTACCCCCCAGCCCTTGG - Intergenic
1093297571 12:17410149-17410171 CATCCCCCACCCCCACCCCACGG - Intergenic
1093741386 12:22693306-22693328 CGGCCAGCGCCGCCAGCCCTGGG - Intergenic
1093883612 12:24434560-24434582 CAGGCCCTACCTCCAGCCCTAGG - Intergenic
1094002327 12:25708166-25708188 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1094160142 12:27381597-27381619 CAGGCCCCACCTCCAGCACTGGG + Intronic
1094189425 12:27682426-27682448 CAGCTAGCACTCCAAGCCCTGGG + Exonic
1094650422 12:32370510-32370532 CAGCCCTTACCCCAAGGCCTGGG + Intronic
1094814063 12:34166696-34166718 CCACCCGCACCCCCATCCCTAGG + Intergenic
1095582403 12:43815027-43815049 GAGCCACCACACCCAGCCCTGGG + Intergenic
1095705676 12:45234717-45234739 AACCCCCCACCCCCACCCCTGGG + Intronic
1095728191 12:45474853-45474875 CAGGCCTCACCTCCAACCCTGGG - Intergenic
1096109774 12:49021662-49021684 CAGCCGGCAGCCCCAACCCTGGG + Exonic
1096199740 12:49673129-49673151 CAGCCCCCACACTCAGCCCATGG + Intronic
1096325111 12:50653444-50653466 CCGCCCCTACCCCCAGCCCTGGG + Intronic
1096384715 12:51187569-51187591 CACCCTGCACCCCCATGCCTGGG + Exonic
1096550705 12:52369961-52369983 AAGCCCCCAGCCCCAGCCCTGGG - Intergenic
1096569697 12:52515019-52515041 CAAAGCCCACCCCCAGCCCTCGG + Exonic
1096647706 12:53047501-53047523 GAGCCCCCGGCCCCAGCCCTGGG - Intronic
1096691748 12:53325719-53325741 CAGGCCGCTCCCCCCGGCCTGGG - Intergenic
1097490933 12:60269844-60269866 CAGCCCGCGTCCCCGGCCCGGGG + Intergenic
1097802371 12:63928645-63928667 CCGCCCCCACCCCCAGTCCATGG - Intronic
1098055630 12:66502517-66502539 CAGGCCCCACCTCCAGCACTGGG - Intronic
1098141038 12:67450534-67450556 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1098694609 12:73537398-73537420 GAGCCCCCACCCCCAGCCAAGGG + Intergenic
1098880693 12:75914233-75914255 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1100100532 12:91098620-91098642 CAGCCCTCACCCTCAGCTCCTGG - Intergenic
1100600301 12:96107185-96107207 AAGCCAGCACGCCCAGCCCGGGG + Intergenic
1100986344 12:100204774-100204796 GAGCCCCCACTCCCAGCCTTTGG + Intronic
1101973603 12:109335436-109335458 CAGGCCCCACCCCCAGCATTGGG + Intergenic
1102024577 12:109706970-109706992 CCTCCCGCAGCCCCAGACCTGGG - Intergenic
1102823360 12:115926595-115926617 TACCCCTCACCCCCAGCCCAGGG - Intergenic
1102969522 12:117155394-117155416 CAGCCGGCAGCCACAGCCTTGGG + Intronic
1103274475 12:119700205-119700227 CAGCCCACAGTCCCAGCCCTGGG - Intronic
1103531268 12:121603835-121603857 AAGCCTCCACGCCCAGCCCTTGG - Intergenic
1103991333 12:124801279-124801301 CCGCCCCCTCCCCCAGCCCCTGG - Intronic
1104462448 12:128966607-128966629 CTGCACGCAGCCCCAGCACTTGG + Intronic
1104513750 12:129404819-129404841 CAGGCCCCACCCCCAACACTAGG + Intronic
1104745287 12:131206806-131206828 GAGCCCCCACCCTCTGCCCTTGG + Intergenic
1104789050 12:131470300-131470322 GAGCCCCCACCCTCTGCCCTTGG - Intergenic
1104980314 12:132570565-132570587 CACCCCCCAACCCCTGCCCTGGG - Intronic
1105528778 13:21199774-21199796 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1105812715 13:24008924-24008946 CAGCCCCCACCTCCCGCACTTGG - Intronic
1106379531 13:29223148-29223170 CAGCCTGGGCCCCCAGGCCTTGG - Intronic
1106810004 13:33350153-33350175 CAGCCCGCTCGCCCCGGCCTTGG + Intronic
1107468136 13:40667075-40667097 CACCCCGCGCCCCCGGCCCTCGG - Intergenic
1107759703 13:43664960-43664982 CAGCCTGCAGCCCCACCCCCAGG + Intronic
1108156421 13:47589918-47589940 CTGCCCCCACCCCCAGTCCCAGG - Intergenic
1108354022 13:49614092-49614114 AAGCCACCACGCCCAGCCCTGGG + Intergenic
1108880423 13:55107656-55107678 AAGCCCCCACCCCCAGCCAAGGG + Intergenic
1109968474 13:69734060-69734082 CAGGCCCCACCTCCAGCACTGGG - Intronic
1110732187 13:78891394-78891416 CCCCACCCACCCCCAGCCCTAGG - Intergenic
1110817881 13:79881668-79881690 CAGACCTCACCTCCAACCCTGGG - Intergenic
1110836974 13:80094082-80094104 GAGCCCCCACCCCCAGCCAAGGG - Intergenic
1111790682 13:92851213-92851235 CAGGCCCCACCTCCAGCACTGGG + Intronic
1112091979 13:96091464-96091486 CAGCCCGCAGCTCCAGCCGGTGG - Exonic
1112180930 13:97079376-97079398 CAGGCCCCAACTCCAGCCCTGGG + Intergenic
1112397381 13:99045491-99045513 CAAACCCCACCCCCAGCCCCTGG - Intronic
1114337664 14:21708873-21708895 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1114541801 14:23466224-23466246 AAGCCACCACACCCAGCCCTGGG - Intergenic
1114674178 14:24430041-24430063 TTGCCCGCGCCCCCAGCCCAGGG - Intronic
1115174607 14:30547779-30547801 CGGCCGGCACTGCCAGCCCTGGG - Intergenic
1115649330 14:35391629-35391651 GAGCCACCACACCCAGCCCTGGG - Intergenic
1115795766 14:36933708-36933730 CAGCCCCCTCCTCCAGCCCCAGG + Intronic
1116677149 14:47920308-47920330 GAGCCCCCACCCCCAGCCAAGGG - Intergenic
1116910974 14:50463808-50463830 CAGCCTCCACCCCCACCCCCTGG - Intronic
1116914568 14:50510930-50510952 CAGCCAGCAACCCCACTCCTTGG + Intronic
1117047029 14:51823585-51823607 TGGCTCCCACCCCCAGCCCTGGG + Intergenic
1117449805 14:55839607-55839629 CGGCCGGCCCCACCAGCCCTGGG + Intergenic
1118188544 14:63559520-63559542 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1118424953 14:65650613-65650635 CAGGCCCCACCTCCAGCACTGGG + Intronic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1118517174 14:66543176-66543198 CAGGCCCCACCCCCAGCATTGGG + Intronic
1118703355 14:68457195-68457217 GAGCCAACACGCCCAGCCCTGGG + Intronic
1118726564 14:68633109-68633131 GAGCCACCACACCCAGCCCTGGG + Intronic
1118760964 14:68879909-68879931 CAGCCCCCAACCCCTGCCCCAGG - Intronic
1118991739 14:70802929-70802951 CAGGCCCCACCGCCAGCACTGGG - Intronic
1119330171 14:73787404-73787426 TAGCCTGCACCCCCCGCCCTGGG + Intronic
1119476783 14:74935005-74935027 CCACCGCCACCCCCAGCCCTCGG - Intergenic
1119530976 14:75361193-75361215 GAGCCCCCACGCCCAGCCCCAGG + Intergenic
1120203096 14:81559755-81559777 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1120495539 14:85230218-85230240 GAGCCACCACCCCCGGCCCTAGG + Intergenic
1120684526 14:87522840-87522862 CAGGCCCCACCCCCAACCTTAGG + Intergenic
1120749667 14:88186211-88186233 CTCCCAGCACCCACAGCCCTCGG + Intronic
1120902331 14:89586657-89586679 CTGCCCGCATCCCCTGCACTGGG - Intronic
1121038794 14:90728211-90728233 GAGCCACCACTCCCAGCCCTGGG - Intronic
1121142341 14:91554709-91554731 CAGCTCCCACCCCCAGCCAGGGG + Intergenic
1121624997 14:95377381-95377403 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1121628355 14:95403997-95404019 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1121871485 14:97412079-97412101 CTGCCCCCACCTCCGGCCCTGGG + Intergenic
1122056553 14:99102317-99102339 CAGGCCTCACCTCCAGCACTGGG - Intergenic
1122112762 14:99513633-99513655 TTGCCTGCATCCCCAGCCCTGGG + Exonic
1122121873 14:99558846-99558868 CAGGCCCCACCTCCAGCACTGGG - Intronic
1122370289 14:101225702-101225724 CATCCCCCACCCCCACTCCTTGG - Intergenic
1122438663 14:101715678-101715700 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1122798482 14:104218171-104218193 CAGCCTGAACTCCCAGCCCTGGG + Intergenic
1122818435 14:104327032-104327054 CAGCCGGCAGCCCCATCCCAAGG - Intergenic
1122904379 14:104795263-104795285 CAGCCTGCACCCCCGGCGCCCGG + Intronic
1122968811 14:105144160-105144182 CAGCCCCCACCCCCACCTATGGG + Intronic
1123123251 14:105927768-105927790 CCTCCAGCACCCCCAGACCTTGG - Intronic
1123213749 14:106786509-106786531 CAGACCCCAGCCCCAACCCTGGG + Intergenic
1124025492 15:25961746-25961768 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1124051109 15:26198230-26198252 CAGCCCCCACCTCCAACACTGGG + Intergenic
1124439307 15:29675121-29675143 CAGCACGCCGCCCCAGTCCTCGG + Intergenic
1125608798 15:40957308-40957330 GAGCCACCACACCCAGCCCTTGG - Intergenic
1125665029 15:41423651-41423673 GAGCCACCACGCCCAGCCCTGGG + Intronic
1125725650 15:41866934-41866956 CAGAGGGCACCCCCAGCCCAGGG - Intronic
1125758126 15:42079605-42079627 CAGCCCGCAGCTCCAGCTCCCGG + Exonic
1126937215 15:53724139-53724161 CTTCCCTCACCCCCAGCCATTGG - Intronic
1127234667 15:57036046-57036068 CACCCCCCACCCCCAGCTCCTGG + Intronic
1128112679 15:65086562-65086584 CAGGCAGCCTCCCCAGCCCTGGG + Intergenic
1128741770 15:70088882-70088904 CCGCCCCCACCCCCACCCCGCGG + Intronic
1128877675 15:71215352-71215374 CAGCCGGCACCCACAGCCCCAGG + Exonic
1129064997 15:72894956-72894978 CTGCCCCCACCTCCAGCCCCAGG + Intergenic
1129108067 15:73322713-73322735 CCGCTGCCACCCCCAGCCCTGGG + Exonic
1129231798 15:74201205-74201227 CAGGCCGCAGCCCCAGCCCCTGG + Intronic
1129240125 15:74245977-74245999 CAGTGCTCACCCCCAGCCCCAGG + Intronic
1129526672 15:76221310-76221332 CAGCCCCCAGCCCCAGCTCCTGG - Intronic
1129614609 15:77088545-77088567 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1129653894 15:77510234-77510256 TTGCCCACACCCCCAACCCTCGG + Intergenic
1129682884 15:77667930-77667952 TTGCCCTCAGCCCCAGCCCTGGG - Intronic
1129924780 15:79354447-79354469 CAGCCAGAACCCTCAGCCATTGG + Intronic
1130068207 15:80623745-80623767 CACCCCCCACCCCCAGCCCAAGG - Intergenic
1130580190 15:85130266-85130288 CAGACCCCACCTCCAGCACTGGG + Intronic
1130901070 15:88207112-88207134 CTGGCTGCATCCCCAGCCCTCGG + Intronic
1130921323 15:88347539-88347561 CTGCCCCCACCCTCAGCCCATGG + Intergenic
1130938663 15:88490334-88490356 CCACCCCCACCCCCTGCCCTTGG + Intergenic
1131082509 15:89548485-89548507 AAGCCTGCAACCCCAGCCTTTGG - Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131463946 15:92639602-92639624 CAGGCCCCACCTCCAGCACTGGG - Intronic
1132196865 15:99920031-99920053 CTGCCCCCACCCCCAGCTCTGGG + Intergenic
1132365049 15:101251301-101251323 CTGCCCGGACCGGCAGCCCTCGG + Exonic
1132365102 15:101251507-101251529 CAGCCCGCTGCCCCCGCCCGCGG + Exonic
1132931477 16:2461125-2461147 GAGCCCGAACCCCCAGGCCTGGG + Exonic
1133156890 16:3881528-3881550 CAGGCCGCACTCCCCGCCCCAGG + Intergenic
1133223170 16:4327901-4327923 CAGCCCTCGCCCCAACCCCTGGG + Intronic
1133421392 16:5650148-5650170 CAGCCCCCACCCCCAACTCCTGG + Intergenic
1133770481 16:8864766-8864788 CAGCCGACACACCCATCCCTGGG - Intronic
1134185114 16:12078929-12078951 CAGCCCCCTCCACCAGCTCTGGG + Intronic
1134229680 16:12419217-12419239 CAACCCCTACCACCAGCCCTCGG - Intronic
1134321859 16:13171268-13171290 CAGGCCCCACCCCCAACACTGGG + Intronic
1135989963 16:27212345-27212367 CAACCCACACCCCATGCCCTTGG - Intronic
1136146742 16:28320736-28320758 CGGCCCGCGCCCCCCGCCGTCGG + Exonic
1136219977 16:28822829-28822851 AACCTCGCACCCCTAGCCCTGGG - Intergenic
1136280873 16:29210458-29210480 CAGCCAGCTCCCCCAGGCCCAGG - Intergenic
1137538069 16:49342433-49342455 CAACTCCCACCCCCAGCCCCTGG - Intergenic
1137613208 16:49832805-49832827 CAGTCACCACCCCCAGCCCCAGG + Intronic
1138180706 16:54938523-54938545 CTGCCCGCACCTCCAGCGCTGGG + Intergenic
1138402728 16:56760701-56760723 CAGGCCCCACCCCCAACACTGGG + Intronic
1138659685 16:58509723-58509745 CAGCTCTGACCCCAAGCCCTGGG - Intronic
1138971622 16:62151245-62151267 CAGCCCCCACTCCCCGCCCCCGG + Intergenic
1139019007 16:62724966-62724988 CAGCCCGCCCCGCCAGCCCCGGG + Intergenic
1139106384 16:63831599-63831621 CAGTCCCCACCTCCAGCACTGGG - Intergenic
1139430204 16:66907073-66907095 CAGCCAGGATCCCCAGCCCAGGG - Intergenic
1139470938 16:67177905-67177927 CAGGCCTGACACCCAGCCCTCGG + Intronic
1139475479 16:67200564-67200586 CTGCCCCCACCCGCTGCCCTAGG - Intronic
1139583120 16:67884839-67884861 CAGCCCGTCCGCCCAGCCCCCGG - Exonic
1139589457 16:67925562-67925584 CTGCGCCCACCCACAGCCCTTGG + Intronic
1139655862 16:68386972-68386994 CACCCCGCACCCCCTGCGCCTGG - Intronic
1140582579 16:76249191-76249213 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1141055784 16:80812478-80812500 CACCCCCCACCCCCATCCCTAGG + Intergenic
1141389941 16:83656091-83656113 CACCCCTCACACCCAGCCCCTGG + Intronic
1141660086 16:85436882-85436904 CAGCCCGCCCCCACAGTCCCGGG - Intergenic
1141715820 16:85726285-85726307 CAGGCAGCACACTCAGCCCTCGG - Intronic
1142085229 16:88176380-88176402 CAGCCAGCTCCCCCAGGCCCAGG - Intergenic
1142132499 16:88437397-88437419 CAGCCCGTCCCCCGACCCCTGGG + Exonic
1142173190 16:88633546-88633568 CAGCCCCCGGCCACAGCCCTAGG + Intergenic
1142193063 16:88726679-88726701 CCCCCCGCACCCACCGCCCTGGG - Intronic
1142285322 16:89169310-89169332 GTCCCCCCACCCCCAGCCCTTGG - Intergenic
1142322296 16:89391320-89391342 CAGCACCCACCGCAAGCCCTGGG - Intronic
1142440399 16:90094250-90094272 CCACCCGCACCCCCATCCCTAGG - Intergenic
1203120209 16_KI270728v1_random:1529629-1529651 CCCCCCCCACCCCCGGCCCTGGG - Intergenic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1142812487 17:2401755-2401777 CACCCCGCGCCGCCAGCCTTCGG + Intergenic
1143743350 17:8971060-8971082 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1143999316 17:11037931-11037953 CAGGCCCCACCCCCAACACTGGG + Intergenic
1144437163 17:15252282-15252304 CAGCCCCCAACCTGAGCCCTTGG - Intronic
1144682707 17:17206068-17206090 CAGGCCGCACGGGCAGCCCTCGG + Exonic
1144738704 17:17569219-17569241 CAGACCAAAGCCCCAGCCCTTGG - Intronic
1144825739 17:18104757-18104779 CAGAGCCCACCCCCAGCCCAGGG - Intronic
1145005505 17:19335547-19335569 CACCCCCCACCCCACGCCCTCGG - Exonic
1145848703 17:28069073-28069095 CATCCCCCTCCCCCTGCCCTAGG + Intronic
1146282886 17:31557102-31557124 GAGCCCCCACCCCCTGCCCCCGG + Intergenic
1146469481 17:33112390-33112412 CAGTCCACACCTCCAGCCCTGGG + Intronic
1146651711 17:34611208-34611230 CAACCCACACCCCCAGGTCTGGG - Intronic
1146940213 17:36839302-36839324 CTTCCCGCACCCCCAGCACAAGG + Intergenic
1147476502 17:40716677-40716699 AAACCCCCACCCCCAGCCTTAGG - Intergenic
1147969718 17:44212784-44212806 CATCCTCCACCCCCAACCCTTGG + Intronic
1147995142 17:44356057-44356079 CATTGCGCACCCACAGCCCTGGG + Exonic
1148052644 17:44776688-44776710 CAGCCCTCAGCTCCAGTCCTGGG + Intronic
1148388242 17:47252188-47252210 CATCCTGCACTCCCAGCCCCAGG - Intergenic
1148688342 17:49513075-49513097 GAGCCCGCACCCCCACCCTTTGG + Exonic
1148970780 17:51479419-51479441 CACCCCCCACCCCCACCCCTTGG + Intergenic
1149189432 17:54041401-54041423 CAGGCCCCACCTCCATCCCTGGG + Intergenic
1149242253 17:54663715-54663737 GAGCCCCCACCCCCAGCCAAGGG - Intergenic
1149294580 17:55250323-55250345 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1149610323 17:57954777-57954799 CAGCCTGCGCCCCCAGGCCCGGG + Intronic
1149626736 17:58084809-58084831 CAGGCCCCACCCCCACCCCTGGG + Intronic
1149772253 17:59331492-59331514 CCGCCCACTCCCCCACCCCTCGG - Intergenic
1150006321 17:61471072-61471094 CAGCCCACACCTCTAGCCCAGGG - Intronic
1150250288 17:63700818-63700840 CCGGCAGCCCCCCCAGCCCTCGG + Intronic
1150294101 17:63998691-63998713 CCGCGCACACCCCCAGCCCTGGG + Exonic
1150481747 17:65516539-65516561 CCGCCCCCATCCCCAGCCCTAGG - Intergenic
1150613527 17:66751997-66752019 CAGGCCCCACCTCCAGCACTGGG + Intronic
1150752904 17:67882720-67882742 CAGCCACCACGCCCAGCCCAGGG - Intronic
1151120611 17:71788799-71788821 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1151187041 17:72372084-72372106 CTACCCACACCCCCAGCCCCAGG - Intergenic
1151214773 17:72569881-72569903 CAGCCCCAAACCCAAGCCCTTGG - Intergenic
1151419645 17:73988726-73988748 CAGTCCCCACCCCCAACACTGGG - Intergenic
1151711445 17:75809306-75809328 CAGCCCACAGCCCCAGCTCATGG + Intronic
1151818446 17:76483567-76483589 CAGCCACCACACCCGGCCCTAGG + Intronic
1152092219 17:78253238-78253260 CGACCCCCAGCCCCAGCCCTGGG - Intergenic
1152318484 17:79594761-79594783 CTGCCTACACCCCCAGCCCCTGG - Intergenic
1152362005 17:79837177-79837199 CAGCGCCCACCCCAGGCCCTTGG + Intronic
1152370209 17:79883110-79883132 CCACCCCCACCCCCAGCCCTAGG + Intergenic
1152506870 17:80755157-80755179 CATCATGAACCCCCAGCCCTGGG - Intronic
1152547682 17:81010226-81010248 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1152598848 17:81251424-81251446 CAGCCCCCTCCCCCAGCCCTGGG - Intronic
1152625999 17:81388224-81388246 AAGCCCTCACCTCCAGCCCCTGG - Intergenic
1152652662 17:81502789-81502811 CAGCAGGCAGCCCCAGCACTTGG + Intergenic
1152876940 17:82791858-82791880 CAGGCCGCACCACCTGGCCTGGG - Intronic
1152926592 17:83090339-83090361 CACCCCCCACCCCCCGCCCCAGG + Intronic
1152930345 17:83106129-83106151 CAGCCTGCATCTTCAGCCCTGGG + Intergenic
1152957163 18:49308-49330 CCACCCGCACCCCCATCCCTAGG + Intronic
1153051765 18:907506-907528 CTGCTCCCACCCCCAGTCCTGGG + Intronic
1153104818 18:1514192-1514214 CAGCCCCCACCTCCAGCATTGGG + Intergenic
1153518249 18:5925348-5925370 CAGCCCCCACCTCCAACACTGGG + Intergenic
1153771730 18:8422197-8422219 CAGGCCCCACCTCCAGCCCTGGG - Intergenic
1153781856 18:8501801-8501823 CTGCCCCCACCCCCTACCCTAGG + Intergenic
1154305054 18:13224367-13224389 CAGCACACACCCCCAGACCCAGG - Intronic
1156250220 18:35345243-35345265 CTGCCCGCACCCCCAGACCCTGG + Intronic
1156670126 18:39458818-39458840 CAGGCCCCACCCCCAACACTGGG - Intergenic
1157100019 18:44720906-44720928 CACCCCCCACCCCAACCCCTTGG + Intronic
1157522981 18:48357923-48357945 CAGCCCTCACCTCCAACGCTGGG - Intronic
1157595751 18:48862687-48862709 CACCCCCCACCCTCATCCCTCGG - Intronic
1157605304 18:48922742-48922764 CTGCCGGCACCCCCATCCCCAGG + Intronic
1158446804 18:57529176-57529198 CAGGCCCCACCTCCAACCCTGGG + Intergenic
1158790829 18:60778626-60778648 CAGGCCCCACCCCCAGCACTGGG - Intergenic
1159607174 18:70487066-70487088 CAGGCCCCACCTCCAGCCTTGGG - Intergenic
1159945967 18:74445143-74445165 CAACCCCCACCCCCAGCTCTGGG - Intronic
1160010328 18:75102443-75102465 CAGCCCCCACCTCCAACACTGGG + Intergenic
1160272894 18:77403729-77403751 AAGGCCACACCCCAAGCCCTGGG + Intergenic
1160272953 18:77404058-77404080 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1160447800 18:78941030-78941052 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1160455162 18:78994475-78994497 CTGCCCGCCCTCCCCGCCCTCGG + Exonic
1160463658 18:79058006-79058028 CAACCCCCACCCCCACCCCCTGG + Intergenic
1160531466 18:79567497-79567519 CAGCCAGCACCCCCTGACCAGGG - Intergenic
1160571048 18:79817989-79818011 CAGCACCCACCCTGAGCCCTTGG - Intergenic
1160607041 18:80059140-80059162 CAGAGCGGACCCCCAGCCCTCGG + Intronic
1160670251 19:359013-359035 CAGCCCGCAACCCCACACCAGGG + Intergenic
1160681936 19:415830-415852 CAGGCCCTACCCCCTGCCCTGGG - Intergenic
1160793648 19:934132-934154 CTGCCCGCCCCTCCAGCCCAGGG - Intronic
1160823027 19:1067125-1067147 CAGGCCCCGCCCCCAGCCCCGGG - Intronic
1160839698 19:1140595-1140617 CCACCCCCACCCCCACCCCTGGG - Intronic
1160902036 19:1433549-1433571 CTGCCCCCACGCCCAGGCCTTGG + Intronic
1161053183 19:2176205-2176227 AAGCCCTGTCCCCCAGCCCTCGG + Intronic
1161262614 19:3346140-3346162 CAGCCACCCTCCCCAGCCCTGGG + Intergenic
1161337369 19:3721804-3721826 CAGCCCCCTCCCCCAGCCCGGGG + Exonic
1161488840 19:4550720-4550742 CACCCGGAAGCCCCAGCCCTCGG + Intronic
1161743336 19:6039293-6039315 CCTCCCCCATCCCCAGCCCTTGG - Intronic
1161997751 19:7724399-7724421 CAGCCCCCACCTCCAGCACTGGG + Intergenic
1162135475 19:8552549-8552571 GAGCCCCCACACCCAGCCCAAGG + Intronic
1162263037 19:9547906-9547928 CGGCTGGCACCACCAGCCCTGGG + Intergenic
1162386366 19:10362521-10362543 CAGCCCCAGCCCCCAGCCCTGGG + Intronic
1162483805 19:10946068-10946090 CACCCCCCCCCCCCACCCCTTGG - Intergenic
1162537962 19:11275311-11275333 CAGCCCCTCCCCCGAGCCCTAGG - Intergenic
1162858417 19:13487478-13487500 CTCCCCGCTCCCCCAGCCCCTGG - Intronic
1163050405 19:14679044-14679066 CAGGCCGCACCTCCAACACTGGG - Intronic
1163057011 19:14727618-14727640 CAGGCCCCACCTCCAGCACTGGG + Intronic
1163267175 19:16228273-16228295 CCTACGGCACCCCCAGCCCTCGG - Intronic
1163282454 19:16325777-16325799 CCGCCTGCGCCCCCAGCCTTCGG + Exonic
1163425078 19:17236486-17236508 CACCCCCCACCCCCAGCTCCTGG + Intronic
1163593158 19:18205365-18205387 CAGCCCGCCCCCAGTGCCCTGGG + Intergenic
1163697964 19:18773524-18773546 CACCCCACACCCCGAGCCCCAGG + Intronic
1163718676 19:18887338-18887360 CAGTCCTCTCCCCCAGCCCCTGG - Intronic
1163820139 19:19491848-19491870 CAGCCCGCAGCCCCTGGCCATGG - Intronic
1164398736 19:27888325-27888347 CAGCCTGCAATCCCAGGCCTGGG - Intergenic
1164443937 19:28301035-28301057 CTGACCCCACGCCCAGCCCTAGG + Intergenic
1164470808 19:28530193-28530215 CAGCCAGAACCCACAGCGCTGGG + Intergenic
1164647452 19:29870168-29870190 CAACCCCCACCCCCACCCCCCGG + Intergenic
1164721052 19:30431781-30431803 CAGCGCACAGCCCCTGCCCTGGG - Intronic
1164871458 19:31647728-31647750 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1165004788 19:32795966-32795988 CAGCCCCCACCTCCAACACTGGG + Intronic
1165108753 19:33489095-33489117 CACCCCTCACCCACAGCCCCCGG - Intronic
1165256237 19:34578551-34578573 CAGACCACAGGCCCAGCCCTGGG - Intergenic
1165709939 19:38003893-38003915 CATCCCCCACCCCCACCCCCAGG + Intronic
1166076082 19:40414643-40414665 CAGGCCTCACCCCCAACCCCTGG + Intergenic
1166255201 19:41599372-41599394 CCGCCCCCACCCCTGGCCCTGGG + Intronic
1166316588 19:41993042-41993064 CATCCCCCACCTCCATCCCTGGG + Intronic
1166369982 19:42295141-42295163 CAGCCCTCCCCCCCACCCCCAGG + Exonic
1166844661 19:45719353-45719375 CACCTCCCTCCCCCAGCCCTAGG - Intronic
1166888407 19:45974881-45974903 CAGCCTGCAGCACCTGCCCTGGG + Intergenic
1166942914 19:46377653-46377675 CAGCCCTCACTCCCATCCCAGGG + Intronic
1167294004 19:48638966-48638988 CAGCCGGCCCCTGCAGCCCTTGG - Exonic
1167336297 19:48888097-48888119 CAATCCGCTCCCCCTGCCCTGGG - Exonic
1167344364 19:48936048-48936070 CACCCAGCACCCCCAGCACAAGG + Exonic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167498234 19:49831378-49831400 CAGCTGGGAGCCCCAGCCCTCGG + Exonic
1167499059 19:49835543-49835565 CAGCAGGCACCCCCAGGGCTGGG + Exonic
1167792688 19:51691097-51691119 CAGGTCGCTACCCCAGCCCTGGG + Intergenic
1168010797 19:53530275-53530297 CAGGCCGCACCTCCAGCACTGGG + Intronic
1168010808 19:53530318-53530340 CAGGCCCCACCTCCAGCACTGGG + Intronic
1168010821 19:53530361-53530383 CAGGCCCCACCTCCAGCACTGGG + Intronic
1168093746 19:54102778-54102800 CAGGGCGCACGCGCAGCCCTGGG + Intronic
1168152407 19:54456094-54456116 CGACCGGCACCCCCAGCCCCGGG - Exonic
1168401084 19:56086775-56086797 CCGCCCTCTCCCCCAGCCCCTGG + Intergenic
1168419809 19:56194159-56194181 CAACCCCCTCCCCCAGCCCCTGG + Intronic
1168659872 19:58157402-58157424 CAGCCGGCCCCGCCAGCCCCGGG + Intergenic
1168659923 19:58157580-58157602 CTCCCCGCAACCCCCGCCCTGGG + Intergenic
925110158 2:1328187-1328209 CAGGCCCCACCTCCAGCACTGGG + Intronic
925134210 2:1515171-1515193 TTCCCCGCACCCCCAGCCCCAGG + Intronic
925230670 2:2231008-2231030 CAGCCCCCACCCCCAGACTCAGG + Intronic
925356876 2:3248021-3248043 CAGGCCCCACCTCCAGCACTGGG - Intronic
925376228 2:3388116-3388138 CAGCGCGCGCCCCCAGCCTCCGG + Exonic
925869124 2:8253957-8253979 CACCCCCCACCCCCAGGCCTGGG + Intergenic
925907781 2:8549628-8549650 CAGGCCCCACCTCCAGCACTGGG - Intergenic
926081275 2:9988465-9988487 CAACCCTGACCCCCAGCCTTGGG + Intronic
926315211 2:11704728-11704750 CAGCTGGGATCCCCAGCCCTGGG + Intronic
926450521 2:12998502-12998524 CAGGCCCCACCTCCAGCACTGGG + Intergenic
927158411 2:20235854-20235876 CAGCATGCACCCCCAGGCCCTGG - Intergenic
927205346 2:20605583-20605605 CTCCCCGCACTCCCAGCCCCTGG + Intronic
927288939 2:21385895-21385917 CAGGCCCCACCTCCAGCACTGGG - Intergenic
927446800 2:23169620-23169642 CAGCCCCCACCTCCAACCATTGG - Intergenic
927713881 2:25341073-25341095 CGCCCCGCACCCCCAGCCACAGG + Intronic
927846322 2:26474352-26474374 CAGCCCCAGCCCCCAGCCCCAGG + Intronic
927931777 2:27050142-27050164 TAGCCCTCTCCCCGAGCCCTCGG + Intronic
928149086 2:28810517-28810539 GAGGCCGCAGCCCCAGCCCCGGG + Intronic
928346507 2:30502527-30502549 CTGTCCCCAGCCCCAGCCCTAGG + Intronic
928696472 2:33854678-33854700 CAGGCCTCACCTCCAGCACTGGG + Intergenic
929138033 2:38643322-38643344 CGGCCGGCACCGCCAGCCCCAGG - Intergenic
929599323 2:43195042-43195064 CAGTCCCCGCCCCCAGCGCTCGG - Intergenic
929868004 2:45734738-45734760 CAGCCCACACTCCCAGCAGTTGG - Intronic
930032718 2:47068339-47068361 CAGGACGCACCACCAGCTCTAGG + Intronic
930593380 2:53356533-53356555 CAGCCAGCACCGCCGGCCCTGGG + Intergenic
931440143 2:62284239-62284261 CAGCCACCACACCCAGCCTTAGG - Intergenic
931472946 2:62557613-62557635 CAGGCCCCACCTCCAGCACTGGG - Intergenic
931517845 2:63059986-63060008 CAACCCCCACCCCCACCCCCGGG + Intergenic
932756768 2:74414906-74414928 CGGGCCGAACCCCAAGCCCTCGG - Exonic
932817531 2:74873979-74874001 CAGCCCACACCCCCATCCCTTGG - Intronic
933629412 2:84639024-84639046 CAGCCCCCACCTTCAGCACTGGG + Intronic
933850795 2:86364984-86365006 CAGGCCCCACCTCCAGCACTGGG + Intergenic
933992636 2:87644437-87644459 CAGTCCCCTCCCCCAGCCCCTGG + Intergenic
934562975 2:95322813-95322835 CACCACCCAACCCCAGCCCTTGG + Intronic
934713859 2:96532020-96532042 CAGCCCCCACCGCAAGCCCAGGG + Intergenic
934892082 2:98079512-98079534 CAGGCCCCACCTCCAGCCTTGGG + Intergenic
935708917 2:105880486-105880508 CTGCCCCCACCCTCACCCCTGGG - Intronic
935971615 2:108534724-108534746 GAGCCCCGACCCCCAGCGCTCGG + Intronic
936172713 2:110190450-110190472 CAGCCAGCCCCACCGGCCCTGGG - Intronic
936301217 2:111306404-111306426 CAGTCCCCTCCCCCAGCCCCTGG - Intergenic
937047132 2:118857750-118857772 CAGCCCACAGCTCCCGCCCTGGG - Intergenic
937134913 2:119544372-119544394 CAGCCCGGCTCCCCCGCCCTGGG + Intergenic
937225799 2:120368043-120368065 CAGCCCCCAATCCCAGCCATGGG - Intergenic
937719518 2:125077685-125077707 CAGGCCCCACCTCCAGCACTAGG - Intergenic
937954824 2:127416272-127416294 CACCCCCAACCCCCAGCACTGGG + Intergenic
938072983 2:128318117-128318139 CAGCCCGCAGCTCCAGCCGGTGG + Exonic
939085662 2:137715895-137715917 CAGCTGGCACCACCAGCCCCAGG + Intergenic
941095641 2:161237770-161237792 CACCCCGCCCCCTCAGCCCCGGG + Intergenic
941111542 2:161423296-161423318 CTGCCCCCACCCCCACCCCAAGG + Intronic
941164780 2:162073609-162073631 CCACCCCCACCCCCAGCCCGCGG - Intronic
941630400 2:167877959-167877981 CAGCCCCCTCCCCCAGCCTCTGG + Intergenic
941925288 2:170888234-170888256 AAGCCACCACCCCCAGCCCTGGG - Intergenic
942318031 2:174712224-174712246 CAGGCCCCACCTCCAGCACTGGG + Intergenic
942365304 2:175219949-175219971 CATCCCCCAACCCCAGCCTTAGG - Intergenic
942450455 2:176105570-176105592 CAGCCAGCGCCGCCTGCCCTGGG + Intronic
942464059 2:176189336-176189358 CAGACCGCATCCCCGGCCCCAGG + Exonic
942914136 2:181282185-181282207 CAGGCCCCACCTCCAGCACTGGG + Intergenic
944020440 2:195096761-195096783 CAGCCACCACCCCCAGCCAGTGG - Intergenic
944100691 2:196023058-196023080 CAGGCCCCACCTCCAGCACTGGG - Intronic
944119526 2:196226094-196226116 CAGGCCCCACCCCCAGCAATGGG - Intronic
944217636 2:197271884-197271906 GAGCCAGCACGCCCAGCCCAAGG + Intronic
944904219 2:204246253-204246275 CAGCCCGCCTCCCCAGCCTCTGG + Intergenic
945062886 2:205924211-205924233 CATCCCGCTCCCCCAGGCCCAGG - Intergenic
945237760 2:207648131-207648153 CAGGCCCCACCCACAACCCTGGG - Intergenic
945833161 2:214809818-214809840 CAGCCTCCAGCCCCACCCCTAGG - Intergenic
946307855 2:218866159-218866181 CAACCCCCACCCACAGCCCCAGG + Intronic
947525762 2:230875819-230875841 CACCCCCCACCCCCAGGCCCTGG - Intronic
947715146 2:232335564-232335586 CAGCCCCCACCCCTGGCCCTTGG + Intronic
947734221 2:232446515-232446537 CAGCCCCCACCCCTGGCCCTTGG + Intergenic
947767454 2:232646846-232646868 CAGTCCCCACGCCCAGCCCAGGG + Intronic
947889520 2:233604826-233604848 CAGGCCGCACCTCCAACACTGGG + Intergenic
948065930 2:235079985-235080007 CAGCTCCCTCCCCCGGCCCTAGG + Intergenic
948312503 2:236999216-236999238 CAGGCCCCACCTCCAGCACTGGG - Intergenic
948383532 2:237567570-237567592 CAGCCCCCAGCCTGAGCCCTGGG + Intergenic
948518557 2:238521736-238521758 CAGCCTGCACCCTCAGGCCTGGG + Intergenic
948661982 2:239513160-239513182 CAGGCCACACCTCCAGCACTGGG - Intergenic
948679303 2:239621815-239621837 CCACCCACACCCCCAGCCCCAGG - Intergenic
948800332 2:240430534-240430556 CCCCCCCCACCCCCAGCCCATGG + Intergenic
948940037 2:241190940-241190962 CAGAGGGCACCACCAGCCCTGGG - Intronic
949061059 2:241957586-241957608 CAGGCCTCACCTCCAGCACTGGG + Intergenic
1168760515 20:347171-347193 CAGGCCCCAGCCCCAGCCCCTGG + Intronic
1168779021 20:473103-473125 CAGCCTGCACCCTCAGTCCAAGG - Intergenic
1168811996 20:710361-710383 CAGCCAGCACCCCCTCCCCCCGG + Intergenic
1168812072 20:710612-710634 TAACCCCCACCCCCAGCCATGGG - Intergenic
1169076090 20:2760535-2760557 CGGCCCCCACCCCCAGGCCTAGG + Intergenic
1169268181 20:4180375-4180397 CTGCCCTGTCCCCCAGCCCTGGG - Intronic
1169291306 20:4355412-4355434 CAGACCCCACCTCCAGCACTGGG - Intergenic
1169331637 20:4721225-4721247 CAGCCCGCACCACCTGTCCAGGG + Intergenic
1169505226 20:6202961-6202983 CAGGCCTCACCTCCAGCACTGGG + Intergenic
1169593407 20:7170714-7170736 CAGCCTCCACCCCCATCCCGGGG - Intergenic
1169750071 20:8982524-8982546 CTGCCCCCAGCCCCAGCCCCTGG - Intergenic
1169860592 20:10147365-10147387 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1170530684 20:17288037-17288059 CAGCCTGCAGAGCCAGCCCTTGG - Intronic
1170582661 20:17710872-17710894 CTGCCCACACACCCAGCCCTGGG - Intronic
1170766207 20:19291738-19291760 CAGCCTGGCTCCCCAGCCCTGGG + Intronic
1170937816 20:20825023-20825045 CAGAACACAGCCCCAGCCCTGGG - Intergenic
1171302462 20:24075636-24075658 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1171413834 20:24964174-24964196 CAGCTCCCACTCCCAGCCCAGGG + Intronic
1171977661 20:31605747-31605769 GAGCCCGGACCGGCAGCCCTCGG - Exonic
1172037110 20:32018517-32018539 CAGGCCCCGCCCCCAGCCCAAGG - Intronic
1172330283 20:34071130-34071152 CAGGCCCCACCTCCAGCACTGGG + Intronic
1172338869 20:34139832-34139854 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1172405292 20:34684013-34684035 CAGTCACCACCCCCAGCCCTAGG - Intergenic
1172729644 20:37075192-37075214 CAACCCCCACACCCAGCTCTTGG - Intronic
1172893819 20:38285546-38285568 CAGGCCCCACCTCCAACCCTGGG - Intronic
1173248598 20:41352706-41352728 CTGCCAGCAGCCCCAGCTCTGGG - Intronic
1173494333 20:43507865-43507887 CAGCCCGCGCCCCCCGCCGGAGG - Intronic
1173593755 20:44245747-44245769 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1173613682 20:44388936-44388958 GAACCCGCAGCCCCACCCCTCGG - Intronic
1173778752 20:45735996-45736018 CGGCCGGCACCGCCGGCCCTGGG + Intergenic
1173886657 20:46465168-46465190 CAGTCACCACCCCCATCCCTGGG - Intergenic
1174044478 20:47723889-47723911 CATCCCTCACCCCCAGTCCGTGG + Intronic
1174190991 20:48740318-48740340 CAGCCAGCACTCCCAGCACCTGG - Intronic
1174384866 20:50181462-50181484 CAGCCAGAACCCCCGGCCCTGGG + Intergenic
1174441901 20:50562291-50562313 CAGCCACCACTCCCAGCCATGGG - Intronic
1174556203 20:51397373-51397395 CAGACCCCACCCACAGCTCTGGG - Intronic
1174946314 20:54989706-54989728 GAGCCACCACGCCCAGCCCTGGG - Intergenic
1175584316 20:60125967-60125989 CAGGCAGCACCCCCATCCCATGG - Intergenic
1175603134 20:60291164-60291186 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1175763053 20:61574049-61574071 CAGCGAGGACCCACAGCCCTGGG + Intronic
1175819460 20:61900736-61900758 CAGCGCCCACCCCCAACCCCTGG - Intronic
1175885598 20:62288603-62288625 CACCCTGCACCCACAGCCTTCGG - Intronic
1175939882 20:62532989-62533011 CAGCCCCCACCTTCAGGCCTGGG - Intergenic
1176101037 20:63364746-63364768 CAGCCCCCGCCCCCCACCCTGGG + Intronic
1176368568 21:6048900-6048922 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1176407910 21:6431424-6431446 CTGCCCGCAACCCCACACCTGGG - Intergenic
1176671028 21:9735637-9735659 CAGCTGGCACCACCAGCCCCAGG + Intergenic
1177753030 21:25309115-25309137 CAGACTCCACCACCAGCCCTGGG + Intergenic
1178029428 21:28507043-28507065 CAGGCCACACCTCCAGCACTGGG + Intergenic
1178054519 21:28783855-28783877 CGGCCGGCACCACCAGCCCCGGG + Intergenic
1178148707 21:29769425-29769447 CACCCCTCACCTCCAGTCCTTGG - Intronic
1178213048 21:30559590-30559612 CAGGCCCCACCTCCAGCACTGGG - Intronic
1178374470 21:32055438-32055460 CATCCAACACCCCAAGCCCTTGG - Intergenic
1178782193 21:35614353-35614375 CAGGCCCCACCTCCAGCACTGGG + Intronic
1179027164 21:37688680-37688702 CACCCCTCTCCCCCACCCCTTGG - Intronic
1179373751 21:40830406-40830428 CAGGCCCCACCTCCAGCACTGGG + Intronic
1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG + Intergenic
1179484138 21:41698961-41698983 CGGGCCCCACCCCCAGCACTGGG + Intergenic
1179505530 21:41837523-41837545 CAGCCCCCTCCCCCAGCCCCTGG - Intronic
1179680002 21:43012802-43012824 CAGCCCACACACCTAGCACTGGG + Intronic
1179683401 21:43039755-43039777 CTGCCCGCAACCCCACACCTGGG - Intergenic
1179754951 21:43489642-43489664 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1180054162 21:45348661-45348683 GAGCCCCCGCCCTCAGCCCTTGG - Intergenic
1180078145 21:45473553-45473575 CTGCCCGCCCTCCCAGGCCTTGG + Intronic
1180631962 22:17235935-17235957 AATCCTGCACCCCCTGCCCTGGG - Intergenic
1181044429 22:20207833-20207855 CAGGCCCCACCCCCAGCTCCTGG - Intergenic
1181277832 22:21697588-21697610 CTGGCCACACCGCCAGCCCTTGG - Exonic
1181441115 22:22935607-22935629 CATCCCCCAACCCCATCCCTTGG - Intergenic
1181545078 22:23598084-23598106 AATCCCCCACCCCCATCCCTTGG + Intergenic
1181745457 22:24952708-24952730 CAGCCCGCGGCACCTGCCCTGGG - Intronic
1181815233 22:25431798-25431820 AATCCCCCACCCCCATCCCTTGG - Intergenic
1182280621 22:29216096-29216118 CTCCCCGCCCCCCCACCCCTGGG + Intronic
1182441999 22:30370097-30370119 CGGCCCGCACCCCAAGCTCCAGG - Intronic
1182734256 22:32519984-32520006 CATCCCCTACCCCCAGCCATGGG + Intronic
1183061099 22:35336800-35336822 AAGCCCGCACCTCCTGCACTGGG - Intronic
1183202977 22:36398745-36398767 CAGCCTCCTCCCCCAGCGCTAGG + Intergenic
1183486316 22:38089297-38089319 CAGCCCCCACCCCCAGTCCCAGG + Intronic
1183581223 22:38727753-38727775 CATCCCCCACCCCCAGGCCCTGG - Intronic
1184016471 22:41789638-41789660 CAGTCCCCTCCCCCAGCCCCTGG + Intronic
1184102359 22:42347510-42347532 CCGTCCGCAGCCCCAGCCCCAGG + Intergenic
1184239903 22:43206564-43206586 CTGCCCGGACCCCCTGACCTGGG - Intronic
1184242606 22:43219128-43219150 CAGGCCCCACCCCCAGCATTAGG - Intronic
1184366426 22:44054553-44054575 CAGCCCCCAACCCCTGCCCCTGG - Intronic
1184571733 22:45329088-45329110 CAGGCCCCACCTCCAGCACTGGG + Intronic
1184586697 22:45452750-45452772 CTGCCATCACCCCCAGCCCACGG - Intergenic
1184644444 22:45888659-45888681 GAGCCCACGCCCCCTGCCCTCGG + Intergenic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
1185040948 22:48504127-48504149 CAGCCCGCACCCCTAAAGCTCGG - Intronic
1185065267 22:48628896-48628918 CAGCCCCCACCCACAGCCCCAGG - Intronic
1185099903 22:48833873-48833895 GAGCCTGCACTCCCTGCCCTGGG - Intronic
1185217669 22:49611358-49611380 CAGCCCCCAGACCCAGCTCTAGG + Intronic
1185322970 22:50210346-50210368 CAGCCCGCACCCCCCAGCCCTGG - Intronic
949883924 3:8680028-8680050 CTTCCAGCAGCCCCAGCCCTGGG + Intronic
949919351 3:8988979-8989001 AAGCAGGCACCCCCAGCCCCCGG - Intronic
949951934 3:9236431-9236453 CAGCCCCCACCTCCAACACTGGG - Intronic
950108043 3:10400746-10400768 CACTCAGCAACCCCAGCCCTGGG - Intronic
950204866 3:11071484-11071506 CAGCCGGCACCACCGGCCCTAGG - Intergenic
950217304 3:11168734-11168756 CAGCCCGCACCCCCAGCCCTGGG - Intronic
950264615 3:11564740-11564762 CAGCCCAGTCCCCCAGCCCCTGG + Intronic
950544170 3:13629087-13629109 CTGCCCGCTTCCCCACCCCTGGG + Intronic
950679598 3:14575795-14575817 CAGCCCGCCCCTCAAGCTCTGGG - Intergenic
950732484 3:14972967-14972989 CAGGCCGCACCTCCAGCACTGGG + Intronic
950946130 3:16948348-16948370 CAACCCCCGACCCCAGCCCTAGG - Intronic
951332957 3:21387471-21387493 CGGCCAGCTCCACCAGCCCTGGG - Intergenic
951415428 3:22417051-22417073 TGGCCGGCACCACCAGCCCTGGG + Intergenic
952237815 3:31498456-31498478 CACCCCCCACCCCCACCCCTTGG - Intergenic
952420175 3:33123301-33123323 CAGGCCCCACCTCCAACCCTGGG - Intronic
952436617 3:33277764-33277786 CAGCCCGGACCCCCACCCAGTGG + Intronic
952945216 3:38474393-38474415 CAGCCTGCAGCCCAAGCCCTAGG - Intronic
953361624 3:42302090-42302112 CAGGCCCCACCTCCAACCCTGGG - Intergenic
953547878 3:43877606-43877628 CAGCCAGCTCCCTGAGCCCTGGG - Intergenic
953694626 3:45147598-45147620 CTGCCCACACCCCCACCTCTGGG + Intergenic
954329792 3:49883690-49883712 CAGGCCCCACCACCAGCACTGGG - Intergenic
954400475 3:50317032-50317054 CAGCCAGCAACCCCACACCTGGG - Intergenic
954528380 3:51294742-51294764 CTGCCCCCACCCCCAGCCTCTGG - Intronic
954617394 3:51976268-51976290 GAGCCCGCATCCCCAGGCTTCGG - Intronic
954663475 3:52238120-52238142 CACCCCCAGCCCCCAGCCCTAGG - Intronic
954839331 3:53496390-53496412 CAGCCTGCACCCCTACACCTAGG - Intronic
956239129 3:67109308-67109330 TAGCACCTACCCCCAGCCCTTGG - Intergenic
956639155 3:71398594-71398616 CACTCTGCACCCCCAGCCCGTGG - Intronic
957843578 3:85701288-85701310 CAGGCCCCACCTCCAGCACTGGG + Intronic
957997198 3:87705725-87705747 CAGGCTGCACCCCCAACACTGGG - Intergenic
958026659 3:88058435-88058457 CCGCCCGAACCCCCGGGCCTGGG - Intronic
959323325 3:104906236-104906258 CAGCCGGCACCTCCAGCCCCAGG + Intergenic
960416402 3:117390227-117390249 CAGGCCCCACCTCCAGCACTAGG + Intergenic
961481858 3:127185898-127185920 CTTCCCCCTCCCCCAGCCCTTGG + Intergenic
961525067 3:127491485-127491507 CATACCCCACCCCCAGCCCCTGG - Intergenic
961629274 3:128284438-128284460 CACCCCCAACCCCCAGCACTGGG - Intronic
961664185 3:128486152-128486174 CCGCTCCCACCCCCAGCCCCTGG + Exonic
961957056 3:130815093-130815115 CAGCCAGCACCACCGGCCCAGGG - Intergenic
962453248 3:135539481-135539503 GAGCCACCACGCCCAGCCCTTGG + Intergenic
962745497 3:138394875-138394897 CAGCACCCACTCCCCGCCCTCGG + Intronic
962928094 3:140013307-140013329 CAGACTTCACCCCCAGCCCTAGG - Intronic
963511087 3:146250680-146250702 CAGCCAGGACCCCCATCCCTGGG + Intronic
964993518 3:162844872-162844894 CAGCCAGCGCCACCAGCCCCGGG - Intergenic
965033820 3:163408460-163408482 CAGGCCCCACCTCCAGCACTGGG - Intergenic
965544574 3:169902655-169902677 CAGCCTTGACCCCCAGGCCTAGG + Intergenic
965807149 3:172553330-172553352 CAGGCCCCACCTCCAGCACTAGG + Intergenic
966439904 3:179933014-179933036 CAGCCCACACCCACAGCCTCTGG + Intronic
966766970 3:183472252-183472274 CAGGCCCCACCTCCAGCCCTGGG - Intergenic
967193291 3:187003986-187004008 CAGGCCCCACCTCCAGCACTGGG - Intronic
967260434 3:187636168-187636190 CAGACCCCACCTCCAGCACTGGG + Intergenic
967632063 3:191755878-191755900 CAGGCCCCACCTCCAGCACTGGG + Intergenic
967692579 3:192493843-192493865 CAGGCCCCACCTCCAGCACTGGG + Intronic
967812030 3:193768649-193768671 CAGGCCCCACCTCCAGCACTGGG - Intergenic
967980384 3:195061878-195061900 CAGCGGGCACTCTCAGCCCTCGG + Intergenic
968144665 3:196288086-196288108 CAGCCCGCACCCCCGCACCCGGG + Intronic
968451991 4:680254-680276 CAGCACTCACCCCCAGCTCCAGG + Intronic
968534363 4:1113855-1113877 TGGCCCGCATCCCCCGCCCTCGG - Intergenic
968565608 4:1311028-1311050 CCGCCTGCTCCCCCGGCCCTGGG - Intronic
968581974 4:1399421-1399443 CTGCCCACACCCCCAGCCCCAGG - Intergenic
968687618 4:1972009-1972031 CACCCAGCACCCGCAGCCTTGGG - Intronic
968744120 4:2350667-2350689 CAGCCCCCACCCCCAACCTCCGG + Intronic
968815248 4:2818450-2818472 GACCCCGCACCCCGAGCCCCTGG + Intronic
969174170 4:5386104-5386126 CAGGCCCCACCCACAGCTCTTGG + Intronic
969239148 4:5888055-5888077 CAGCCCCCTCCCCCAGCCTCTGG - Intronic
969246340 4:5935501-5935523 GAGCCACCACACCCAGCCCTGGG - Intronic
969264287 4:6054990-6055012 CAGCGAGCAACCCCAGGCCTCGG - Intronic
969364382 4:6685719-6685741 CAGCCTGCACCCCCACCCCAGGG + Intergenic
969432182 4:7161750-7161772 CAGCCCCGTCCCCCAGCCCATGG - Intergenic
969656074 4:8499276-8499298 CAGCCTGGGCCCCCTGCCCTGGG + Intergenic
969682273 4:8649851-8649873 CACCCCACGGCCCCAGCCCTCGG - Intergenic
969978721 4:11132067-11132089 CAGGCCCCACCTCCAACCCTGGG + Intergenic
970692010 4:18630832-18630854 CAGCCAGCGCCACCGGCCCTGGG - Intergenic
972666744 4:41172212-41172234 CATCCAGCACCCCCCGCCCCAGG + Intronic
973039952 4:45457376-45457398 CGGCCGGCACCGCCAGCCCTGGG - Intergenic
973176489 4:47212390-47212412 GAGCCACCACACCCAGCCCTGGG - Intronic
973587775 4:52410007-52410029 CAGCCAGCCCTGCCAGCCCTGGG - Intergenic
974868996 4:67615127-67615149 CAGCCCTCACCTCCAACACTGGG - Exonic
975684551 4:76906657-76906679 CGGCCCCCACCTCCAGCACTGGG + Intergenic
975707864 4:77128589-77128611 AAGCCTGGACCCTCAGCCCTAGG - Intergenic
975710686 4:77157636-77157658 CTGCCCTCAGCCCCAGCCCCGGG + Intronic
975898421 4:79122032-79122054 CAGCCAACCCTCCCAGCCCTGGG + Intergenic
976843331 4:89457642-89457664 CAGCCCCATCCCCCAGCCTTTGG - Intergenic
977461933 4:97336997-97337019 GAGCCCCCACCCCCAGCCAAGGG + Intronic
977988746 4:103416278-103416300 CAGTCCCAACCCCCAGCCATGGG - Intergenic
978178040 4:105758337-105758359 CAGGCCCCACCTCCAGCACTGGG - Intronic
978266940 4:106838646-106838668 CAGTCCCCACCTCCAGCACTGGG + Intergenic
978712479 4:111800933-111800955 CAGGCCCCACCCCCAACACTGGG + Intergenic
979124366 4:116948922-116948944 CAGGCCCCACCTCCAACCCTGGG + Intergenic
979672150 4:123371317-123371339 TAGGCCGCACCTCCAACCCTTGG - Intergenic
979920715 4:126492607-126492629 CAGGCCCCACCTCCAGCACTGGG - Intergenic
981053213 4:140332145-140332167 CAGGCCCCACCTCCAGCACTGGG + Intronic
981305974 4:143247484-143247506 CACCCCCCACCCCCAGTCCCTGG + Intergenic
981782218 4:148442789-148442811 CTGCCCCCACCCCCATCGCTCGG + Intronic
981782546 4:148444414-148444436 CAACCCGCGCCCTCTGCCCTGGG + Intronic
982223443 4:153144049-153144071 CAGCCCACAGACGCAGCCCTTGG + Intergenic
982714811 4:158795894-158795916 CATCCCCCACCCCCAGTCCATGG + Intronic
982997297 4:162365899-162365921 CAGGCCCCACGCCCAGCACTGGG + Intergenic
983618451 4:169733812-169733834 CAGCCTGCACCTCCTGCACTGGG - Intronic
983719785 4:170835868-170835890 CTGCTCCCAACCCCAGCCCTAGG - Intergenic
984314093 4:178103678-178103700 GAGCCCCCACACCCAGCCCTAGG + Intergenic
984658156 4:182342449-182342471 CCCCTCCCACCCCCAGCCCTAGG - Intronic
984773413 4:183458371-183458393 CAGGCCCCACCTCCAGCACTGGG - Intergenic
984820233 4:183875535-183875557 AAGCCCGCTCCACCAGGCCTCGG - Intronic
984934977 4:184882047-184882069 CAGGCCGCACCTCCAACACTGGG - Intergenic
985060480 4:186072735-186072757 CAGCCCCCACCTCCAACACTGGG + Intronic
986125988 5:4882725-4882747 CAGCCTGGCCCTCCAGCCCTGGG - Intergenic
986189061 5:5476756-5476778 CAGGCCCCACCTCCAGCACTGGG + Intronic
986707400 5:10463387-10463409 CTGCCCACCCCACCAGCCCTGGG - Intronic
986919016 5:12662006-12662028 CGGCCAGCGCCGCCAGCCCTGGG + Intergenic
987246283 5:16052364-16052386 GAGCCACCACCCCTAGCCCTTGG - Intergenic
987710400 5:21496399-21496421 CAGGCAGCACTCCCAGCACTGGG - Intergenic
987907295 5:24093188-24093210 CAGGCCTCACCTCCAGCACTGGG - Intronic
988417100 5:30959339-30959361 CAGGCCCCACCCCCAGTACTGGG - Intergenic
988493749 5:31727142-31727164 CAGGCCCCACCTCCAGCGCTGGG + Intronic
988647144 5:33107221-33107243 CAGCCCCCACCTCCAACGCTAGG - Intergenic
989070833 5:37509508-37509530 GAGCCATCACACCCAGCCCTTGG + Intronic
989593001 5:43129354-43129376 GAGCCACCACACCCAGCCCTTGG + Intronic
990173616 5:53082838-53082860 CTGCCCGCCCCACTAGCCCTTGG + Intronic
990504889 5:56434260-56434282 CAGGCCCCACCACCAGCACTGGG + Intergenic
991623569 5:68572343-68572365 GAGCCACCACACCCAGCCCTTGG + Intergenic
991737465 5:69640967-69640989 CAGGCAGCACTCCCAGCACTGGG + Intergenic
991760728 5:69915458-69915480 CAGGCAGCACTCCCAGCACTGGG - Intergenic
991786603 5:70202643-70202665 CAGGCAGCACTCCCAGCACTGGG + Intergenic
991789041 5:70220693-70220715 CAGGCAGCACTCCCAGCACTGGG + Intergenic
991813791 5:70495799-70495821 CAGGCAGCACTCCCAGCACTGGG + Intergenic
991816921 5:70517083-70517105 CAGGCAGCACTCCCAGCACTGGG + Intergenic
991839958 5:70790509-70790531 CAGGCAGCACTCCCAGCACTGGG - Intergenic
991879047 5:71203028-71203050 CAGGCAGCACTCCCAGCACTGGG + Intergenic
991881487 5:71221057-71221079 CAGGCAGCACTCCCAGCACTGGG + Intergenic
992014710 5:72564066-72564088 CAGGCCCCACCTCCAGCACTGGG + Intergenic
992085804 5:73277467-73277489 CAGACAGCACACCCAGACCTGGG + Intergenic
992088673 5:73299356-73299378 CATCCCGCCCCTCTAGCCCTCGG + Intergenic
992134837 5:73734086-73734108 CAGGCCCCACCCCCAACACTGGG + Intronic
992334226 5:75748931-75748953 CAGGCCCCACCTCCAGCACTGGG - Intergenic
992375388 5:76183395-76183417 CAGGCCCCACCTCCAGCACTGGG + Intronic
992432408 5:76722193-76722215 CTGTCCCCATCCCCAGCCCTGGG + Intronic
992722061 5:79570521-79570543 GAGCCACCACGCCCAGCCCTTGG + Intergenic
993938899 5:94035011-94035033 CATCCCCCACCCCCAGTCCATGG + Intronic
994210787 5:97085485-97085507 CGGCCAGCACCACCAGCCCCAGG - Intergenic
994422350 5:99536506-99536528 CAGGCAGCACTCCCAGCACTGGG - Intergenic
994570287 5:101506127-101506149 CGGCCGGCACCACCAGCCCTGGG + Intergenic
995052731 5:107724760-107724782 CTGCCCGCAGCCCCGGCCCCCGG + Intergenic
996088885 5:119331054-119331076 CAGCCAGGACTTCCAGCCCTAGG - Intronic
996747109 5:126854790-126854812 CGGCCTGCGCCCCCAGCCCGGGG - Intergenic
996814576 5:127560542-127560564 CCTCCCGCTCCCCCAGCCCCTGG - Intergenic
998458935 5:142295240-142295262 CACGCCTCACCCCCACCCCTGGG + Intergenic
998529114 5:142868774-142868796 TAGCCCACACCCCCATTCCTAGG - Intronic
998693133 5:144610039-144610061 CAGGCCTCACCTCCAGCGCTGGG + Intergenic
999178348 5:149648236-149648258 CAGCTCCCACCTCCAGCACTAGG - Intergenic
999654196 5:153796778-153796800 CTGCCCCCACCCCCACCCCCCGG + Intronic
999900812 5:156085278-156085300 CAGGCCACACCTCCAGCACTGGG - Intronic
1000111157 5:158109288-158109310 CAGCCAGCCCCTCCAGCCCCAGG - Intergenic
1000628662 5:163567234-163567256 CAGCCCACCTCCCCAACCCTTGG + Intergenic
1000668874 5:164034760-164034782 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1000883375 5:166722096-166722118 CAGGCCCCACCTCCAACCCTGGG + Intergenic
1000902499 5:166927208-166927230 CGGCCGGCACCGCCAGCCCCAGG - Intergenic
1001001819 5:168014781-168014803 CTGCCCGCAACCCCTGCCCAGGG + Intronic
1001411992 5:171518787-171518809 CAGCCGCCATCCCCGGCCCTGGG - Intergenic
1001542671 5:172550400-172550422 CAGCCCTCAGCCCCAGCCTCCGG - Intergenic
1001591047 5:172865618-172865640 CAGCCAGCACCCCCACCACGGGG + Intronic
1002091840 5:176810660-176810682 CAGCCCGGAGCCCCAGCTCGGGG - Exonic
1003128445 6:3374761-3374783 CACCCAGCACAGCCAGCCCTGGG + Intronic
1003345185 6:5260582-5260604 CAGCCCGCACCCCCGGTCCCCGG + Intronic
1003383839 6:5649485-5649507 CAGCCTGCACCCTCAGCTCCTGG - Intronic
1003405642 6:5825006-5825028 CAGCCCCCACCACCATGCCTGGG + Intergenic
1003549335 6:7088231-7088253 CATTCCCCACCCCCAGCCCCTGG + Intergenic
1003667029 6:8121010-8121032 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1004384632 6:15162023-15162045 CCACCCCCACCCCCACCCCTTGG - Intergenic
1004499684 6:16198351-16198373 CGGCCCGCCCCACCAGCCCCGGG - Intergenic
1005046939 6:21651982-21652004 CAGGCCCCACCTCCAACCCTGGG + Intergenic
1005126435 6:22451446-22451468 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1005547294 6:26884118-26884140 CAGGCAGCACTCCCAGCACTGGG + Intergenic
1005841954 6:29749332-29749354 ATCCCCGCACCCCCACCCCTAGG + Intergenic
1006419386 6:33923917-33923939 CCCTCCACACCCCCAGCCCTGGG + Intergenic
1006717853 6:36131415-36131437 CAGCCCCCACCCCCTCCCCGGGG - Intronic
1007264821 6:40588069-40588091 CAGCCCCCACTCCCAGCCTAGGG - Intergenic
1007347905 6:41247267-41247289 CAGTCTGGACCCCCAGCCCAGGG - Intergenic
1007390368 6:41546885-41546907 CAGCCCCCACCCACGTCCCTGGG - Intronic
1007392539 6:41558354-41558376 CACCCCCCTCTCCCAGCCCTTGG - Intronic
1007624366 6:43235104-43235126 CTGCTCCCACCCCCAGCCTTAGG - Intergenic
1007728172 6:43929419-43929441 CAGACTTCACCCCAAGCCCTAGG - Intergenic
1007825164 6:44594770-44594792 CAGCCAGCAGCTGCAGCCCTAGG + Intergenic
1007975434 6:46096244-46096266 CAGCCCTCACCCCCAACACTGGG + Intergenic
1008654471 6:53597485-53597507 CAGGCCCCACCTCCAGCACTGGG + Intronic
1009018053 6:57925191-57925213 CAGGCAGCACTCCCAGCACTGGG + Intergenic
1009664333 6:66655626-66655648 CAGCCAGCCCCGCCAGCCCGGGG - Intergenic
1010270361 6:73910088-73910110 CAGCTGGCACCACCGGCCCTGGG + Intergenic
1011338360 6:86285036-86285058 CAGCCGGCCCCACCAGCCCCAGG - Intergenic
1012145009 6:95670141-95670163 CATCCAACGCCCCCAGCCCTGGG + Intergenic
1012409639 6:98942401-98942423 CAGGCCCCACCTCCAGCACTGGG - Intronic
1012809581 6:103940350-103940372 CAGCCCCCACCTCCAACACTGGG - Intergenic
1013129644 6:107220066-107220088 CAGTTCCCACCCCCAGCCCCAGG - Intronic
1013612155 6:111805684-111805706 CAGCCCCCTCCCCCTTCCCTTGG + Intronic
1014146089 6:117999485-117999507 GACCCCCCACCCCCACCCCTGGG + Intronic
1014200182 6:118600604-118600626 GAGCCACCACACCCAGCCCTGGG + Intronic
1014258351 6:119186707-119186729 CAGCTCCCACCTCCAGCACTTGG - Intronic
1014558070 6:122856970-122856992 CAGGCCCCACCCCCAGCACTGGG + Intergenic
1014862343 6:126485071-126485093 CAGTGAGCTCCCCCAGCCCTGGG - Intergenic
1015019867 6:128460100-128460122 CAGGCCCCACCTCCAGCACTGGG + Intronic
1016023568 6:139260942-139260964 CAGGCCTCACTCCCAGACCTCGG - Intronic
1016389730 6:143562514-143562536 CAGGCCCCACCTCCAGCACTGGG + Intronic
1016740876 6:147527496-147527518 CAGGCCCCACCTCCAGCACTGGG + Intronic
1017108676 6:150912143-150912165 CAGGCCCCACCCCCAACACTGGG + Intronic
1017112276 6:150943344-150943366 GAGCCACCACGCCCAGCCCTTGG - Intronic
1017629525 6:156382938-156382960 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1017637187 6:156454980-156455002 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1017810132 6:157978474-157978496 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1018215052 6:161518509-161518531 CAGCTCTCACCCAGAGCCCTGGG - Intronic
1018371007 6:163168392-163168414 CAACCCGCAACCCCGGCCCCAGG - Intronic
1018728576 6:166632093-166632115 CCTTCCCCACCCCCAGCCCTGGG + Intronic
1018757473 6:166862687-166862709 CCCCCCGCCTCCCCAGCCCTTGG - Intronic
1018853319 6:167657287-167657309 CAGGCCTCACCTCCAGCACTGGG - Intergenic
1018868837 6:167766075-167766097 CAGGTCCCACCCCCAACCCTGGG + Intergenic
1019005152 6:168790479-168790501 CGGCCCCCACCTCCAGCACTGGG - Intergenic
1019036271 6:169062484-169062506 CAGCTCCCACCGCCAGCCCTTGG - Intergenic
1019065503 6:169292719-169292741 CAGAGCTCACCCCCAGCCCCCGG + Intergenic
1019262820 7:91683-91705 CACGCCCCACCTCCAGCCCTGGG + Intergenic
1019471113 7:1221548-1221570 CAGCTCCCTCCCCCAGCCCCCGG - Intergenic
1019605717 7:1909240-1909262 CGGGCGGCTCCCCCAGCCCTGGG - Intronic
1019624363 7:2008570-2008592 CAGCCCCCACCCCGGGCCTTGGG - Intronic
1019934104 7:4242979-4243001 CAGCATCCACCTCCAGCCCTTGG - Intronic
1020044412 7:5030527-5030549 CCCCCCCCACCCCCAGTCCTAGG + Intronic
1020097528 7:5377115-5377137 CAGCCAGCACCCCTGTCCCTTGG - Intronic
1020115557 7:5474165-5474187 CAGCCCCCTCCCTCAGCCCCAGG - Intronic
1020125536 7:5530844-5530866 CGGCGCGCGCCCCCAGCCCCCGG - Intronic
1020799752 7:12719119-12719141 CAGCCCTGGCCACCAGCCCTAGG - Intergenic
1020815114 7:12895868-12895890 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1020870449 7:13622697-13622719 CAACCCTCTCCCCCAGCCCCTGG - Intergenic
1021274731 7:18636285-18636307 CTGCCAGCCCCCCCTGCCCTGGG + Intronic
1021740380 7:23680335-23680357 CTGCTCGCGCCCCCAGCCCAGGG - Intronic
1022064535 7:26837618-26837640 CAGGCCCCACCTCCAGCACTGGG + Intronic
1022759548 7:33332990-33333012 CAACCCCCTCCCCCAGCCCCTGG + Intronic
1023515194 7:40994699-40994721 CAGGCCCCACCTCCAACCCTGGG - Intergenic
1023732831 7:43208754-43208776 CAGCACTGACCACCAGCCCTGGG - Intronic
1023843371 7:44108589-44108611 CAGCCCGCAACCCCAGGCACAGG + Intronic
1023844036 7:44111255-44111277 CAGGTCCCACCCCCAGCCCCAGG - Intronic
1024145818 7:46515381-46515403 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1026018976 7:66693670-66693692 CAGGCTGCACTCCCAGCCCTGGG - Intronic
1026161613 7:67874476-67874498 GAGCCACCACCCCCAGCCCATGG - Intergenic
1026244420 7:68606158-68606180 GAGACATCACCCCCAGCCCTGGG + Intergenic
1026411480 7:70127385-70127407 CAGCCCCCTCCCAAAGCCCTGGG + Intronic
1026794924 7:73359900-73359922 CAGCCTGCTCCCCCAGGACTTGG - Intergenic
1026881418 7:73909006-73909028 CAGGCTGCACTCCCAGCCCTGGG + Intergenic
1027229821 7:76265532-76265554 CAGCCCTGCTCCCCAGCCCTTGG - Intronic
1027232380 7:76280425-76280447 CAGGCCGGACCCCCAGCGCTTGG - Intronic
1027244748 7:76359265-76359287 CCTCCCGCCCCGCCAGCCCTCGG + Intergenic
1027345792 7:77258159-77258181 CACCCCCCACCCCCACCTCTGGG - Intronic
1028207351 7:88032715-88032737 CAGACCGCACCTCCAACACTGGG - Intronic
1028634551 7:92972404-92972426 CAGGCTGCACCTCCAGCACTGGG + Intergenic
1028912975 7:96228807-96228829 TGGCCAGCACCGCCAGCCCTGGG + Intronic
1029246511 7:99205949-99205971 CACCCCCCGTCCCCAGCCCTTGG + Intronic
1029248618 7:99220381-99220403 CAGGCCGCAGCCCCAGGGCTGGG - Intergenic
1029356752 7:100057775-100057797 CAGCATGCAGCCACAGCCCTTGG + Exonic
1029458238 7:100681695-100681717 CAGCCCGGACCCCCAGCCCCTGG - Exonic
1029502294 7:100939432-100939454 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1029540392 7:101179385-101179407 TAGCACGCACCCCCTCCCCTGGG + Intronic
1029550073 7:101232799-101232821 AACCCCCCACCCCCCGCCCTCGG - Intronic
1029647865 7:101869505-101869527 CACCCCACAGCCTCAGCCCTGGG - Intronic
1030260994 7:107563969-107563991 CCGCCCGCCCACCCAGCCCATGG + Exonic
1030642869 7:112025920-112025942 CAGCCAACTCCCCCAACCCTGGG + Intronic
1031409007 7:121420260-121420282 CAGCCTGCAATCCCAGCACTTGG + Intergenic
1031796117 7:126176097-126176119 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1032161876 7:129517111-129517133 CAGGCCGCACCTCCAACACTGGG + Intergenic
1032768016 7:135018995-135019017 CAGTCCGCAGCTCCAGCCCCAGG + Intronic
1033228299 7:139577776-139577798 CAGCCCCCAGCCCCAGCGCCAGG - Intronic
1033642485 7:143275222-143275244 CACCCCGCACCCCCAGCCTCTGG - Intergenic
1033830453 7:145245281-145245303 CAGGCCACACCTCCAGCACTGGG + Intergenic
1034159514 7:148982757-148982779 CAGCCTGGGCCCCCAGCCCTGGG - Intergenic
1034173519 7:149082088-149082110 CAGGCCCCTCCCCCAACCCTGGG - Intronic
1034264682 7:149775119-149775141 GAGCCAGCTCCCCCAGCCCTGGG - Intergenic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1034427440 7:151021461-151021483 CAGCACCCACCCCCTGCCCCGGG - Intronic
1034469543 7:151248118-151248140 CATCCCCCACCCCCACCCCCAGG + Intronic
1034523142 7:151636324-151636346 CAACCCTCACACCCATCCCTAGG + Intronic
1034545473 7:151786049-151786071 CAGCGCCCACCCCCAGCGCTGGG - Intronic
1034621029 7:152457247-152457269 CAGGCCCCACCTCCAACCCTAGG - Intergenic
1035023020 7:155809845-155809867 CAGCCGGAGCCCCCAGCCCGGGG - Intronic
1035047018 7:155974294-155974316 CAGCCTGCAGACCCAGCCCTGGG - Intergenic
1035057688 7:156046822-156046844 CCGCCCTCACCCACAGCCCCAGG - Intergenic
1035085411 7:156253650-156253672 CAGGCCCCACCCCCAACACTGGG - Intergenic
1035235403 7:157494682-157494704 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1035258310 7:157646202-157646224 CAGGCCCCACCTCCAGCCCTGGG - Intronic
1035433241 7:158838202-158838224 CAGGCCCCACCTCCAGCCCTGGG + Intergenic
1035528931 8:336240-336262 CAGCCGGCAGCCCCAGGCCAGGG + Intergenic
1035844860 8:2852412-2852434 CAGGCCTCACCTCCAGCACTGGG - Intergenic
1036692511 8:10952698-10952720 CAGGCCCCACCTCCAGCACTGGG - Intronic
1037530355 8:19766831-19766853 CATCCCCCACCCCCTGCCCGTGG + Intergenic
1037754640 8:21702976-21702998 CTGCCCTCACCCCCATCCCAGGG - Exonic
1037808210 8:22069990-22070012 CAGCCCGCAGCCCCAGGGCACGG - Intronic
1037824754 8:22154689-22154711 CAGCCCGCTGCCTCAGCCCTGGG + Intronic
1037916753 8:22777652-22777674 CAGCCACCACCCCCGGCTCTGGG - Intronic
1038008709 8:23457309-23457331 CGGCGCGCTCCCCCAGCCCCTGG - Intronic
1038542522 8:28401942-28401964 CAGCCGGCAGCCCCGCCCCTCGG + Intronic
1038805883 8:30790788-30790810 GAACCCACAGCCCCAGCCCTGGG + Intronic
1039460028 8:37736400-37736422 CCGCCCTCATCCCCAGCCCCAGG + Exonic
1039493420 8:37964526-37964548 CCACCCGCCCCCCAAGCCCTCGG - Intronic
1039902295 8:41761877-41761899 CAGCCCCCACCCACAACCCCAGG + Intronic
1040628172 8:49175854-49175876 CCACCCTCACCCCCAGCCCAGGG - Intergenic
1040794164 8:51271339-51271361 CAGCCTGCGCCGCCGGCCCTGGG + Intergenic
1041090784 8:54299346-54299368 CAGCCCAGAAGCCCAGCCCTCGG - Intergenic
1041277579 8:56178718-56178740 AGGCCAGGACCCCCAGCCCTAGG - Intronic
1041432534 8:57799259-57799281 CAGCACCCACCCCAAGCCCAGGG + Intergenic
1041464619 8:58146123-58146145 CAGGCTGCACCCGCCGCCCTTGG + Exonic
1041548881 8:59078330-59078352 CAGGCCCCACCTCCAGCACTGGG - Intronic
1042105094 8:65317580-65317602 CAGGCCTCACCTCCAGCACTGGG + Intergenic
1042719820 8:71815105-71815127 GAGCCACCACGCCCAGCCCTTGG + Intergenic
1042800145 8:72709706-72709728 CAGGCCCCACCTGCAGCCCTGGG + Intronic
1043813716 8:84775238-84775260 GAGCCACCACGCCCAGCCCTTGG + Intronic
1044038687 8:87337696-87337718 GAGCCCCCACCCCCAGCCAAGGG - Intronic
1044327901 8:90881447-90881469 CAGGCCCCACCTCCAGCACTGGG - Intronic
1044896669 8:96899727-96899749 CAGGCCCCACCTCCAGCACTAGG + Intronic
1044957233 8:97493647-97493669 GAGCCACCACACCCAGCCCTGGG + Intergenic
1045743350 8:105387547-105387569 CAGCCGGCCCCGCCCGCCCTAGG - Intronic
1045817607 8:106294728-106294750 CAGGCCCCACCTCCAGCACTGGG + Intronic
1046423151 8:114011182-114011204 CCGTCCGCCTCCCCAGCCCTTGG - Intergenic
1046910461 8:119620831-119620853 CAGCAAGTACCCCCATCCCTGGG + Intronic
1047750840 8:127879242-127879264 GAGCCACCACGCCCAGCCCTGGG - Intergenic
1048591381 8:135823988-135824010 CAGCTCCCACCTCCAGCTCTTGG - Intergenic
1048601198 8:135920581-135920603 CAGGCCCCACCCCCAACACTGGG - Intergenic
1048645482 8:136414741-136414763 CAGCCCGCATCCCAGGCACTGGG - Intergenic
1048865880 8:138761148-138761170 CAGCCCACACCACCAGCACTAGG + Intronic
1048973727 8:139659331-139659353 CAGCCTGAACCCTCAGTCCTAGG - Intronic
1049019984 8:139949727-139949749 CTTCCCCCACCCCCAGCCCTAGG - Intronic
1049087572 8:140490509-140490531 GAGCCTGCATCCTCAGCCCTTGG + Intergenic
1049304178 8:141890823-141890845 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1049379078 8:142303088-142303110 CTGCCGGCTCCCCCAGCGCTCGG + Intronic
1049444051 8:142621953-142621975 CATCCTGAACCCCCAGCTCTGGG - Intergenic
1049455257 8:142683333-142683355 CAGGCTGCACCCCTAGCCCTAGG - Intergenic
1049457066 8:142698762-142698784 CAGGCCCCACCCCCAACACTGGG + Intergenic
1049474291 8:142789602-142789624 CAGCCAGCTCCTCCAGCCCAGGG - Intergenic
1049595763 8:143482606-143482628 CAGCCCGCATTCCCAGCGCCTGG - Intronic
1049612198 8:143560936-143560958 CGGCCCGCACCCGCACCCCACGG + Intronic
1049615338 8:143573390-143573412 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1049654512 8:143791819-143791841 CAGACCCCACCCCCATGCCTCGG + Intronic
1049730861 8:144177660-144177682 CAGGCCCCACCTCCAGCACTGGG - Intronic
1049757728 8:144318227-144318249 CAGCAGGCAGCCCCAGCCCCTGG + Intronic
1049759862 8:144327040-144327062 CGGCCCGCAGCCCCGGCCCTGGG - Intergenic
1050146382 9:2572509-2572531 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1050236010 9:3580810-3580832 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1051149639 9:14066414-14066436 GAGCCACCACGCCCAGCCCTAGG - Intergenic
1051635947 9:19181164-19181186 GAGCCACCACACCCAGCCCTTGG - Intergenic
1051711201 9:19933033-19933055 CAGCCCCCACCTCCTGCCCCAGG - Intergenic
1052898060 9:33766750-33766772 CTGCCAGCACCCCCAGCCCCTGG - Intronic
1053199295 9:36141956-36141978 CAGCCCCTTCCCTCAGCCCTGGG + Intronic
1053294490 9:36903022-36903044 CACCCCTCACCACCAGCACTTGG + Intronic
1053313854 9:37035891-37035913 CACCCCCCGCCCCCAGCCCGGGG - Intergenic
1053428723 9:38027880-38027902 CAGGAGGCACCCCCTGCCCTGGG - Intronic
1053585839 9:39457714-39457736 CACCCCTCACCCCCAGCCTCTGG - Intergenic
1054580467 9:66907508-66907530 CACCCCTCACCCCCAGCCTCTGG + Intronic
1056222704 9:84465867-84465889 CACCCCGCCCCACCAGCCCTAGG - Intergenic
1056807855 9:89742771-89742793 CAGCCCCCAACCCCAGCCCCTGG - Intergenic
1056848172 9:90058392-90058414 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1057480171 9:95439055-95439077 TAGCCAACAGCCCCAGCCCTTGG - Intergenic
1057709040 9:97420445-97420467 CTCCCCTTACCCCCAGCCCTTGG + Intronic
1058379583 9:104363161-104363183 CAGCTGGCACCACCAGCCCCGGG - Intergenic
1058429249 9:104903687-104903709 CAGCCAGCACCCCCAGCGTGTGG + Exonic
1059322354 9:113479598-113479620 CATCCCCCAACCCCAGCCCCAGG - Intronic
1059429471 9:114241266-114241288 CTTCCCGCACCCTCAGCCCAGGG - Intronic
1059431844 9:114255164-114255186 CTGCCAGCTCCTCCAGCCCTGGG - Intronic
1060219700 9:121757932-121757954 CTCCTGGCACCCCCAGCCCTGGG + Intronic
1060703367 9:125779076-125779098 CATCCCCCACCCCTAGCCCTTGG + Intronic
1060849173 9:126860624-126860646 CAGCCCGCGCCCCCCGCCCCCGG - Intergenic
1061012843 9:127965603-127965625 CTGCCTGCTCTCCCAGCCCTTGG + Intronic
1061195403 9:129104365-129104387 CAGCCAGGTCCCCTAGCCCTGGG - Intronic
1061230950 9:129315540-129315562 CCACCTGGACCCCCAGCCCTCGG + Intergenic
1061537589 9:131259438-131259460 CACCCAGCCCTCCCAGCCCTTGG + Exonic
1061824711 9:133250951-133250973 AAGCCCACTCCCCCAGCCATCGG - Intronic
1061892835 9:133631795-133631817 TGGCCTGCACCCCCAGCTCTGGG - Intergenic
1062031434 9:134363778-134363800 CAGGTCGCACCTCCGGCCCTGGG - Intronic
1062113571 9:134795871-134795893 CAGCTCGGCCCCTCAGCCCTTGG - Intronic
1062116942 9:134814636-134814658 CAGGTCGCTCCCCAAGCCCTGGG - Intronic
1062139214 9:134946094-134946116 CACCCCACACCCCCAGCACCAGG - Intergenic
1062211027 9:135364182-135364204 CAGACTGCACACCCAGCCCTGGG + Intergenic
1062290593 9:135792626-135792648 CAGCCCTGGCCCCCAGCCCTTGG - Exonic
1062341009 9:136094080-136094102 CAGCCCGGACTCCCATCCCGTGG - Intronic
1062383474 9:136298781-136298803 CATCCCTCTCCCCCAGCCCCTGG - Intronic
1062406549 9:136399602-136399624 CAGCCCTCATGACCAGCCCTTGG - Intergenic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062527817 9:136985348-136985370 CACCCCGCGCCCCCTTCCCTGGG - Exonic
1062592841 9:137281715-137281737 TAGCCCCCACCCCCACCCCGTGG - Exonic
1062595090 9:137295803-137295825 CAGGCCGCGACCCCAGCGCTGGG + Intergenic
1062601645 9:137321053-137321075 CAGACTGCACCCCCAGGCCAGGG + Intronic
1062740987 9:138175270-138175292 CCACCCGCACCCCCATCCCTAGG - Intergenic
1186193897 X:7093160-7093182 CATCCCCCTCCCCCAGCCCCTGG + Intronic
1186295656 X:8145191-8145213 CAGCCGGCCCCGCCAGCCCGGGG - Intergenic
1186884100 X:13895422-13895444 CACCCCCCACCCCCAGCTTTTGG - Intronic
1186933215 X:14417749-14417771 CTCCCAACACCCCCAGCCCTGGG - Intergenic
1187083432 X:16015720-16015742 CAGGCCCCACCTCCAGCACTGGG + Intergenic
1187481261 X:19657905-19657927 CCGCCCCCACCCCCAGCCCCTGG - Intronic
1187674950 X:21707099-21707121 CACCCCCCACCCCAAGCCCCTGG + Intronic
1188003744 X:25003630-25003652 AAGCCCCCACCCCCACCCCCCGG - Intergenic
1188100037 X:26071814-26071836 GAGCCCTCACCCCCAGCCAAGGG - Intergenic
1188903080 X:35759341-35759363 CAGGCTGCACCTCCAGCACTGGG - Intergenic
1189257856 X:39654285-39654307 CACCCCCATCCCCCAGCCCTGGG - Intergenic
1189949464 X:46213907-46213929 CAGCCCCCACCTCCAACACTGGG + Intergenic
1190298600 X:49043077-49043099 CAGTCGGCACTCCCAGCCCCAGG + Intronic
1191907594 X:66110233-66110255 CATCCCGCACCCCCAGCTTTGGG + Intergenic
1191937980 X:66445469-66445491 CAGACCGCACCACCCACCCTAGG + Intergenic
1192196153 X:69029783-69029805 TAGCCCTCAGCTCCAGCCCTCGG + Intergenic
1192364746 X:70462047-70462069 CCCACCGCCCCCCCAGCCCTAGG + Intronic
1192405286 X:70879102-70879124 CCTCCCTCACCCTCAGCCCTAGG - Intronic
1192771438 X:74195766-74195788 AGGCCAGCACCCACAGCCCTAGG - Intergenic
1193091704 X:77500740-77500762 CAGGCCCCACCTCCAGCGCTGGG + Intergenic
1193098437 X:77579415-77579437 CACCCCCCACCCCCAGCTCCAGG + Intronic
1194002362 X:88446270-88446292 CATCCCCCACCCCAAGCCCCTGG - Intergenic
1194173496 X:90618018-90618040 CAGCTGGCACCGCCAGCCCTGGG - Intergenic
1194236037 X:91384016-91384038 CAGCCCCTACCTCCAGCACTGGG - Intergenic
1194895396 X:99433351-99433373 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1195297638 X:103495502-103495524 CTGTGCCCACCCCCAGCCCTAGG + Intergenic
1195785849 X:108521967-108521989 CAGCCCAGCCCCCCAGCCCTAGG + Intronic
1196089915 X:111729099-111729121 TTGCCCCAACCCCCAGCCCTTGG + Intronic
1196743790 X:119049769-119049791 CTCCCCCTACCCCCAGCCCTAGG - Intergenic
1196744821 X:119061947-119061969 CTGCCCTCACTCCCAGCCCCTGG - Intergenic
1196804844 X:119574773-119574795 CAGCTCGCAACCCCCGGCCTCGG - Intronic
1197800323 X:130340876-130340898 CACCCCCTACCCCCACCCCTTGG + Intronic
1198047013 X:132913303-132913325 CAGCCCGCAGCCCCAGGGCTAGG - Intronic
1198051511 X:132956888-132956910 CAACCCGCAGCTCCAGCCCGTGG + Exonic
1198597263 X:138250081-138250103 CAGCCACCACCCCCAGCCCAAGG - Intergenic
1199239334 X:145528025-145528047 TAGCCAGCACTCCCAGCACTAGG + Intergenic
1199577626 X:149328638-149328660 CAGGCCCCACCTCCAGCACTGGG - Intergenic
1199672208 X:150156708-150156730 CAGCCCTCACTCCCAGCCACTGG - Intergenic
1200182770 X:154160972-154160994 CATCCCCCACCCCCAGCCCCTGG - Intergenic
1200188424 X:154198086-154198108 CATCCCCCACCCCCAGCCCCTGG - Intergenic
1200194074 X:154235226-154235248 CATCCCCCACCCCCAGCCCCTGG - Intergenic
1200199829 X:154273030-154273052 CATCCCCCACCCCCAGCCCCTGG - Intronic
1200254979 X:154575849-154575871 CAGGCCCCACCTCCAGCCCTGGG - Intergenic
1200262790 X:154628559-154628581 CAGGCCCCACCTCCAGCCCTGGG + Intergenic
1200519716 Y:4195710-4195732 CAGCTGGCACAACCAGCCCTGGG - Intergenic