ID: 950217525

View in Genome Browser
Species Human (GRCh38)
Location 3:11169908-11169930
Sequence TGGGGCATGGAGAAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1174
Summary {0: 1, 1: 0, 2: 9, 3: 108, 4: 1056}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950217525 Original CRISPR TGGGGCATGGAGAAGGGGCA TGG (reversed) Intronic
900290242 1:1920673-1920695 TGTGGCAGGAAGAAGGGCCAGGG - Intergenic
900392121 1:2438297-2438319 TGGGGTAAGAAGAAAGGGCAGGG + Intronic
900459775 1:2797312-2797334 TGGGGCACGAGGAAAGGGCAGGG + Intronic
900848354 1:5121634-5121656 TGGGGCTGGGTGAAGGGGAAAGG - Intergenic
900858550 1:5206225-5206247 TGGGGCATGGGGAAGGGGCGGGG - Intergenic
900911786 1:5601770-5601792 TGGGGTGTGGAGACGCGGCACGG + Intergenic
900911819 1:5601892-5601914 TGGGGTGTGGAGACGCGGCATGG + Intergenic
900911824 1:5601912-5601934 TGGGGTGTGGAGACGCGGCATGG + Intergenic
901049557 1:6419552-6419574 TGGGGCGCGGAGCGGGGGCAGGG - Intronic
901381277 1:8876486-8876508 GGTGGCCTGGAGATGGGGCAGGG - Intronic
901399435 1:9005919-9005941 AGGGCCCTGGAGAAGGGGCCCGG - Intronic
901651727 1:10746933-10746955 TGGGCCCTAGAGAAGGGGCAGGG - Intronic
901798725 1:11694866-11694888 TGGGTCATGGTGTTGGGGCATGG - Intronic
902129087 1:14243109-14243131 AGTGGCATGGTGGAGGGGCAAGG - Intergenic
902381633 1:16055537-16055559 AGGGGCATGGGGATGGGGCGGGG + Intronic
902406652 1:16187798-16187820 AGGGGTAGGGAGTAGGGGCAGGG - Intergenic
902552235 1:17225951-17225973 TGGGGAGTGGGGAAGGGGGATGG + Intronic
902701964 1:18178746-18178768 TGGGGTAGGGGGAAGGGGAAGGG - Intronic
903045948 1:20564337-20564359 TGGGGAATGGAGAGGGGATAAGG - Intergenic
903049086 1:20587658-20587680 TGGGGAATGGGGAAGGGGCAGGG - Intergenic
903365848 1:22805088-22805110 GGGGGCAAGGAGAGGGGGCAAGG - Intronic
903466457 1:23555189-23555211 TGGGGCATGGGGAAGAGTCGTGG + Intergenic
903548772 1:24143180-24143202 TGGGGCGGGGAGAAGGGGGTGGG + Intergenic
903642131 1:24867430-24867452 TAGGGCAGGGAGAATGGGCAAGG + Intergenic
903675304 1:25060894-25060916 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
903773378 1:25778064-25778086 TTGGGCAGGGAGAAGGGGCGTGG - Intronic
904001849 1:27343212-27343234 AGGGGCATGTAGACGTGGCAAGG - Intronic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
904533485 1:31183947-31183969 TGGTGGATGGAGAATGGGCCAGG - Exonic
905104286 1:35554475-35554497 AGGGCCATGGAGAAGAGGCTGGG - Exonic
905275724 1:36816752-36816774 AGGGGCCTGGAGAAGTGGGAAGG - Intronic
905954245 1:41978880-41978902 TGGGGCAGGGGTGAGGGGCAAGG - Intronic
906100374 1:43256505-43256527 AGGTGCATGGAGCAGGGGCCTGG + Intronic
906193591 1:43914792-43914814 CTGGGCCTGGAGAAGGGACAGGG + Intronic
906200049 1:43954185-43954207 TGGCACAAAGAGAAGGGGCAGGG - Intronic
906324925 1:44839608-44839630 TGGGGAATGGAGAGGGAGGAAGG + Intronic
906495230 1:46301012-46301034 TAGGGGAGGGAGAAGGGGAAAGG + Intronic
906502620 1:46352550-46352572 TGGGGAAAGGAAAAGGGGAAAGG + Intronic
906687521 1:47772077-47772099 TGGGCCAGGGAGAGGGGGAAGGG + Intronic
906711032 1:47930124-47930146 TTTGGCAGGGAGAAGGGGAAGGG - Intronic
906952290 1:50344726-50344748 TGCTGGATGGAGAAGGGGGAGGG + Intergenic
907190646 1:52645069-52645091 TCGGGGAGGTAGAAGGGGCAAGG + Intronic
907248227 1:53121432-53121454 GGGGGCTTGGTGAAGGGACAAGG + Intronic
907272280 1:53298127-53298149 TGGGGCCTGGAGGAGGTGCTTGG - Intronic
907283799 1:53367805-53367827 TGGGGCTTGGAGCATGGGGATGG - Intergenic
907329264 1:53660646-53660668 TGGGGCAGGGAGGAGGGAAAAGG + Intronic
907387493 1:54135665-54135687 TAGGGCATGGAATAGGGGGAGGG + Intronic
907795384 1:57710921-57710943 TGGGGCAGGCAGGAGGGTCAGGG + Intronic
907951624 1:59189036-59189058 TGGGGGATGGAGGAGGGACTGGG + Intergenic
908140442 1:61179036-61179058 TGGGGCAGGCTGAAAGGGCAGGG - Intronic
908849743 1:68363767-68363789 TGGGGCATTGAGAAGGGACATGG + Intergenic
909119265 1:71580307-71580329 TGGGGCATGGGGAGGGGGGAGGG + Intronic
909559434 1:76993099-76993121 TGGGGAAGGCAAAAGGGGCATGG - Intronic
912135223 1:106652898-106652920 TGGGGTAGGGAGATGGGGGAGGG - Intergenic
912258561 1:108085787-108085809 TGGGGGATGGTGCAGGGGGAAGG + Intergenic
912530448 1:110317231-110317253 TGGGGCCCGGGGAAGGGGCCCGG + Intergenic
912964168 1:114222882-114222904 TGAGGCAAGGAAAGGGGGCATGG - Intergenic
913075120 1:115335759-115335781 CTGGGCATGGAGTAGGGCCAAGG - Intronic
913089269 1:115465643-115465665 TGGGCCCTGAAGAAGGAGCAGGG + Intergenic
913169969 1:116222812-116222834 TGGGCCAAGGAGAAGGGCCCTGG - Intergenic
913196266 1:116458786-116458808 TGGGGTATGGGGAGGGGGGAGGG - Intergenic
914331086 1:146671379-146671401 TGGGGCATGGGGTGGGGCCATGG + Intergenic
914909337 1:151771468-151771490 TGGGGCATGGAGGAAGGCAAAGG - Intronic
915066949 1:153232608-153232630 TGGGGCAGGGAGCTGGAGCATGG - Intergenic
915213579 1:154326454-154326476 TGGGGCTGGGTGACGGGGCAGGG + Intronic
915529737 1:156496446-156496468 TGGGGGAGGGGTAAGGGGCAGGG + Intronic
915601554 1:156925689-156925711 GGGAGCCTAGAGAAGGGGCAGGG - Intronic
915723709 1:158002738-158002760 TGGAGCAGGGAGCAGGGGCAGGG + Intronic
915831998 1:159140035-159140057 TGGGGGAAGGGGAAGGGGAAGGG - Intronic
915932071 1:160067105-160067127 TGTGGCATGGAGAAGGAGGTTGG - Intronic
915935596 1:160088541-160088563 TGGGGCCTGGAGAGGGGCCTGGG + Exonic
916078050 1:161214543-161214565 TGGGGAATAGAGAAGTGGAAAGG - Intergenic
916171421 1:162003960-162003982 TGGGGACTGGAGGAGGGGAAGGG + Intronic
916498873 1:165369476-165369498 TGTGGCATGAAGATGTGGCAGGG - Intergenic
917431058 1:174969488-174969510 TGAGGAATGGACAAGTGGCAGGG + Intronic
917506986 1:175636386-175636408 AGGGGCATGGAGAAGAGGGCAGG - Intronic
917596808 1:176537577-176537599 TGGTGCATGGACAAGGTGCAAGG - Intronic
917631169 1:176892998-176893020 TGGTGCAGGGAGAAAGGGAAGGG + Intronic
918097815 1:181349138-181349160 TGGGACAGAGAGAAGGTGCAGGG + Intergenic
918215957 1:182391986-182392008 AGGGGCGTGGGGGAGGGGCAGGG + Exonic
918357341 1:183717904-183717926 TGGGGCATGGATATGGTGGAAGG + Intronic
918649396 1:186942102-186942124 GGGGGCATGTAGCAGGGTCAGGG + Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918817513 1:189208593-189208615 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
919775469 1:201191414-201191436 TAGGTCCTGGAGAGGGGGCAGGG + Intronic
919861459 1:201741488-201741510 TGGGCCCTGGAGAAGGTGAAGGG + Intronic
919932304 1:202229296-202229318 TGGGGCAGGGAGAAGGAGAAGGG - Intronic
920112597 1:203597846-203597868 AGGGGGATGGAGAGGGGCCAGGG - Intergenic
920330243 1:205202103-205202125 GGGGGAAGGGAGAAGGGGAAGGG + Intronic
920371298 1:205481068-205481090 TGGGGCTGGGGGAGGGGGCAGGG - Intergenic
920377758 1:205518515-205518537 TGGGCCACAGGGAAGGGGCAAGG + Intronic
920650924 1:207836797-207836819 TGGGGCCTGCAGAAGGACCAGGG + Intergenic
920986149 1:210891390-210891412 TGGGGTGAGGAGAAGGGGGAGGG + Intronic
921068116 1:211637194-211637216 GGAGGCAGTGAGAAGGGGCAGGG + Intergenic
922070302 1:222185939-222185961 TGGGGTATGGGGAGGGGGGAGGG - Intergenic
922114756 1:222602044-222602066 TGCTGCCTGGTGAAGGGGCAAGG - Intergenic
922725249 1:227920064-227920086 GCGGGCATGGTGAGGGGGCAGGG - Exonic
922898587 1:229119240-229119262 GGGGGCTTGGAGGAAGGGCATGG + Intergenic
923301165 1:232642052-232642074 TGTTGCATGGAGAAAAGGCATGG - Intergenic
923438480 1:233992770-233992792 TGGGGAATGTAGCAGGGACAGGG + Intronic
924309196 1:242722396-242722418 CGGGGCAGGGGGCAGGGGCAGGG - Intergenic
924323431 1:242871888-242871910 TGGGACAAGTAGAAAGGGCATGG + Intergenic
924784897 1:247185429-247185451 TGGGGCTCGGAGGCGGGGCAGGG + Intergenic
1062801119 10:381309-381331 AGGGGCAGGGAGAACCGGCATGG + Intronic
1062815076 10:493449-493471 GGGGGGAGCGAGAAGGGGCAAGG + Intronic
1063596742 10:7442278-7442300 CTGGGCCTGGAGACGGGGCAGGG - Intergenic
1063601529 10:7485578-7485600 AGGGGCATGGAGAGGGGACGAGG + Intergenic
1064150119 10:12855841-12855863 TGGGGGGTGGATAAGGGGTAGGG - Intergenic
1064300104 10:14115728-14115750 TGGAAGATGGAGAGGGGGCAGGG - Intronic
1064942124 10:20746753-20746775 TGGGGCATGGGGAGGGGAAATGG - Intergenic
1065045258 10:21742180-21742202 TGGGGTAAGGGGTAGGGGCATGG - Exonic
1065283962 10:24169291-24169313 TGGGTCAGGAAGAACGGGCATGG - Intronic
1065727750 10:28682360-28682382 TGGGGCATGTACAGTGGGCACGG + Exonic
1066524233 10:36258694-36258716 CGGGGCATGGTAAAGGGACATGG + Intergenic
1067056950 10:43058060-43058082 TGGGGGATGGAGAAGGAGGGAGG - Intergenic
1067363996 10:45608111-45608133 TGGGGGAGGGAAAAGGGGGAAGG + Intergenic
1067557604 10:47283565-47283587 TGGGGTGTGGAAAAGGGCCATGG + Intergenic
1067675492 10:48371956-48371978 CAAGGCGTGGAGAAGGGGCATGG + Intronic
1068075521 10:52248965-52248987 TGGGGAAGGGGGAAGGGGGAAGG - Intronic
1069280231 10:66646457-66646479 TGGGGCAAGTGGAAGGGGTAGGG + Intronic
1069604472 10:69730981-69731003 AGTGGCCTGGAGAAGGGGGACGG - Intergenic
1069633401 10:69911197-69911219 TGAAGCATTGAGAAGGGGCAAGG - Intronic
1069655036 10:70081449-70081471 TGGGCCAGGGAGAGGGGGAAAGG + Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069871039 10:71533168-71533190 GGCGGCTTGGAGAAGCGGCATGG + Intronic
1069875619 10:71561298-71561320 GGGGGCAGGGAGGAGGGGCAAGG - Intronic
1069884506 10:71615415-71615437 GGGGGCATGGAGCTGGGGCCAGG - Intronic
1069996442 10:72344811-72344833 TGGAGGATGGAGAAGGTCCAAGG - Intronic
1070537882 10:77393000-77393022 TGGGGACTGGAGAACGGGCTGGG - Intronic
1070590435 10:77796881-77796903 AGGAGAATGGAGATGGGGCAGGG - Intronic
1070769433 10:79073698-79073720 TGGGGGGTGCAGAAGGGGGAAGG + Intronic
1070808000 10:79282004-79282026 TGGGGCTTGGAGAAGGAACACGG - Intronic
1070969134 10:80549272-80549294 TGGGGCATGGAGAGAGAGCTGGG + Intronic
1071164163 10:82785204-82785226 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1071365868 10:84900153-84900175 GGGTGAAGGGAGAAGGGGCAAGG - Intergenic
1071412190 10:85407745-85407767 TTGGGCATGCAGAAAGGACAGGG - Intergenic
1071448051 10:85767618-85767640 AGGGAGATGGAAAAGGGGCAAGG + Intronic
1071696602 10:87881361-87881383 TGGGGTATGGGGAGGGGGGAGGG - Intronic
1071917469 10:90310699-90310721 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1072197681 10:93130627-93130649 GGAGGAATGGAGAAGGGGAAAGG - Intergenic
1072449898 10:95531618-95531640 CGTGGCATGGAGAAGCAGCACGG + Intronic
1072738838 10:97897253-97897275 TGATGGATGAAGAAGGGGCAGGG + Intronic
1072837064 10:98726485-98726507 TGGGGCAGGGGGAGGGGGGAGGG + Intronic
1074527507 10:114275045-114275067 TGGAGCATGGAGGAGGGGACAGG + Intronic
1075002464 10:118808692-118808714 AGGGGCAGGGTGGAGGGGCAGGG - Intergenic
1075079723 10:119375286-119375308 TGAGGCTGGGAGGAGGGGCAAGG - Intronic
1075216842 10:120543768-120543790 AGGGGCTTGGCGAAGGGGAATGG - Intronic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075279864 10:121130113-121130135 TGGGGCATGGAGACGGGGAAAGG + Intergenic
1075426022 10:122342290-122342312 TGGGGACTTGAGCAGGGGCAAGG + Intergenic
1075515001 10:123101504-123101526 GGGGGCATGGGGAAGTGGCAAGG - Intergenic
1075585429 10:123653776-123653798 GGGGGAATGGGGAAGGGGAAGGG + Intergenic
1075585434 10:123653789-123653811 AGGGGAAGGGAGAAGGGGGAAGG + Intergenic
1075819350 10:125292465-125292487 TGGAGCAAGGAGAAGAGCCAGGG - Intergenic
1075989512 10:126823268-126823290 TGGGGCATGGGGATGGGACTGGG + Intergenic
1076389499 10:130087901-130087923 TGGAGAATAGAGAAGAGGCATGG + Intergenic
1076526546 10:131115905-131115927 AGGGTCCTGGAGAGGGGGCAGGG - Intronic
1076760920 10:132605375-132605397 TGGGGGATGGGGAAGGGACAGGG + Intronic
1076790545 10:132774853-132774875 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790549 10:132774866-132774888 AGGGGCAGGGAGGAGAGGCAGGG + Intronic
1076790555 10:132774879-132774901 AGAGGCAGGGAGGAGGGGCAGGG + Intronic
1076790576 10:132774940-132774962 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790587 10:132774970-132774992 AGGGACAGGGAGGAGGGGCAGGG + Intronic
1076790597 10:132775000-132775022 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1076790603 10:132775013-132775035 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790630 10:132775070-132775092 AGGGGCAGGGGGGAGGGGCAGGG + Intronic
1076790646 10:132775113-132775135 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790662 10:132775160-132775182 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1076823391 10:132953456-132953478 TGGGTCAATGAGAAGGGGGAGGG + Intergenic
1076824519 10:132960381-132960403 TGGGGCATGGCGAGGGCCCAGGG - Intergenic
1076885533 10:133260764-133260786 TGGGGATGGGAGAAGGGGCTCGG + Intergenic
1077047973 11:554605-554627 TTGGGCATGGCCGAGGGGCAGGG + Exonic
1077048589 11:556681-556703 CGGGGCAGGGAGCAGGGCCAGGG + Intronic
1077106699 11:845368-845390 TGGGGCCTGTAGATGGGGCCGGG + Intronic
1077183450 11:1226430-1226452 TGGGGGATGGGGACGGGTCAGGG + Intronic
1077184100 11:1228796-1228818 TGTGCCAGAGAGAAGGGGCAGGG + Intronic
1077215532 11:1393862-1393884 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215550 11:1393915-1393937 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215566 11:1393967-1393989 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215585 11:1394021-1394043 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215597 11:1394060-1394082 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215610 11:1394100-1394122 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215618 11:1394126-1394148 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215622 11:1394139-1394161 TGGGCCATGGAGATGGGCCATGG + Intronic
1077215626 11:1394152-1394174 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215640 11:1394192-1394214 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215654 11:1394232-1394254 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215666 11:1394271-1394293 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215686 11:1394325-1394347 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215694 11:1394351-1394373 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215698 11:1394364-1394386 TGGGCCATGGAGATGGGCCATGG + Intronic
1077215702 11:1394377-1394399 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215716 11:1394417-1394439 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215724 11:1394443-1394465 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215728 11:1394456-1394478 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215732 11:1394469-1394491 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215736 11:1394482-1394504 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215754 11:1394535-1394557 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215762 11:1394561-1394583 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215766 11:1394574-1394596 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215770 11:1394587-1394609 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215774 11:1394600-1394622 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215782 11:1394626-1394648 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215786 11:1394639-1394661 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215813 11:1394719-1394741 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215831 11:1394772-1394794 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215839 11:1394798-1394820 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215843 11:1394811-1394833 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215861 11:1394864-1394886 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215869 11:1394890-1394912 TGGGTCCTGGAGATGGGCCATGG + Intronic
1077215873 11:1394903-1394925 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077215895 11:1394969-1394991 TGGGCCATGGAGATGGGTCCTGG + Intronic
1077346225 11:2056990-2057012 TGGAGGATGGAAAAGGAGCATGG - Intergenic
1077407917 11:2390923-2390945 TGAGGGGTGGAGACGGGGCAGGG + Intronic
1077485751 11:2837698-2837720 TGGGGCCTGGAGAATGAGAAGGG + Intronic
1077578757 11:3403685-3403707 TGGGGGATGGCGGAGGGGGAGGG + Intergenic
1077768524 11:5189347-5189369 TGGAGCAGGAAGAAGAGGCAGGG - Intergenic
1078058725 11:8030102-8030124 TCGGGTATGGAGGTGGGGCATGG + Intronic
1078614313 11:12850858-12850880 TGTGGCTTGGGGAAGTGGCAGGG + Intronic
1078936006 11:15950930-15950952 TGGGAGAGGGAGAAGGGGAATGG - Intergenic
1079119588 11:17672346-17672368 GGGGGCATAAAGAAGGGGCTGGG + Intergenic
1079641908 11:22816183-22816205 GGGGGCAGGGAGATGGGGGAGGG - Intronic
1080033814 11:27689878-27689900 TGGGGCCTGGAGCAGGGGGCAGG - Intronic
1080668938 11:34358456-34358478 TGGGGCCAGGAGAATGGGGAGGG + Intergenic
1080985652 11:37461237-37461259 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1081540375 11:44030406-44030428 TGGGGCTTGGAGAATAGGCGGGG - Intergenic
1081612475 11:44570877-44570899 TGGGGCCTGGAGAAATGGGACGG + Intronic
1081709915 11:45209936-45209958 TGGGGCGCGGAGAAGGGGAGGGG + Intronic
1081777449 11:45685281-45685303 TGGGGCAGGGAGAGGGGTCTCGG - Intergenic
1081809274 11:45906137-45906159 TGGGGGTTGGGGCAGGGGCAGGG - Exonic
1081911877 11:46705092-46705114 CAGGGCATGGGCAAGGGGCAGGG - Exonic
1083083054 11:60113477-60113499 TGGGGGATGGAAAAGGGAGAAGG + Intergenic
1083326472 11:61875712-61875734 TGGGGAAGGGAGGAAGGGCATGG + Intronic
1083614512 11:64019591-64019613 TGGAGCATGGAGGAGGGGCCGGG - Intronic
1083820989 11:65171331-65171353 TAGGAGATGGAGATGGGGCAGGG - Exonic
1083880020 11:65543775-65543797 TGGGGCAGGGAGAGAGGGCGGGG - Intronic
1083927659 11:65818256-65818278 TGGGGCAGGGCGGCGGGGCAAGG + Intergenic
1083964654 11:66035975-66035997 AAGGGCATGGAGAAGAGGAAGGG - Intergenic
1084030778 11:66479612-66479634 TGGGGCATGCGGAAGGGCCTAGG - Intergenic
1084106829 11:66985932-66985954 TGGAGGATGGAGCAGGGCCAAGG + Intergenic
1084148064 11:67275477-67275499 TTGGGCAGGAAGAAGGGGAAGGG - Intronic
1084235785 11:67787201-67787223 TGGGGGATGGCGGAGGGGGAGGG + Intergenic
1084258083 11:67955979-67956001 TGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1084372234 11:68751496-68751518 TGGCGGTTGGAGAAGGGGGAAGG + Exonic
1084892199 11:72242101-72242123 TGGGACATGGAGAAGGTGCCTGG - Intronic
1085159998 11:74331826-74331848 AGGGGCATGATGAAGGGGGAAGG - Exonic
1085516812 11:77116388-77116410 TGGGGCATGCAGGAGAGGCCTGG - Intronic
1085537895 11:77236324-77236346 TGGGGTGGGGAGACGGGGCAGGG - Intronic
1086966496 11:93033194-93033216 TGGGGCATGGAGTTGGGGGATGG + Intergenic
1087887354 11:103496094-103496116 TGGGGCATGCAGGAGGGCCAAGG - Intergenic
1087892783 11:103553809-103553831 AGGGGCATGCAGGAGTGGCAAGG + Intergenic
1088155751 11:106800738-106800760 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1088254135 11:107887044-107887066 TGAGTCTAGGAGAAGGGGCATGG + Intronic
1088537952 11:110882070-110882092 TGGGGTAGGGAGAGGGGGGAGGG + Intergenic
1088720553 11:112588465-112588487 TGGGGCATGGAGGAGGGGAGAGG - Intergenic
1089006467 11:115095512-115095534 TGGGGCATGTCAAAGGGACATGG + Intergenic
1089307587 11:117536300-117536322 TTGGGGATGGAGACGGGCCAGGG + Intronic
1089349527 11:117814483-117814505 GGAGGCATGGAGCAGGGACAGGG + Intronic
1089497928 11:118917053-118917075 AGGGGCCTGGAGAAGGCCCAGGG - Intronic
1089528417 11:119111641-119111663 TGGAGCATGGGGTCGGGGCAGGG - Intronic
1089535558 11:119158768-119158790 TGGGGCTTGGGGCAGGGGCCAGG + Intronic
1089611738 11:119673086-119673108 TGGGGCTTAGAGCAAGGGCATGG + Intronic
1089858860 11:121571316-121571338 TGAGTTATGGAGAATGGGCATGG + Intronic
1089995170 11:122899919-122899941 TGGGGCAGGGATATGGGACATGG - Intronic
1090049221 11:123362745-123362767 TGGGACTTGGGGAAGGGGTAGGG + Intergenic
1090209674 11:124909491-124909513 TGGGGCGGGGAGAGGGGGAAGGG - Intergenic
1090342007 11:126032290-126032312 TGGGGGATGGAGTAGAGGAAGGG + Intronic
1090383980 11:126345893-126345915 TGGGGCTTGGAGAAGGCCCTCGG - Intergenic
1090436791 11:126693902-126693924 TGGGATCTGGGGAAGGGGCAAGG - Intronic
1090703205 11:129314748-129314770 TGGGGGAGGGGGAAGGGGAAGGG - Intergenic
1091364016 11:135001854-135001876 TGGGACAGGGACAAGGGACATGG - Intergenic
1091387907 12:106437-106459 AGGGGCAGGGCGGAGGGGCAGGG - Intronic
1091413981 12:264095-264117 AAGGGCATGGGGTAGGGGCATGG + Intergenic
1091583415 12:1802252-1802274 TGGGCAATGGAGACAGGGCAAGG - Intronic
1091726115 12:2847706-2847728 AGGGGCTTGGAGGAAGGGCATGG - Intronic
1091812971 12:3415218-3415240 CGAGGCATGGGGAAGGGACATGG + Intronic
1092730564 12:11529647-11529669 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1092931931 12:13324095-13324117 TCAGGCATGGAGAAAGGTCAGGG - Intergenic
1093221496 12:16425810-16425832 TGGGGTATTGAGAAAGGGCTTGG - Intronic
1094259726 12:28479464-28479486 TGGGGTAGGGGGAAGGGGGAAGG + Intronic
1094555704 12:31497827-31497849 AGGGGCAAGGGGAGGGGGCAGGG + Intronic
1095942168 12:47734454-47734476 GGGGGCATGGGGAAAGGGCATGG + Intergenic
1095999244 12:48115017-48115039 AGAGTCATGGAGAAGGGGGATGG + Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096220839 12:49827646-49827668 TTGGGCAGGGAGCAGGGACAGGG - Intronic
1096229876 12:49890875-49890897 TGAGGTAGGGAGAAGGGGAATGG - Intronic
1096626224 12:52897674-52897696 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1096638406 12:52975720-52975742 TGGGGAATGGAGAAGCGGGTGGG - Intergenic
1096670498 12:53195723-53195745 TGGGACAGGGAGCAGGGACAAGG + Intronic
1096792780 12:54055220-54055242 GGGGGCATGGGGTGGGGGCAGGG - Exonic
1097051929 12:56228934-56228956 TGGGGCATGGAGACAGGCCTTGG + Intronic
1097235477 12:57536437-57536459 AGGGACAGGGAGAAGGGGCAAGG + Intronic
1097398434 12:59103054-59103076 AGAGACATGGAGAAGGGGTAGGG - Intergenic
1097691920 12:62741619-62741641 GGGGTCACAGAGAAGGGGCATGG - Intronic
1097905364 12:64913796-64913818 CGGGACATGGAGAATGGCCAAGG - Intergenic
1097944252 12:65349049-65349071 TGGGGTGGGGAGAAGGGGGAGGG - Intronic
1098126518 12:67300449-67300471 TGGGAGATGGGGAAGGGGCAGGG - Intronic
1098462523 12:70748001-70748023 TGGGGGAAGGAGAAGGGAAAGGG + Intronic
1099014206 12:77325357-77325379 TGGGTCCTGGAGAAGCAGCAGGG - Intergenic
1100306027 12:93351119-93351141 TGGGGTATGGGGATGGGGAAGGG - Intergenic
1100713789 12:97284746-97284768 TGCTGGATGGAGAAGGTGCATGG - Intergenic
1101289373 12:103352075-103352097 TGGGGCAAAGAGGAAGGGCAAGG - Intronic
1101450778 12:104776785-104776807 TGGGGGATGGAGAAGTTGGAAGG - Intergenic
1101541864 12:105672614-105672636 TGGGACATGGAAAAGGGGTGGGG + Intergenic
1101714642 12:107300213-107300235 TGGGGTAGGGAGAGGGGGAAGGG - Intergenic
1101915560 12:108893063-108893085 TGGGGCAGGGAGAAGAGGGGAGG + Intronic
1101943919 12:109121533-109121555 TGGGGCATAGAGCAAGAGCATGG + Intronic
1102226273 12:111230426-111230448 TGGGACATGGAGGTGGGGGATGG - Intronic
1102394177 12:112573986-112574008 TGGGGCAGGGAGAGGGGTAATGG + Intronic
1102394259 12:112574228-112574250 GGGGGCATGGAGGAGGGGGAGGG + Intronic
1102453761 12:113058550-113058572 TGAGGCAGGGAGATGGGGAAGGG - Intronic
1103179265 12:118894507-118894529 TGGGGGATGGAGTGGGGGAAGGG + Intergenic
1103204741 12:119119806-119119828 TGGAGAATGGAGGAGGGGAAAGG + Intronic
1103530624 12:121598845-121598867 TGGGTGTTGGAGAAAGGGCAGGG + Intergenic
1103611334 12:122126003-122126025 GTGGGACTGGAGAAGGGGCAGGG + Intronic
1103900730 12:124302549-124302571 TGGGGCAGGGGGCCGGGGCAGGG - Intronic
1103986258 12:124769543-124769565 AAGGGCATGGGGAAGGGGCATGG - Intergenic
1103986264 12:124769556-124769578 AGGGGCACGGGGAAAGGGCATGG - Intergenic
1103986269 12:124769569-124769591 AGAGGCATGGGGGAGGGGCACGG - Intergenic
1103998016 12:124842495-124842517 GGGGGCAGGGAGAAGAGACAGGG - Intronic
1104431347 12:128718842-128718864 TGGGGCAGGAGGAAGGGACAGGG + Intergenic
1104968971 12:132522656-132522678 TGGGGCGTGCAGCAGGAGCAGGG - Intronic
1105290899 13:19052865-19052887 TGGGGGATGGGGTTGGGGCAGGG - Intergenic
1105595158 13:21830613-21830635 AGGGGGAGGGAGAAGGGGAAAGG - Intergenic
1106285002 13:28310654-28310676 AGGGAATTGGAGAAGGGGCAAGG - Intronic
1106340419 13:28821503-28821525 TGGGGCCTGGGGAAAGGGAAGGG - Intronic
1106438918 13:29748282-29748304 TGGGGCAAGCAGAAGGGCAAAGG - Intergenic
1106693546 13:32145885-32145907 TGGGGAATGGAGCAGAGGCAGGG - Intronic
1107149090 13:37091190-37091212 TGGGGCTCTGAGCAGGGGCAGGG + Intergenic
1107706295 13:43109711-43109733 TGGGGCGGGGAGAGGGGGGAGGG + Exonic
1107785205 13:43948755-43948777 TGGGGGATGGAGAAGGGGAGAGG + Intergenic
1107955022 13:45503542-45503564 TGGACCATGGATGAGGGGCATGG + Intronic
1108346422 13:49551125-49551147 GGGGGGAGGGAGAAGGGGGAAGG + Intronic
1108731945 13:53244551-53244573 TGGGGCAAGGAGGAGGAGAACGG - Intergenic
1108832335 13:54495616-54495638 TGGCACATGAAGAATGGGCAGGG + Intergenic
1109409739 13:61946238-61946260 TGGGGTGTGGGGAAGGGGGAGGG + Intergenic
1110157652 13:72337988-72338010 TGGGGTAGGGAGAGGGGGGAGGG - Intergenic
1111547455 13:89760599-89760621 TGGGGCATTGAATAGGAGCAAGG - Intergenic
1111605183 13:90529186-90529208 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1111954061 13:94737808-94737830 TGGAGCTTGGAGTGGGGGCAAGG + Intergenic
1112602360 13:100869007-100869029 TGGGCCATGGTGGAAGGGCAGGG + Intergenic
1112628648 13:101136445-101136467 TGGGGCAGGGGGAGGGGGGAGGG - Intronic
1113159591 13:107364972-107364994 AGGGGGATGGGGAAGGGGGAGGG - Intronic
1113278109 13:108757620-108757642 TGGGGTGGGGAGAAGGGGGAGGG - Intronic
1113560193 13:111272622-111272644 TGGGGCGTGGTGATGGGGCGGGG + Intronic
1113574416 13:111383872-111383894 TGGGGCTGGGAGAAGGGACTTGG + Intergenic
1113927965 13:113951674-113951696 TGGGGCCTGGAGGAGGAGCAGGG - Intergenic
1113966168 13:114155150-114155172 TGGGGCCTGGGGGAGGGGGAGGG + Intergenic
1115159766 14:30380675-30380697 ACGGGCAGCGAGAAGGGGCAAGG + Intergenic
1115501654 14:34055087-34055109 GAGGGCATGGAGAAGTGGAAGGG + Intronic
1115604253 14:34984296-34984318 TGTGCCATGGAGAAAGGGAAAGG + Intronic
1115761490 14:36581905-36581927 TCAGGCATGGAGAGGGGGCGGGG + Intronic
1115774704 14:36702533-36702555 TGGGGCAGGGAGATGGTGTAGGG - Intronic
1116078531 14:40143837-40143859 TGGGGCAGGGGGAAGGGGGAGGG + Intergenic
1116358342 14:43960080-43960102 TGGGGTGTGGGGAGGGGGCAGGG + Intergenic
1116515009 14:45794751-45794773 TGGGGTGGGGAGAAGGGGGATGG - Intergenic
1116604326 14:46969784-46969806 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1116856328 14:49955480-49955502 AGGGGCATGCAGTTGGGGCAGGG - Intergenic
1117227702 14:53680208-53680230 TGGGGTAGGGGGAGGGGGCAGGG - Intergenic
1117284504 14:54273887-54273909 TGGGGTGAGGAGAAGGGGGAGGG - Intergenic
1117763847 14:59059715-59059737 AGGGGCAGGGGGCAGGGGCAGGG + Intergenic
1117763857 14:59059734-59059756 AGGGGCAGGGGGCAGGGGCAGGG + Intergenic
1118089614 14:62458844-62458866 GGGGGAGTGGAGAAGGGGAATGG - Intergenic
1118313315 14:64708402-64708424 TGGGGCGGGGACAAGGGGTAGGG + Intronic
1118448125 14:65870347-65870369 TGTGGCATAGAGAAGGAGCCTGG - Intergenic
1118824467 14:69367734-69367756 TGGGAAGTGGAGATGGGGCAGGG + Intergenic
1119408060 14:74411034-74411056 TGGGGTATGGAGAGAGGCCAGGG + Intronic
1119703548 14:76770627-76770649 TGGGGCAGGGTGCAGGGGCAGGG - Intronic
1120591475 14:86378950-86378972 TGGGGCGAGAGGAAGGGGCAAGG + Intergenic
1120763466 14:88306675-88306697 TGGGGCTGGGGGAGGGGGCATGG + Intronic
1121391311 14:93577298-93577320 TTGGGCATAGAGTAGGGCCAAGG + Intronic
1121437158 14:93927512-93927534 TGGGGCCTGGGGGAGGGGCGAGG + Intronic
1121438035 14:93931816-93931838 TCGGGGATGGTGAAGGGGTAGGG - Intergenic
1121593383 14:95137549-95137571 AAGGGAATGGAGAAGGGGAAGGG + Intronic
1121705262 14:95988462-95988484 TGGGGTATGGAGAAGGTGGTGGG - Intergenic
1121903997 14:97723290-97723312 TGGGGAATGGACAGGGAGCAAGG + Intergenic
1122030449 14:98908075-98908097 GGGGGGCTGGAGGAGGGGCAGGG - Intergenic
1122388285 14:101363555-101363577 AGGGGCTGGGAGATGGGGCAAGG + Intergenic
1122515399 14:102304934-102304956 TGGGGCCGGGGAAAGGGGCAGGG - Intronic
1122593349 14:102871235-102871257 GGAAGCATGGAGAAGGGGGAGGG - Intronic
1122663828 14:103315610-103315632 TGGGCCAAGGACGAGGGGCAGGG - Intergenic
1122774776 14:104112284-104112306 TGGGGCAGGGCGCAGGGGCAGGG - Intronic
1122785255 14:104160514-104160536 TGGGGCCTGGGGAAGCTGCAGGG + Intronic
1122806391 14:104262048-104262070 TGGGGCCTGGAGAAGCGGGCAGG + Intergenic
1122820607 14:104342960-104342982 TGGCCCAGGGAGGAGGGGCAGGG + Intergenic
1122856149 14:104561129-104561151 TGGGGCAGGCAGCTGGGGCAGGG - Intronic
1122911090 14:104827842-104827864 CGGGGCAGGGAGGAGGGGCTGGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124636510 15:31368058-31368080 TGGAGCATGGAGAAGAGGGGAGG - Intronic
1125053835 15:35334547-35334569 GGGGGCATGGGGTAGGGGTAGGG - Intronic
1125290069 15:38136810-38136832 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
1126106280 15:45149002-45149024 TGGGGCAGGAAGTAGGGGGAAGG - Intronic
1126269777 15:46801342-46801364 TGGGGCAGGGAGAAGAGAGAGGG - Intergenic
1126996930 15:54454596-54454618 AGGGGCTTGGAGGAAGGGCATGG - Intronic
1127997778 15:64163397-64163419 GTGGGCCTGGACAAGGGGCACGG + Intergenic
1128095307 15:64949691-64949713 TGGAGCATGGAGAAGGGCCTTGG + Intronic
1128316255 15:66661359-66661381 TGGGGCCTGGGGAAGGAGCCAGG - Intronic
1128504617 15:68258785-68258807 TTGTGAATGGAGACGGGGCAAGG - Intergenic
1128514521 15:68334056-68334078 AGGCACATGGAAAAGGGGCAGGG - Intronic
1128666275 15:69540453-69540475 TTGGACTTGGAGATGGGGCAGGG + Intergenic
1128703650 15:69822306-69822328 TGAGGCAAGGAGATGGGGCAAGG + Intergenic
1129053170 15:72799170-72799192 GGGGACAGGGAGAAAGGGCAAGG - Intergenic
1129207930 15:74048256-74048278 TGAGGCATGGAGAGTGGTCAGGG - Intergenic
1129246857 15:74284448-74284470 TGAGGGATGGAGAAGGGGATGGG - Intronic
1129293822 15:74588487-74588509 TGGGGCAATGGGAGGGGGCAAGG + Intronic
1129810676 15:78507545-78507567 CGGGGCTTGGAGGAGGGGCGCGG + Intronic
1130650027 15:85757176-85757198 TGGGGCTTGGGGAAGGGAGAAGG - Intergenic
1130689031 15:86064332-86064354 AGGGACACGGGGAAGGGGCAGGG + Intergenic
1131064454 15:89424869-89424891 TGGGGCAGGGGGAAGGGGGTAGG + Intergenic
1131202770 15:90414212-90414234 TGGGAGATGGAGAAGGGGGCGGG + Intronic
1131342220 15:91613108-91613130 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1132018419 15:98339318-98339340 TGGGGAAGGGGGAATGGGCATGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132085932 15:98908158-98908180 TGGGGGAGGGAGAAGGCCCAGGG + Intronic
1132563657 16:610653-610675 TGGGGGACGGCGCAGGGGCAGGG - Intronic
1133051664 16:3120444-3120466 TGAGGCATGGCGATGGGGGAGGG + Exonic
1133347364 16:5079840-5079862 TGGGGGATGGCGGAGGGGGAGGG + Intronic
1133369892 16:5239577-5239599 TGGGGCGGGGAGGAGGTGCACGG + Intergenic
1133619691 16:7514429-7514451 TGGACCATGGAGATGGGACAGGG + Intronic
1134028224 16:10970946-10970968 TGGGGCATGTAGAAAGGGACAGG - Intronic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134136143 16:11677534-11677556 TGCGGCAGGGAGCCGGGGCAGGG + Exonic
1134712775 16:16336180-16336202 TGGGGGACTGAGAAGGGGGAGGG + Intergenic
1134954052 16:18372513-18372535 TGGGGGACTGAGAAGGGGGAGGG - Intergenic
1135522942 16:23191213-23191235 TGGGGCATGGAGAGGGAGAGTGG - Intronic
1135745694 16:25014922-25014944 CGGGGCAGGGACAATGGGCAGGG + Intronic
1135879255 16:26238305-26238327 TGGGGCATAGAGAACAGGAAAGG - Intergenic
1136269427 16:29139708-29139730 TGGGGCGTGGAGCCAGGGCACGG + Intergenic
1136411902 16:30082615-30082637 TGGGGCGTGGAGTGGGGGCAAGG + Intronic
1136777652 16:32880279-32880301 TGGGTCATGCAGCAGGGGCTGGG + Intergenic
1136892972 16:33981235-33981257 TGGGTCATGCAGCAGGGGCTGGG - Intergenic
1137460912 16:48662489-48662511 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1137519582 16:49180521-49180543 TGGGGCGGGGAGAGGGGGAAGGG + Intergenic
1137577819 16:49615214-49615236 TGAGGCGTGGAGAGGGTGCAGGG + Intronic
1137591536 16:49696853-49696875 TGGGGCCTGGAGAGGAGACAGGG - Intronic
1137708142 16:50549046-50549068 GGGGGCAGGAAGAGGGGGCAGGG - Intronic
1138191567 16:55017776-55017798 GGGGGCATGGCTAAGGGGAATGG + Intergenic
1138294203 16:55872857-55872879 TGGAGCATGGAGAGGGGTGATGG - Intronic
1138458017 16:57132447-57132469 TGGGGCATGGAGAAAGCCCAAGG - Intronic
1138547266 16:57727416-57727438 TGGGGCCTGGAGAAGGGATTGGG - Intronic
1138552394 16:57754814-57754836 GGGGGGATGGAGCAGGAGCATGG - Intronic
1138800945 16:60028460-60028482 TGGAGCATGGTGAAAGGTCATGG - Intergenic
1138891913 16:61154038-61154060 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1139285938 16:65814083-65814105 TGGAGCATGGTGAAGAGGGAAGG + Intergenic
1139491249 16:67287184-67287206 TGTGGCGTGAAGGAGGGGCATGG - Intronic
1139543502 16:67636638-67636660 TGGGGCAAGGAGAAGGGTGGTGG - Intronic
1139680543 16:68558509-68558531 TGGAGCAAGGAGAAGAGCCATGG + Exonic
1139955296 16:70690300-70690322 TGGGGCAGGGAGAGCGGGCCTGG - Intronic
1140002467 16:71039525-71039547 TGGGGCATGGGGTGGGGCCATGG - Intronic
1140034799 16:71364029-71364051 TGGGGGAGGGAGCAGAGGCAGGG - Intronic
1140681213 16:77386576-77386598 TGAGGGATGCAGAAGGGGTAGGG - Intronic
1140714036 16:77705946-77705968 TGGGGCATAGAGATGTGGGAAGG - Intergenic
1141173234 16:81704215-81704237 GGGGGCAGGGAGGAGGGGGAGGG - Intronic
1141173317 16:81704420-81704442 GGGGGCAGGGAGGAGGGGGAGGG - Intronic
1141570223 16:84929597-84929619 AGGGGCATGGAGAGGAGGAAGGG + Intergenic
1141590600 16:85066256-85066278 TGGGGAATGGAGAAGGGAGAGGG + Intronic
1141617699 16:85219746-85219768 TGTGGCTTGCAGAAGGGGGAAGG - Intergenic
1141919887 16:87128610-87128632 TGGTGAATGGGGAAGGGCCAGGG - Intronic
1142072905 16:88100978-88101000 TGGGGCGTGGAGCCGGGGCACGG + Intronic
1203080068 16_KI270728v1_random:1142388-1142410 TGGGTCATGCAGCAGGGGCTGGG + Intergenic
1142704086 17:1683471-1683493 TGGGACAGGGAGAAGGGAAAAGG + Intronic
1142990873 17:3730043-3730065 TGGGGCCTGTGGGAGGGGCAGGG - Intronic
1142994065 17:3750706-3750728 TGAGGCATGGGGAAAGAGCAGGG + Intronic
1143383934 17:6515036-6515058 AGGGGCTGGGAGAAGGGGAATGG + Intronic
1143410412 17:6705062-6705084 TGGGGGTAGGAGCAGGGGCAGGG + Intronic
1143444357 17:6998646-6998668 TGGGGCCAGGGGCAGGGGCAGGG - Intronic
1143473997 17:7192678-7192700 TGGGGCAAGGAGAAGGGAGTGGG + Intronic
1143571316 17:7760391-7760413 TGGGGAAGGGAGCAGGGGCTTGG + Intronic
1143576468 17:7796669-7796691 TGGGCCAAGCAGAAGGGGCAAGG - Intronic
1143597347 17:7923218-7923240 TGGGTCACTGAGAAAGGGCATGG + Intronic
1144657016 17:17043087-17043109 TGGGGCATGGGGACGGGGACGGG + Intronic
1144725243 17:17498564-17498586 TGGGGCATTCAGAATGGGAATGG - Intergenic
1144795515 17:17888705-17888727 TGGGGCATGGGGAGGGGGGCTGG + Intronic
1145879871 17:28345145-28345167 ACAGGCATGGAGAAGGGCCAAGG - Exonic
1145933654 17:28702808-28702830 TGGGGCAGGGACAAAGGGCCAGG - Intergenic
1145999524 17:29122887-29122909 GGCGGCATGGAGAAGGAGCAGGG - Intronic
1146063910 17:29620992-29621014 TGGTGCATGGAGAGGTGGGAGGG + Intronic
1146266958 17:31459148-31459170 TGGGGAATTGACACGGGGCAGGG - Intronic
1146518335 17:33507037-33507059 TGGGGCAGGGTCAAGGGGCCGGG + Intronic
1147215955 17:38899070-38899092 GTGGGCATGGAGAGTGGGCAGGG + Intronic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1147854889 17:43472160-43472182 TGGGGCATGCAGAGAGTGCAGGG + Intergenic
1147945210 17:44076945-44076967 TGGGGGATGGGGATGGGGCCAGG - Exonic
1147965763 17:44193484-44193506 TGGGTCAGGGAGGAGAGGCAGGG + Exonic
1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG + Intronic
1148541348 17:48483155-48483177 TGGGGCCTGGGGACAGGGCACGG - Intergenic
1148870892 17:50658333-50658355 TGGGGCTTGGAGCAGGAACAAGG + Intronic
1148876047 17:50687776-50687798 TGGGGCATCAGGAATGGGCAGGG + Intronic
1148966165 17:51437862-51437884 AGGGAGATGGAGAAGGGGAAAGG + Intergenic
1148985017 17:51613459-51613481 AGGGGGAGGGAGAGGGGGCAAGG - Intergenic
1149620345 17:58040089-58040111 TGGGGCAGGGAGAAGGGACCTGG + Intergenic
1149657725 17:58319116-58319138 TGGGGAATGGAGCAGCAGCAGGG + Exonic
1150649458 17:67000514-67000536 TGGAGCCAGGAGAGGGGGCAAGG + Intronic
1150944075 17:69725066-69725088 TGGGCCATGGAGAGAAGGCATGG - Intergenic
1151107924 17:71639628-71639650 TTGGCAATGGAGAAGGAGCAAGG + Intergenic
1151143367 17:72016493-72016515 TGGGGTCTGGAGAAGGAGAAAGG + Intergenic
1151188081 17:72378663-72378685 TGGGGCCTGGAGCAGGGCAACGG + Intergenic
1151715802 17:75830484-75830506 TGGGGTGGGGAGCAGGGGCAGGG + Intronic
1151732898 17:75921601-75921623 TGGGACACGGGGACGGGGCAGGG + Intronic
1151732912 17:75921639-75921661 TGGGACATGGGGACGGGGCAGGG + Intronic
1151732925 17:75921677-75921699 TGGGACACGGGGATGGGGCAGGG + Intronic
1151732938 17:75921714-75921736 TGGGACACGGGGACGGGGCAGGG + Intronic
1151732952 17:75921752-75921774 TGGGACACGGGGATGGGGCAGGG + Intronic
1151732975 17:75921828-75921850 TGGGACACGGGGACGGGGCAGGG + Intronic
1151833813 17:76570518-76570540 TGGGGCGTGGCAGAGGGGCAAGG - Intronic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152391513 17:80006501-80006523 CGGGGGATGGGGATGGGGCAAGG + Intronic
1152614516 17:81331609-81331631 TGGGGCAGGGGGAGGGGGCCTGG + Intergenic
1152641352 17:81450574-81450596 TGGGGCAGGCAGGAGGGCCATGG - Intronic
1152755451 17:82085209-82085231 TGGGGCCTGGAGGTGGGGCAGGG + Intronic
1152863420 17:82709116-82709138 TGGGGGATGGAGCAGGGGGAGGG - Intergenic
1153528157 18:6016909-6016931 AGGGGCATGGAGAAGCAGCCAGG + Intronic
1153890088 18:9505357-9505379 TAGGGTGTGGAGAAGAGGCAGGG - Intronic
1153947554 18:10030981-10031003 TGGGGCATGGCGTAGGGGGAAGG + Intergenic
1153992777 18:10414781-10414803 AGTGGCATGGAGACGAGGCAGGG - Intergenic
1154006156 18:10528761-10528783 TGGGGCAGGGAGGTGGGGCGGGG + Intronic
1154238509 18:12629611-12629633 AGGGGCTGGGAGGAGGGGCAGGG + Intronic
1155293635 18:24365655-24365677 TGGGGCATGGGAAAGGGGAAGGG + Intronic
1155453494 18:25987179-25987201 TGGGGCAGGAAGAAGGGGGTTGG - Intergenic
1156004963 18:32429083-32429105 TGGGGGAGGGGGAACGGGCAAGG + Intronic
1156242222 18:35265593-35265615 GGGATCATGGAGAATGGGCAAGG + Intronic
1156475766 18:37404451-37404473 TGGGGCATAGACACAGGGCAGGG + Intronic
1157497831 18:48169087-48169109 TGGGGCATGGGGAGCAGGCAAGG + Intronic
1157600218 18:48889078-48889100 TGGGGAAAGGTGAGGGGGCATGG - Intergenic
1157957579 18:52115306-52115328 TAGGACATGGAGAGTGGGCAGGG + Intergenic
1158093679 18:53745877-53745899 TGGGGTATGGATAGGGGGAAGGG - Intergenic
1158915331 18:62120203-62120225 TGGGGGAAGGGGAAGGGGAAGGG + Intronic
1159053182 18:63440730-63440752 TGGGTTATGGTGAAAGGGCATGG + Intergenic
1159796927 18:72855270-72855292 TGAGGCTTGTAGAAGGGCCAGGG - Intronic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160618361 18:80151094-80151116 TCGGGCCTGGAGATGGGGGAGGG + Intronic
1160722731 19:604501-604523 GGGGTCAAGGAGCAGGGGCAGGG + Intronic
1160770395 19:828421-828443 TGGGGCTCAGAGAAGGGGCTTGG + Intronic
1160777439 19:862503-862525 CGGGGCATGGGGACGGGGCGGGG + Intronic
1160966221 19:1748108-1748130 TGGGGAATGGGGAAAGGGGAAGG - Intergenic
1161003508 19:1923216-1923238 AGGTTCATGGAGAAGGGGTAAGG - Intronic
1161225941 19:3146028-3146050 CGGAGCACGGAGAAGGGGCGGGG - Intronic
1161314374 19:3611088-3611110 TGGGGGTTGGAGAAGGGTGAGGG - Exonic
1161330981 19:3687763-3687785 GGGAGAAGGGAGAAGGGGCAAGG - Intronic
1161571974 19:5035745-5035767 TGGTGCAAGGAGAAGCAGCATGG - Intronic
1161576574 19:5057890-5057912 TGGGACATGGAGATGATGCAGGG + Intronic
1161659953 19:5539864-5539886 TTGGGCCTGGAGAAGGCTCAAGG + Intergenic
1161716730 19:5880518-5880540 TGGGGGGTGGGGAAGGGGCAGGG - Intronic
1161957893 19:7506483-7506505 GAGAGGATGGAGAAGGGGCAGGG - Intronic
1162491014 19:10991695-10991717 TGGGAAAAGGAGAAGGTGCAAGG + Intronic
1162588931 19:11578327-11578349 TGTGGGATGGAGAGAGGGCAGGG - Intronic
1163302154 19:16454653-16454675 TGGGGCATGGCACAGGGGTAAGG + Intronic
1163492144 19:17623365-17623387 CGGGGCATGGGGAGGGGGCGGGG - Intronic
1163529448 19:17841322-17841344 TGAGGCATAGAGAAGGGGAGGGG + Intronic
1163758423 19:19120402-19120424 CGGGGCCTGGGGAGGGGGCAGGG - Intronic
1164158690 19:22612296-22612318 TGGGGGATGCAGAGGGGGTAGGG - Intergenic
1164670034 19:30067194-30067216 TGGGGCCTGGAGCTGGGGAAGGG + Intergenic
1164727418 19:30475686-30475708 AAGGACATGGAGAAGGGGCTGGG - Intronic
1165057954 19:33190604-33190626 TGGGGCTTGGAGAAGGTGGCAGG + Intronic
1165652805 19:37506217-37506239 TGGGGGATGGAGAAGTGAGACGG - Intergenic
1165779816 19:38425828-38425850 TGAGGAGTGGAAAAGGGGCACGG + Intronic
1165887076 19:39085756-39085778 AGAGGGATGGAGAAGGGGCTGGG - Intronic
1165937436 19:39397873-39397895 GGGAGCAGGAAGAAGGGGCAGGG - Exonic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166196263 19:41207673-41207695 TGGAGCTGGGAGGAGGGGCAGGG + Intergenic
1166354278 19:42217723-42217745 TGGGGGAAGGAGGAGGGGCGAGG - Intronic
1166392898 19:42419711-42419733 TGGGGGATGGAGGAAGGGCCAGG + Intronic
1166835990 19:45668315-45668337 GGGGGCAGGGAGAATGGGCTGGG - Intronic
1167041060 19:47022596-47022618 CGGGGCATGGAGGAGGGGGCGGG + Intronic
1167509920 19:49890648-49890670 TGGGGCAAGGCAGAGGGGCAGGG - Intronic
1167515876 19:49922906-49922928 TGGGGCAGTGTGGAGGGGCAGGG - Intronic
1167569306 19:50276908-50276930 TGGGGCAGGGGGACAGGGCAGGG + Intronic
1167572522 19:50297979-50298001 GAGGGCATGGGGGAGGGGCATGG + Intronic
1167674697 19:50877122-50877144 TGAGGCATGGGGAGGGGGCGTGG - Intronic
1167674767 19:50877406-50877428 TGGGGCAGGGAGGAGGGGTGGGG + Intronic
1167698785 19:51030244-51030266 CGGGGAATGGAGGAGGGGGAGGG - Intronic
1167728468 19:51235332-51235354 TGAGGGCTGGAGAAAGGGCAGGG + Intronic
1167762480 19:51458230-51458252 TGGGGGTAGGAGAAGGAGCAGGG + Exonic
1168019191 19:53596255-53596277 TGGGACTTGGAGAACAGGCAAGG - Intergenic
1168431427 19:56284214-56284236 GGGGGCATTGTGAAGTGGCAAGG - Intronic
1168434416 19:56305964-56305986 TGGGGGCAGGAGAAGGGGGAGGG + Intronic
1168641003 19:58031593-58031615 AGGGGCTAGAAGAAGGGGCAAGG - Intergenic
925023225 2:588011-588033 TGGGGCTTCCAGGAGGGGCAGGG + Intergenic
925157696 2:1660183-1660205 GGAGACATGGAGAAGGGTCAGGG + Intronic
925301319 2:2815016-2815038 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
925379686 2:3416587-3416609 GAGGGCATAGTGAAGGGGCAGGG - Intronic
925420216 2:3704518-3704540 AGGGGCGTGGGGGAGGGGCATGG + Intronic
925473032 2:4183274-4183296 TGGAGCCTTGAGAAGGTGCAGGG + Intergenic
925577011 2:5370531-5370553 TGGGTCAAGGAGAAGGAGAAAGG - Intergenic
926132901 2:10316333-10316355 GGGGTCATGAAGAATGGGCAGGG - Intronic
926234497 2:11028986-11029008 TTGGGAATGGAGCAGGGGGAGGG - Intergenic
926849937 2:17185168-17185190 TGGGTAATGGAGCAGAGGCAAGG + Intergenic
927096022 2:19748111-19748133 TGAGCCATGTGGAAGGGGCAAGG + Intergenic
927239213 2:20905594-20905616 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
927270819 2:21208714-21208736 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
927547835 2:23970416-23970438 TGGGGATTGGGGATGGGGCAGGG + Intronic
927699648 2:25259723-25259745 TGGAGCCTGGAGAAGGGGTGGGG - Intronic
927846288 2:26474274-26474296 TGGGGCCTGGAGCTGGGGCCTGG - Intronic
927993552 2:27465589-27465611 TGGGGCAAGGGGAGGGGGAAGGG + Intronic
928167952 2:28984359-28984381 TGGGCCATTGGGAAGGGACAGGG + Intronic
928172594 2:29012931-29012953 TGGTGCAGGGAGAAGGATCAAGG - Intronic
929076850 2:38085327-38085349 TGGGGCACGGAGAAGAGGTTGGG + Intronic
929748345 2:44683159-44683181 TGGAGCATGGAAAGGAGGCAGGG + Intronic
929816386 2:45236301-45236323 TGGGGCATGTGGTAGGGGTAGGG + Intergenic
929857671 2:45650601-45650623 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
930002309 2:46869656-46869678 ACAGGCATGGAGTAGGGGCAAGG - Intergenic
931829251 2:66034079-66034101 TGGGCCTTGGAGAATGTGCATGG + Intergenic
932300941 2:70666679-70666701 AGGGACATGGATGAGGGGCATGG - Intronic
932343566 2:70981616-70981638 TGAGGCATAGGGAAAGGGCAGGG + Intronic
932513264 2:72317298-72317320 TTGGGGATGGGAAAGGGGCATGG - Intronic
932592860 2:73077564-73077586 TGGACCATGAAGAAAGGGCAGGG - Intronic
932777371 2:74536277-74536299 TGGGGCAGGGTGAGGTGGCATGG - Exonic
932784883 2:74591519-74591541 TGGGGGAGGGAGCAGGGGAATGG + Intronic
933260643 2:80127602-80127624 AGGGGCAGGAAGAAGGGGCTAGG - Intronic
933268724 2:80210354-80210376 TGGGGTATGGGGAGGGGGGAAGG - Intronic
933709438 2:85314816-85314838 AGGGGCTTGGAGCAGAGGCAGGG + Intergenic
933776531 2:85774409-85774431 TGGGGCAGGTAGAAAGGGCATGG - Intronic
933787417 2:85854479-85854501 TGGTTCAGGGAGAAGGGGCAGGG + Intronic
934947984 2:98555757-98555779 GAGGGCATGGTGGAGGGGCATGG - Exonic
936268891 2:111033175-111033197 TGGGACATGGAGGAGGAGCGAGG + Intronic
936373899 2:111924830-111924852 TGAGGGATGGAGAAGGTGCCTGG - Intronic
936749841 2:115628956-115628978 TGGGGTAGGGGGAAGGGGGAAGG - Intronic
936965999 2:118128109-118128131 AGGGACAGAGAGAAGGGGCAGGG - Intergenic
937554818 2:123141035-123141057 TGTGGTAGGGAGAAGGGGGAGGG - Intergenic
937614439 2:123905022-123905044 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
937642290 2:124227372-124227394 TTGGACATTTAGAAGGGGCAGGG - Intronic
937648484 2:124294038-124294060 TGGGGCTGGGAGAAAGGGTAGGG + Intronic
938236649 2:129711205-129711227 TGGGGAATGGATATGGGGAAAGG - Intergenic
938929168 2:136071116-136071138 TGGGGACTGGAGGAGGGGAAAGG + Intergenic
938969924 2:136422741-136422763 AGGGGCCTGGAGAAGGTGGAAGG + Intergenic
938995276 2:136671830-136671852 TGGGGCATGGAGAAGGGAGGGGG + Intergenic
939298080 2:140295862-140295884 TGGGGCAAAGAGAGGGAGCATGG + Intronic
940635920 2:156296478-156296500 TGGGTCATAGAGCAGGGCCAAGG + Intergenic
940718726 2:157258318-157258340 GGGGACATGGGAAAGGGGCATGG + Exonic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
941309572 2:163912365-163912387 TGGGGGGTGGGGGAGGGGCATGG - Intergenic
942616375 2:177795512-177795534 TAGGGCATGGAGAAGGGGGTGGG + Intronic
942653942 2:178195041-178195063 TGGGGATTGAAGCAGGGGCAGGG + Intronic
942823324 2:180142657-180142679 TGGGGCTGGGAGATGGGGGATGG - Intergenic
943273730 2:185841869-185841891 TGGGGTGTGGGGAGGGGGCAGGG - Intergenic
943820974 2:192320429-192320451 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
943920726 2:193705043-193705065 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
944035997 2:195295253-195295275 GGGGGCATGGGGTAGGGGGAGGG + Intergenic
944256663 2:197629445-197629467 TGGGGCAGGGGGATGGGGGAGGG + Intronic
944635192 2:201669168-201669190 TTGGGCATGGAGAAGGGGAAAGG + Intronic
944654635 2:201865353-201865375 TGGTGGATGGAGAAGGTGGAGGG - Intronic
944713869 2:202359888-202359910 TTTAGCCTGGAGAAGGGGCAGGG + Intergenic
944831444 2:203536924-203536946 GGGGGGATGGAGAGGGGGGAGGG + Intergenic
945516950 2:210774195-210774217 TGGGGTAGGGAGAGGGGGGAGGG + Intergenic
946024106 2:216661521-216661543 TTGGGCATGGGGTGGGGGCATGG + Intronic
946039103 2:216768807-216768829 TGGGCCATGAAGAAGAGGTAGGG + Intergenic
946039184 2:216769335-216769357 GGGGGCTTGGAGAGGGGCCAAGG - Intergenic
946160461 2:217832609-217832631 TGGGGAAAGCAGCAGGGGCAGGG - Intronic
946161149 2:217836825-217836847 TGGGGCAGGGAAAAGGGGGCGGG - Intronic
946172203 2:217902254-217902276 TGGGGCCTGGAGCAGGGCCTAGG - Intronic
947407154 2:229790521-229790543 GGGGGCAGGGAGCAGGGGGAGGG + Intronic
947772533 2:232682001-232682023 TGGGGAATGGTAAAGGGACAAGG - Exonic
948390460 2:237607861-237607883 TGGGGCATGGAAAAGGGGATCGG - Intergenic
948501288 2:238396915-238396937 GAGGGCATGGAGAATGTGCAGGG - Intronic
948687363 2:239677594-239677616 TGGGGCAGGGAGGCCGGGCAGGG - Intergenic
948814490 2:240502886-240502908 TGGGCCGTGGAGGTGGGGCAGGG - Intronic
948835506 2:240624288-240624310 TGGCCCATGGAGACTGGGCAGGG + Intronic
1168895747 20:1322271-1322293 TAGGACATGGAGCAGGGGCTAGG - Intronic
1169219294 20:3812133-3812155 TGGGTCATGGAGGATGAGCAGGG + Intergenic
1169333778 20:4738285-4738307 TGGGGAATGGAAAAAGGGAAGGG + Intronic
1169334931 20:4748385-4748407 TGGGGAAGGGAGAAGGGAGATGG + Intergenic
1169388927 20:5173781-5173803 TGGAGCCTGGAGCAGTGGCATGG - Intronic
1170420841 20:16191474-16191496 TGGAGGCTGGAGATGGGGCATGG - Intergenic
1170989211 20:21286838-21286860 AGGGGCCAGGAGAAGGGGCAAGG - Intergenic
1171970600 20:31562614-31562636 TGGGCCCTGGGGAAGGGGAAAGG - Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172690122 20:36784308-36784330 TGGGGCATGGAGGAGGCGGCTGG + Exonic
1172854728 20:37993196-37993218 GGAGGCATGGGGGAGGGGCAGGG - Intronic
1173163025 20:40666266-40666288 CGGGGCATGCAGTAGGGGCTCGG + Intergenic
1173163067 20:40666502-40666524 TGGGCCCTCGGGAAGGGGCACGG - Intergenic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173471077 20:43324119-43324141 TGGGGGGTGGGGAAGGGGGAGGG - Intergenic
1173476903 20:43365948-43365970 TGGGGCGTGGAGAAGGCAGAGGG - Intergenic
1173846662 20:46192898-46192920 GGGGGCATGGGGACAGGGCAGGG - Intronic
1173851400 20:46220638-46220660 TGGGGGCTGGAGCAGGGGCCTGG + Intronic
1173890398 20:46504248-46504270 TGGAGCAAGGAGAAGAGCCATGG - Exonic
1174076740 20:47942671-47942693 TGGGGCAGTGAGATGGGACAGGG + Intergenic
1174141501 20:48417361-48417383 TGGGGCAAGGAGGGTGGGCAGGG + Intergenic
1174358269 20:50012450-50012472 AGGGGCAAAGAGAAGGGCCAAGG - Intergenic
1175100616 20:56576229-56576251 GAGGGCAAGGGGAAGGGGCAGGG - Intergenic
1175126341 20:56754815-56754837 GGGGGTAGGGAGAAGGGGAAGGG - Intergenic
1175139126 20:56846823-56846845 TTGGCCTTGGAGAAGGGCCATGG - Intergenic
1175347997 20:58296527-58296549 AAGGGCTTGGAGAAGGGCCATGG + Intergenic
1175414456 20:58792645-58792667 AGGGGAATGGAGATGGGGCAAGG + Intergenic
1175439524 20:58981151-58981173 CGGGGCCTGGAGGAAGGGCAGGG - Intergenic
1175462310 20:59160602-59160624 TGGGGTCTGGAGAAGGGCCCAGG + Intergenic
1175616640 20:60405359-60405381 TTTGGAATGGAGAAGGGGGAAGG + Intergenic
1175724350 20:61307590-61307612 TGGGGCAGGTGGATGGGGCAGGG - Intronic
1175942106 20:62542191-62542213 TGGGGCATCGAGCAGAGGGACGG + Intergenic
1176108315 20:63399737-63399759 TTGGGCAGGGAGTGGGGGCAGGG + Intergenic
1176209695 20:63913066-63913088 AGGGAGATGGAGACGGGGCAGGG - Intronic
1176623222 21:9072357-9072379 TGAGGCACTGAGAAGGTGCAGGG + Intergenic
1176717388 21:10364586-10364608 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1177322096 21:19535992-19536014 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1177571633 21:22894741-22894763 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1178195661 21:30342140-30342162 TGGTGAATGGAGAAGAGGAATGG - Intergenic
1179021311 21:37643502-37643524 TGGGCCCTGAAGAATGGGCAAGG + Intronic
1179264096 21:39786958-39786980 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1179465302 21:41567862-41567884 TGGGGCTTGCAAATGGGGCAGGG - Intergenic
1179631326 21:42680327-42680349 TTGGCCATGGAGACAGGGCAGGG + Intronic
1179786831 21:43734950-43734972 TGGAGCAGGGAGGAGGGGCCTGG + Intronic
1179830258 21:43992092-43992114 TCGGGATTGGAGATGGGGCAGGG + Intergenic
1179899708 21:44383262-44383284 TGTGGCCTGGAGAATGGGCCAGG - Intronic
1179904710 21:44416472-44416494 GGGTGCATGTGGAAGGGGCAGGG - Intronic
1180240354 21:46499326-46499348 TGGTGCATGCAGTAGGTGCAGGG + Intronic
1180298612 22:11017506-11017528 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1180865136 22:19114339-19114361 TGGGGCATGGAGAGAGCCCAAGG - Intronic
1180871676 22:19150213-19150235 TGCTCGATGGAGAAGGGGCAGGG + Exonic
1181029026 22:20141167-20141189 TGGGGCTTGGATGAGGGGCAGGG - Intronic
1181183109 22:21080851-21080873 TGGGGCAGGGACAATGGGCCCGG + Intergenic
1181431569 22:22884788-22884810 TGGGGGATGGAGACTGGGCAGGG + Intronic
1181514226 22:23402183-23402205 TGGGGCTTGGATGATGGGCAAGG + Intergenic
1181531734 22:23521129-23521151 TGGGCTGTGGGGAAGGGGCAAGG - Intergenic
1181543105 22:23584391-23584413 TGGGGCATAGAGAGTGGGCAGGG - Intergenic
1181637767 22:24182196-24182218 TGGGGGATGGGGAAGGGCCAGGG + Intronic
1181832440 22:25571998-25572020 TGGGGCGGGGGGAAGGGGTAGGG - Intronic
1181967316 22:26666349-26666371 TGGGGCATCAGGAAAGGGCAGGG + Intergenic
1181978762 22:26751532-26751554 TGGGGGAGGGGGAAGGAGCAGGG + Intergenic
1182207074 22:28639362-28639384 TGGTGAATGGAGAGGGGGTAAGG - Intronic
1182331372 22:29553627-29553649 TGGGGCTGGGAGATGGGGCGGGG - Intronic
1182420899 22:30248107-30248129 GGGGGCATGGAGGATGGGCGAGG - Intergenic
1182433207 22:30312969-30312991 AGGAGCATGTAGAAGGGGCTAGG + Intronic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182543007 22:31055401-31055423 TGGGGCTTGGAGATGGAACAAGG - Intergenic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1182927567 22:34139934-34139956 TGAGACAAGGAGAAGGGGCCGGG + Intergenic
1183674188 22:39290688-39290710 TGGGGAAAGGAGCAGGGTCATGG - Intergenic
1183736233 22:39646383-39646405 TGAAGCAAGGAGGAGGGGCAGGG - Intronic
1184265599 22:43344141-43344163 CGGGGCCAGGAGGAGGGGCAGGG + Intergenic
1184346877 22:43918936-43918958 AGGGGCTGGGGGAAGGGGCATGG + Intergenic
1184348356 22:43926459-43926481 TGGGGCATGGAGGTGGGGCATGG + Intronic
1184411486 22:44328837-44328859 TGGGGGATGGAGCAGGGCCAGGG - Intergenic
1184506388 22:44906356-44906378 AGGGGCAGGGAGACGGGCCAGGG + Intronic
1184507823 22:44914700-44914722 TGGTGGATGGGGAAGGGGAAGGG + Intronic
1184647446 22:45903781-45903803 GGGGGCAGCGAGAAGGGGCCGGG + Intergenic
1185127256 22:49018092-49018114 TGGGGCATGGGGGTGGGGCATGG - Intergenic
1185127263 22:49018105-49018127 TGGGGCATGGGGGTGGGGCATGG - Intergenic
1185215519 22:49597942-49597964 TGGGGATGGGGGAAGGGGCATGG - Intronic
1185294208 22:50045434-50045456 TGGGGACTGGAGATGGGGCCAGG + Intronic
1185326540 22:50228372-50228394 AGGGGCATGGCAAAGGGGCTGGG + Intronic
1185359486 22:50397004-50397026 TGGGGCAAGGAGAGTGGGGAGGG + Intronic
1185372246 22:50466308-50466330 AGGGGCCAGGAGAAGGGGCTGGG + Intronic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
950396303 3:12736725-12736747 TGGGGAATGCACAAGGGGGATGG - Intronic
951345149 3:21538751-21538773 TGGGGCATGGAGGGGGGAAAGGG + Intronic
951589555 3:24248640-24248662 TGGGGCATGAAAAAGGAGAAAGG - Intronic
952144630 3:30518397-30518419 TGGGCCATGGAGATGAGGCACGG - Intergenic
952580924 3:34832523-34832545 TGAGGAAAGGAGAAGGGGCAGGG + Intergenic
952699686 3:36312767-36312789 TGGGGCAAGGAGAAGGTTAAGGG - Intergenic
952741475 3:36738542-36738564 TCAGCCTTGGAGAAGGGGCACGG + Exonic
953034997 3:39203548-39203570 TGGGAGTGGGAGAAGGGGCAGGG + Intergenic
953075713 3:39568576-39568598 GGTGGCAAGGAGAAGAGGCAGGG + Intergenic
953168033 3:40482627-40482649 TGGAGCAAGGAGAAGCAGCATGG + Exonic
953462867 3:43095522-43095544 CCTGGCATGGAGCAGGGGCAAGG - Intronic
953979091 3:47404847-47404869 TGCAGCAAGGAGAAGGGGGAAGG - Intronic
954136070 3:48582730-48582752 TGGGGGCTGGAGAGGGGTCAGGG + Intronic
954202177 3:49030161-49030183 TGGGGCCTGGGGAAAGGGCTTGG - Exonic
954844793 3:53546052-53546074 TGGGGGAAGGAGAAGTGACAAGG + Intronic
955113289 3:55971602-55971624 TGGGGTATGAAGAAGGGGGCTGG + Intronic
955357440 3:58242862-58242884 TGGGGCAGGGGGATGGGGGAGGG - Intronic
956049755 3:65235360-65235382 TGGAGGATGGAGAAGGGGAGGGG - Intergenic
956661870 3:71606864-71606886 CGGAGCAGGGAGCAGGGGCAGGG + Intergenic
956738042 3:72253858-72253880 AGGGGCATGGATAAGGGGAAGGG - Intergenic
957073027 3:75580487-75580509 TGGGGCGGGGAGGAGGTGCAAGG - Intergenic
957383882 3:79470410-79470432 TGGGGCATGGGGAGGGAGGAGGG + Intronic
957617498 3:82550093-82550115 TGGAGCATGGAGAAGTGACCAGG - Intergenic
957644330 3:82901571-82901593 TGGGGTGGGGGGAAGGGGCAGGG - Intergenic
958069563 3:88592841-88592863 TGGGGCATGTAGGAAGGGAATGG + Intergenic
959182532 3:102999997-103000019 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
959747399 3:109792699-109792721 TGGGGAGTGGAGTAGGGGAAAGG + Intergenic
960024025 3:112988195-112988217 TGGGGCAGGGAAGTGGGGCAGGG - Intergenic
960571762 3:119191596-119191618 TGGGGTGTGGAGTAGGAGCAGGG - Intronic
960694568 3:120383449-120383471 GGAGGCAGAGAGAAGGGGCAGGG + Intergenic
960694571 3:120383462-120383484 AGGGGCAGGGAGGAGAGGCAAGG + Intergenic
961281057 3:125766290-125766312 TGGGGCGGGGAGGAGGTGCAGGG + Intergenic
961302714 3:125932595-125932617 TGGGGGATGGTGGAGGGGGAGGG - Intronic
961495293 3:127287177-127287199 TGGGAGATTGAGAAGGAGCATGG + Intergenic
961659326 3:128460118-128460140 TGGGGCAAGGTGATGTGGCATGG - Intergenic
961885194 3:130092291-130092313 TGGGGCATGCAGGACTGGCAGGG - Intronic
961885351 3:130093193-130093215 TGGGGGATGGTGGAGGGGGAGGG + Intronic
962081431 3:132143061-132143083 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
963033013 3:140997641-140997663 TGGGGCCTGTTGGAGGGGCAGGG - Intergenic
963037820 3:141047826-141047848 TGTGGCAGGGAGAAAGAGCATGG + Intergenic
963239514 3:142989239-142989261 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
964433953 3:156633034-156633056 TGGGGCATAGAGAAGTCACACGG + Intergenic
964628370 3:158781334-158781356 TGGAGTATGGAGAAGAGCCAGGG - Intronic
964790359 3:160449352-160449374 TGGAGCTTTGAGAAGGGGAAGGG - Intronic
965969131 3:174532174-174532196 TGGGGGAAGGAGAAGGGGAAGGG + Intronic
966598180 3:181746651-181746673 TGGGGCTTGAAGAATGGGTAGGG + Intergenic
967643989 3:191899903-191899925 AGAGACATGGAGAAGGGGTAGGG + Intergenic
967803912 3:193696464-193696486 TGGGGCATGGAGAGGGCGTCAGG - Exonic
968392565 4:205306-205328 TGGGGCTTGGGCTAGGGGCACGG + Intergenic
968504225 4:964543-964565 TGGAACATGGAGACAGGGCAGGG - Intronic
968514509 4:1010587-1010609 TGGGGGATGGAGGAGGTGCTGGG + Intronic
968534181 4:1113209-1113231 GGGCGCGTGGAGAAGGGGGAGGG - Intronic
968562982 4:1294802-1294824 TGGGGCCGGGGGCAGGGGCAGGG + Intronic
968698041 4:2042228-2042250 TGGGGCTTGGACAAGGGTCGTGG + Intronic
968759251 4:2433577-2433599 CTGGGCATGGAGAGGGGGCTCGG - Intronic
969016631 4:4107784-4107806 TGGGGCAGGGAGGAGGTGCAGGG - Intergenic
969099240 4:4756562-4756584 TGGGGCTTAGATGAGGGGCATGG - Intergenic
969439355 4:7208183-7208205 TGGGACATGCAGAAGGGGCTTGG + Intronic
969796529 4:9532119-9532141 TGGGGCGGGGAGGAGGTGCAGGG + Intergenic
969982104 4:11168312-11168334 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
970791476 4:19862943-19862965 TGGGGCAGGGGGAGGGGGGAGGG - Intergenic
970915118 4:21323392-21323414 TGGGGCTGGGAGAATGGGGATGG - Intronic
971400001 4:26267251-26267273 TGGGGCTTGGAGATGGGACAAGG + Intronic
971487998 4:27180984-27181006 GGTGGCATGGAGAAGGGGAATGG + Intergenic
971748635 4:30617430-30617452 GGGGTCATGGTGAAGGGTCAAGG + Intergenic
973652652 4:53012059-53012081 TGGGGCAGGGAGTAGGGGGATGG - Intronic
974000739 4:56508281-56508303 AAGGGAATGGAGAAGAGGCAGGG + Intronic
974349766 4:60730149-60730171 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
975122755 4:70746886-70746908 TTGAGGATGGAGTAGGGGCAAGG + Intronic
975252459 4:72196207-72196229 TGGGGTAGGGAGAGGGGGGAGGG - Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975469073 4:74743927-74743949 GGGAGCATGGAGAGGGAGCAGGG - Intergenic
976299442 4:83504171-83504193 TGGGGCTGGGGGCAGGGGCAGGG + Intronic
976607934 4:86999990-87000012 TGGGGCATGTCAAAGGGGCAAGG + Intronic
977091447 4:92681540-92681562 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
977306440 4:95328987-95329009 TGGGACATGGAACAGGGGTATGG - Intronic
977363381 4:96034782-96034804 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
977478520 4:97542974-97542996 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
977627250 4:99200743-99200765 TGGGGCACAGAGAAGTGGTAAGG + Intergenic
977772012 4:100870893-100870915 TGGGTCACAGAGAAGTGGCATGG + Intronic
978303393 4:107294970-107294992 AGAGACATGGAGAAGGGGGATGG + Intergenic
978695421 4:111571087-111571109 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
978709343 4:111759117-111759139 TGGGGCAGGGGCAAGGGGGAGGG + Intergenic
978744736 4:112179558-112179580 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
979423065 4:120530528-120530550 TGGGGTGTGGGGAGGGGGCAGGG - Intergenic
979798487 4:124876707-124876729 AGAGACACGGAGAAGGGGCAGGG + Intergenic
979934819 4:126678861-126678883 TGAGCCATGGAGAATGGGGATGG - Intergenic
980281993 4:130734716-130734738 TGGGGCAGGGGGAGGGGGGAGGG + Intergenic
980653173 4:135747932-135747954 TGGGGCAGGGGGAGGGGGGAGGG - Intergenic
980857709 4:138460008-138460030 TGGGGAGGGGAGAAGGGGGAGGG - Intergenic
981438127 4:144750129-144750151 TGGGGAAGGGAGAGGGGGAAGGG + Intergenic
982084116 4:151817099-151817121 AGAGACATGGAGAAGGGGTAGGG + Intergenic
983315411 4:166126881-166126903 TGGGGTATGGGGAGGGGGGAGGG - Intergenic
983409396 4:167377766-167377788 TGGGAGATGGAGAAGCGGCATGG + Intergenic
983440473 4:167777346-167777368 TGGGGTAGGGGGAAGGGGGAAGG - Intergenic
983557537 4:169071745-169071767 TCGGCCATGAAGAAGGGCCATGG - Intergenic
984386650 4:179068340-179068362 TGGGGCTTGGAGAAGGGGGATGG - Intergenic
984608309 4:181809863-181809885 TCTGGAATGGAGAAGAGGCAGGG + Intergenic
984716836 4:182933813-182933835 TGATGCAGGGAGAGGGGGCAAGG - Intergenic
984911440 4:184676935-184676957 GGGGGAAGGGAGAAGGGGAAGGG - Intronic
985567070 5:624387-624409 TGGGGCATCTACACGGGGCAGGG - Intronic
985825625 5:2188805-2188827 TGGGGTATGGGGAGGGAGCAAGG + Intergenic
986525270 5:8666999-8667021 TGAGCCAAGGAGAATGGGCAAGG + Intergenic
986598542 5:9448446-9448468 TGGGGTAGGCAGAAGGGGCGGGG - Intronic
987331299 5:16859879-16859901 TGGGGCCTGAAGGAAGGGCACGG - Intronic
987447647 5:18040687-18040709 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
987561577 5:19530574-19530596 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
988172794 5:27681385-27681407 TGGGGCCTGGAGAAGGGTGGGGG + Intergenic
988434915 5:31163007-31163029 TGGGGGATCGAGTTGGGGCAGGG + Intergenic
989272912 5:39553643-39553665 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
989282874 5:39665356-39665378 TGGCGAATGGAGTAGGGGTAGGG - Intergenic
989823045 5:45818606-45818628 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
990829086 5:59936211-59936233 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
991501524 5:67282006-67282028 GGGGGAACGGAGAAGGGGGAAGG - Intergenic
992068788 5:73130552-73130574 TGGGCCTTGGAGCAGGGGCCAGG + Intronic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992300427 5:75372983-75373005 TGAAGCATGGAGATGAGGCAAGG - Exonic
992783345 5:80147677-80147699 TGTGGGAGGGAGAAGGGGAAGGG - Intronic
993810548 5:92470731-92470753 GGAGGTATGGAGAAGGGGCATGG + Intergenic
993879557 5:93346846-93346868 TGGGGTCAGGAGAAGGGGGAGGG - Intergenic
995276015 5:110278806-110278828 TGGGGTATGGGGAGGGGGGAGGG - Intergenic
995395080 5:111678738-111678760 TGGAGCACAGAGAAGGGGCTAGG - Intronic
995582375 5:113615458-113615480 AGGGGCATGCAAGAGGGGCAAGG + Intergenic
996542023 5:124640397-124640419 TGGTGGGTGGGGAAGGGGCAGGG - Intronic
996599565 5:125245820-125245842 TGGGGCATTCAGGAGGGCCAGGG + Intergenic
996819861 5:127614547-127614569 TGGGGTAGGGGGAAGGGGGACGG + Intergenic
997198373 5:131994647-131994669 TGGGGTGTGGAGAAGAGGGAAGG + Intronic
997203730 5:132028582-132028604 TGAGGGATGGTGGAGGGGCATGG + Intergenic
997512537 5:134463423-134463445 TGGGGGAAGGAGATAGGGCAAGG + Intergenic
997526420 5:134555921-134555943 GGGGGCACGGAGAAGGGGAAGGG - Intronic
997654592 5:135545626-135545648 TGGGGACTGGAGAAGGGGAATGG + Intergenic
997689196 5:135814206-135814228 TGGAGCATGGAAAAGGCCCAGGG - Intergenic
997702448 5:135912243-135912265 TGGAGCTTGGTGAATGGGCAAGG + Intergenic
997724363 5:136107920-136107942 TGGGCCATGGAGCAGTGTCATGG + Intergenic
997879865 5:137579915-137579937 TGGGCCATGGTGAAGAGGCTGGG + Intronic
997884585 5:137618661-137618683 TGTGGCATGGAGAAGCCTCAGGG - Exonic
998149823 5:139750568-139750590 TGGGGCCTGCAGAAAAGGCAGGG + Intergenic
998172929 5:139883021-139883043 TGGGTCCTGGCTAAGGGGCAGGG + Intronic
998370244 5:141656121-141656143 TGGGGCAGTCAGAAAGGGCAGGG + Intronic
998454864 5:142264082-142264104 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
998819896 5:146049002-146049024 GGGGGCATGGAGTGGGGGAATGG - Intronic
999056993 5:148588412-148588434 TGGGGAATGGAGAAGAACCAGGG + Intronic
999103063 5:149043321-149043343 TGGGCATTGGAGGAGGGGCAGGG - Intronic
999150138 5:149421362-149421384 TGAGGGATGGAGAATGGGCCTGG - Intergenic
999238608 5:150114611-150114633 GGGGGCCTGGGGAAGGGGCATGG + Exonic
999266000 5:150267224-150267246 TGGGACGTGGAGCAGGGGGAGGG - Intronic
1000146342 5:158456846-158456868 TGTGGCATGGATGAGGGTCAGGG + Intergenic
1000153415 5:158526420-158526442 TGGGGCATGAAGAAGAGGAAGGG + Intergenic
1000252849 5:159511564-159511586 TGGTGAGTGGAGAAGGAGCATGG - Intergenic
1001064953 5:168529188-168529210 CGGGAGATGGGGAAGGGGCAGGG + Exonic
1001295105 5:170493767-170493789 TGGGGCATGGGGAGAGGGCCAGG - Intronic
1001334645 5:170787456-170787478 TGGGGCATGGCCCAGGGGCCCGG - Intronic
1001489775 5:172147166-172147188 TGAGGCTGGGGGAAGGGGCAAGG + Intronic
1001689195 5:173619955-173619977 TGGGGCTTGGAGCAGGCCCAAGG + Intergenic
1001695557 5:173667370-173667392 TGGGGCCTGGAGCAGGTGGAAGG - Intergenic
1001723652 5:173877656-173877678 TGCAGCATGGAGAAGGGCCAGGG + Intergenic
1001881788 5:175251018-175251040 GGTGGCATGGAGGAGGGGCAGGG - Intergenic
1002045410 5:176538686-176538708 TGGGCCATGGGGCAGGGGGATGG + Intergenic
1002046793 5:176545999-176546021 AAGGGCAGGGAGAGGGGGCAGGG + Intronic
1002449761 5:179311980-179312002 GGGAGGAGGGAGAAGGGGCATGG + Intronic
1002575023 5:180169743-180169765 TGGGGCTACGAGAAGGGCCAGGG - Intronic
1002601754 5:180357574-180357596 TGGGGCCTGAGAAAGGGGCAGGG + Intergenic
1002603852 5:180370538-180370560 TGGGGCTTAGAGAAGGAGCTGGG + Intergenic
1003340390 6:5214562-5214584 TGTGGGGTGGAGTAGGGGCAGGG + Intronic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1004899674 6:20182656-20182678 GGGGGCAGGAGGAAGGGGCAAGG - Intronic
1005789265 6:29279437-29279459 TGGGGTGTGGTGAGGGGGCAGGG + Intergenic
1006059690 6:31410964-31410986 GGAGGCATGGAGGAGGGCCAGGG + Intronic
1006072180 6:31506035-31506057 GGAGGCATGGAGGAGGGCCAGGG + Intronic
1006377201 6:33678197-33678219 TGGGGCAAGGTGAAGTGTCACGG - Intronic
1006627113 6:35405327-35405349 TGGGGCATGGGGGAAGGGCAAGG - Intronic
1006669166 6:35718963-35718985 GAGGGCCTGGAGGAGGGGCAGGG + Intronic
1007339891 6:41184570-41184592 TGGGGTAGGGAGAAGGGGGAGGG + Intergenic
1007483343 6:42164209-42164231 TGGGGCATGGAAGAGGGGGATGG + Intronic
1007807450 6:44461076-44461098 GGGGGAATGTAGAAAGGGCAGGG + Intergenic
1008328773 6:50220199-50220221 TGGGGCATAGGAGAGGGGCAGGG - Intergenic
1008763436 6:54881904-54881926 TGCGGCAGGGGGAAGGGGGAGGG - Intronic
1008824461 6:55676521-55676543 AGGGCCATGGAGAAGGGGTGAGG - Intergenic
1008877028 6:56340359-56340381 TGGGGCAGGGACTTGGGGCAAGG + Intronic
1008935515 6:56987664-56987686 TGGTGCATGGAGGAGGAGCCTGG - Intronic
1009795483 6:68461691-68461713 TGGGGTTGGGAGAAGGGGGAGGG - Intergenic
1009842620 6:69095396-69095418 GGGGGCAGGGGGCAGGGGCATGG + Intronic
1010190138 6:73186932-73186954 TGGGGTAGGGAGCAGGGGGAGGG - Intronic
1010351772 6:74883425-74883447 TGGGGCAGGGGGAGGGGGGAGGG - Intergenic
1010354083 6:74909757-74909779 TGGGGCAGGGGGAGGGGGGAGGG + Intergenic
1010359931 6:74981128-74981150 GGGGGCAGGTAGAAGGGGAAGGG + Intergenic
1010633779 6:78231700-78231722 TGGGGCAGGGGGAGGGGGGAGGG - Intergenic
1011446342 6:87445361-87445383 TGGGGCTTGCTGGAGGGGCAAGG - Intronic
1011713473 6:90079266-90079288 TGGAGGAGGGAGAAGGGACAAGG - Intronic
1012506274 6:99949853-99949875 TGGGAAATGGAGAGGGGACAGGG + Intronic
1012971390 6:105735530-105735552 AGGGGCATGGAGAAGAAACATGG + Intergenic
1013273161 6:108560789-108560811 CGGGGCGGGGAGAAGGGGGAGGG - Intronic
1013637083 6:112039199-112039221 TTGGTAATGGAGAAAGGGCAGGG - Intergenic
1013652215 6:112207030-112207052 TGGGGCAGGGGACAGGGGCACGG + Exonic
1014218166 6:118773543-118773565 TGGGGTCAGGAGCAGGGGCAAGG - Intergenic
1015791332 6:136967397-136967419 TGGGGCATGCAGAAGGAAAAGGG + Intergenic
1016066581 6:139689099-139689121 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1016356798 6:143227367-143227389 AGGGGCACGGGGCAGGGGCACGG - Intronic
1016384373 6:143516240-143516262 GGTGGCATGGAGTAGGGGCGGGG - Intergenic
1017829279 6:158111017-158111039 TGGTGCATCCAGGAGGGGCACGG - Exonic
1017913919 6:158818309-158818331 GCGGGCATGGGGAGGGGGCACGG + Intronic
1018102998 6:160457798-160457820 TGGGGCTCAGAGAAGGTGCAGGG - Intergenic
1018746274 6:166764578-166764600 TGGGGCAAGGAGCAGGGGGTTGG + Intronic
1019396688 7:823783-823805 GCGGGAATGGAGAGGGGGCATGG + Intronic
1020123419 7:5518663-5518685 TGGGGGGAGGAGAAGGGGAAGGG - Intergenic
1020287637 7:6697376-6697398 TGGAGCAAGGAGAAGAGCCATGG - Exonic
1020318822 7:6925743-6925765 TGGGGGATGGTGGAGGGGGAGGG + Intergenic
1021040567 7:15857102-15857124 TGTGGCATAGTGAAGAGGCAGGG + Intergenic
1021058945 7:16085700-16085722 TTGGGGATGGAGATGGGGAAAGG + Intergenic
1021093482 7:16509767-16509789 TGGGGCCTGGTGAAGGGGGAAGG - Intronic
1021620846 7:22549979-22550001 TGGGGGATGGAGAGGGGCGATGG + Intronic
1022590207 7:31654335-31654357 TGGGGCATGGAGATGGAGGGAGG + Intronic
1022591395 7:31667060-31667082 AGGGACATGGATACGGGGCAGGG + Intergenic
1022616904 7:31940878-31940900 AGGGACCTGGAGATGGGGCAAGG - Intronic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1022931267 7:35117294-35117316 TGGGGCAGGGGGACGGGGGAGGG + Intergenic
1023519901 7:41039656-41039678 TGGGGCCTGGGGATGGGGAAAGG - Intergenic
1023908914 7:44540431-44540453 AAGGACATGGAGCAGGGGCAGGG + Intronic
1024529206 7:50376820-50376842 AGTGGCCTGGAGAAGGTGCATGG + Intronic
1024632432 7:51260980-51261002 TGGGCAATGGAGAAGGGGTATGG - Intronic
1024971766 7:55078172-55078194 TGGGGAGGGGAGAAGGAGCAAGG + Intronic
1025035256 7:55589651-55589673 AGTGGCATGGAGCAGGGTCAGGG - Intergenic
1025059999 7:55797947-55797969 TTGGGCCTGGAGAAGGGGAGTGG - Intronic
1025258910 7:57404224-57404246 CGGGGCGAGGAGAAGGGGCGGGG + Intergenic
1026256207 7:68714157-68714179 TGGGGGGTGGAGTAGGGGGAGGG - Intergenic
1026479339 7:70764825-70764847 TTGGGCAGGGAGAGGGGGAACGG - Exonic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026741560 7:72981865-72981887 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026801394 7:73402249-73402271 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026875585 7:73877288-73877310 TGGGGCAGGGGGCAGAGGCAGGG + Intergenic
1027102175 7:75383213-75383235 AAGGGGAGGGAGAAGGGGCAGGG - Intergenic
1027235453 7:76295063-76295085 TGGGCAATGAAGAAGGGGAAGGG + Intergenic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1028306244 7:89269204-89269226 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1028427981 7:90712300-90712322 AGGGGCAGGGGGAAGGGGAATGG - Intronic
1028493339 7:91438450-91438472 TGATCAATGGAGAAGGGGCAGGG + Intergenic
1029075106 7:97928584-97928606 TGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1029118823 7:98252577-98252599 TGGGGCGTGGAGAGGACGCAGGG + Intronic
1029257478 7:99279396-99279418 TGGGGGTTGGACAAGGGGCTGGG - Intergenic
1029450891 7:100641337-100641359 GGGGGCGTGGGGGAGGGGCAGGG + Intronic
1029536971 7:101162872-101162894 AGGGGCAGGGCCAAGGGGCAGGG + Exonic
1029677531 7:102080662-102080684 GGGGGCGTGGAGAGGGCGCAGGG - Intronic
1030726563 7:112933024-112933046 TGGGGGAAGGAAGAGGGGCAGGG + Intronic
1031381808 7:121095205-121095227 TGGGCTATGGAGAAGGGGGATGG + Intronic
1031586350 7:123535154-123535176 AGCGGCAGGGAGAAGGGGCGGGG + Intergenic
1031805374 7:126301142-126301164 AGGGGCTGGGAGAAGGGACAAGG - Intergenic
1032290780 7:130588646-130588668 TGGGGCAGGGGGAGGGGGAAGGG + Intronic
1032413777 7:131720399-131720421 TGGGGCATGGAAAAAGGGGTGGG + Intergenic
1032435492 7:131897330-131897352 GGGGGCCTGGAGATGAGGCAGGG - Intergenic
1032478743 7:132229803-132229825 TGGGGCAAGGAGATGAGGGAAGG + Intronic
1033116788 7:138632574-138632596 TGGGGGATGGAGAAGGTGGAGGG + Intronic
1033152393 7:138926653-138926675 TGGAACATGGAGAAGGGGAAAGG - Intronic
1033217176 7:139501509-139501531 TGGGGGAGGGAGAAGGGCAAGGG + Intergenic
1033411966 7:141126300-141126322 TGGGGCCTGGAGGAGGTGAATGG + Intronic
1033526938 7:142225547-142225569 TGGAGCATGGAGCATGGGCAAGG + Intergenic
1033631260 7:143160354-143160376 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1033633132 7:143181155-143181177 TGGGGTGTGGGGAGGGGGCAGGG + Intergenic
1033757365 7:144405929-144405951 TGGGGATAGGAGTAGGGGCAAGG + Intronic
1033973892 7:147075772-147075794 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1033990909 7:147285713-147285735 TGGGACATGGAGAAGAGGCAAGG + Intronic
1034349279 7:150405782-150405804 GGGGGCGGGGAGAAGGGGCGCGG + Intronic
1034421521 7:150993480-150993502 TGGGGCATTGGGGAGTGGCAGGG - Intronic
1034531280 7:151697664-151697686 GGGGGCACAGAGAATGGGCACGG + Intronic
1035400846 7:158564610-158564632 TGGGGCATGAAGGGTGGGCAGGG - Intronic
1035476882 7:159149995-159150017 GGGAGCATGGAGAAGGGGAGAGG + Intergenic
1035895378 8:3393839-3393861 TGGGGTGTGGGGAGGGGGCAGGG + Intronic
1035905774 8:3508357-3508379 TGGGGCAGGGGGAGGGGGGAGGG + Intronic
1035966920 8:4202876-4202898 GGTGTCCTGGAGAAGGGGCATGG + Intronic
1036025261 8:4900470-4900492 TGGGCCAGGGTGAAGGGGAAGGG - Intronic
1036242425 8:7091794-7091816 TGGGGCGGGGAGGAGGTGCAGGG + Intergenic
1036502059 8:9323221-9323243 TGGGGCCTGGAGGAGAGGGATGG - Intergenic
1036621015 8:10424591-10424613 AGGGACAGGGAGAAGGGGCCAGG + Intronic
1036688111 8:10925005-10925027 TGAGGCATGGGGGAGGGGCGGGG + Intronic
1036830312 8:12015337-12015359 TGGGGCGGGGAGGAGGTGCAGGG - Intronic
1036899392 8:12659636-12659658 TGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1036900459 8:12665783-12665805 TGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1037817243 8:22118748-22118770 TGGGGCTCAGAGAAGGGGCAGGG - Intronic
1037890700 8:22622485-22622507 TTGGGCAGGGAGTGGGGGCAGGG - Intronic
1038301492 8:26354366-26354388 TGGGGTATTGAGAATGTGCAGGG + Intronic
1038486519 8:27939237-27939259 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1039127627 8:34220915-34220937 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1040007314 8:42631369-42631391 TGGTGCAGGGAGAAGGGGAGTGG - Intergenic
1040311213 8:46237801-46237823 TGTGGCATGGGCAAGTGGCAGGG + Intergenic
1040341764 8:46444647-46444669 GGTGGCATGGACAAGTGGCAGGG - Intergenic
1040904620 8:52453647-52453669 TGGGGAGTGGAGATGGGGGAAGG - Intronic
1040983123 8:53266253-53266275 TGGGGAGTGGGGAAGGGGAAAGG - Intergenic
1041029737 8:53724584-53724606 TGGGGCGGGGAGGAGGGGGAGGG - Intronic
1041281831 8:56218223-56218245 TTGGGCAGGGAAAAGGGTCAGGG + Exonic
1043046494 8:75330071-75330093 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1043859580 8:85300288-85300310 TGGGGTATGGGGTAGGGGAAGGG + Intergenic
1044607844 8:94062575-94062597 TGGGGGAGGGAGGTGGGGCAAGG - Intergenic
1044632534 8:94293189-94293211 GGGAGCAGGGAGCAGGGGCAAGG + Intergenic
1044781104 8:95744321-95744343 TGGGGCATGGAGGAGGTCCTGGG + Intergenic
1044812360 8:96076401-96076423 TGGGGTAGGGGGAAGGGGGAAGG + Intergenic
1045178552 8:99754887-99754909 TGTGGCAGGGAGTGGGGGCATGG - Intronic
1045478296 8:102572085-102572107 TGGGGCATGTCAAAGGGACATGG + Intergenic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1045789722 8:105968339-105968361 TGGGGCAGGGGGAGGGGGGAGGG + Intergenic
1045969637 8:108065021-108065043 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
1046094941 8:109546446-109546468 TGAGGCAGGGAGAAGTGGGAAGG - Intronic
1046318399 8:112537019-112537041 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1047322552 8:123801677-123801699 TGGGGCAAGGAGAAGGGCTTAGG + Intronic
1047725434 8:127679964-127679986 TGGGGAAGGGAGAAAGGGGAAGG + Intergenic
1048079715 8:131112257-131112279 TGGGGGATGGAGATGGTTCATGG - Intergenic
1048288649 8:133163003-133163025 TGGGCCACGGAGATGGGGAAGGG - Intergenic
1048308912 8:133303276-133303298 AGGGGCAGGAAGAAGGGGAACGG - Intergenic
1048528504 8:135226396-135226418 TGAGATATGGAGTAGGGGCAAGG + Intergenic
1048614947 8:136063937-136063959 TGGGGTAGGGAGATGGGGGAGGG - Intergenic
1048628166 8:136210019-136210041 TGGTGCAAGGAGAAGGGGGTTGG - Intergenic
1049154230 8:141057092-141057114 TGGGGCAGAGAGAAGGGGGTGGG - Intergenic
1049180561 8:141219908-141219930 AGGGGCATGCGGAGGGGGCACGG + Intronic
1049222099 8:141432901-141432923 AGGGGCATGGAGGCGGGGCCTGG + Intergenic
1049408965 8:142464077-142464099 GGGGGCAGGGAGGCGGGGCAAGG - Exonic
1049675591 8:143887531-143887553 TGGGGCCTGGAGCAGTGCCAGGG + Intergenic
1049684840 8:143935148-143935170 TGGGGCAGGCAGCAGGGGAAGGG + Intronic
1049791160 8:144473311-144473333 TGGGGCATGGAGGACTGCCAGGG - Exonic
1049851960 8:144837430-144837452 TGGAGCAGGGAGAAGAGCCATGG + Exonic
1049934165 9:484724-484746 TGGGGTATGGAGAGGGAACACGG + Intronic
1050021152 9:1285784-1285806 TGTGCAATGGAGAAGGGCCAAGG - Intergenic
1050609077 9:7332415-7332437 TGGGGTATGGAGAAAGAGTATGG + Intergenic
1050697745 9:8298075-8298097 TGGGACATTGAGCAGGAGCAAGG - Intergenic
1050766564 9:9141856-9141878 TGGGGCATGAAGGTGGGCCATGG + Intronic
1051600041 9:18863409-18863431 TGGGGAATGGAAAATGGGCTTGG + Intronic
1052091219 9:24329886-24329908 TGGGGAATTGGGAAGGGGAAAGG + Intergenic
1052703998 9:31972013-31972035 CTGGGCATGGAGGAGGGTCAGGG - Intergenic
1052859272 9:33426900-33426922 TTGGGCATGGGGCAGGGGCAGGG + Intergenic
1052885584 9:33644658-33644680 TGGGGGATGGAGTGGGGGGAGGG + Intergenic
1052997253 9:34557781-34557803 TGGGGTATGGACAGAGGGCATGG + Intronic
1053139521 9:35674001-35674023 TGAGGCCTGGAGCAGGGGCCGGG - Exonic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053285255 9:36846067-36846089 TGGGACATGAAGTAGAGGCATGG - Intronic
1053303022 9:36965059-36965081 TGGAGCAAGGAGAAGGGGTGTGG - Intronic
1053672245 9:40378096-40378118 TGGGGCAGGGGGAGGGGGCAGGG + Intergenic
1053792622 9:41697573-41697595 TGGGTAAGGTAGAAGGGGCAGGG - Intergenic
1054181036 9:61909594-61909616 TGGGTAAGGTAGAAGGGGCAGGG - Intergenic
1054383356 9:64518130-64518152 TGGGGCAGGGGGAGGGGGCAGGG + Intergenic
1054472329 9:65548395-65548417 TGGGTAAGGTAGAAGGGGCAGGG + Intergenic
1054512379 9:65998214-65998236 TGGGGCAGGGGGAGGGGGCAGGG - Intergenic
1054656555 9:67671548-67671570 TGGGTAAGGTAGAAGGGGCAGGG + Intergenic
1055271295 9:74562584-74562606 TGGGTCATGGTGAAGGAGTAGGG - Intronic
1055362178 9:75504201-75504223 TGGGGCAGGGAGAAAAGGCAGGG - Intergenic
1055606610 9:77977231-77977253 TGGAGTGTGGAGAAGGGCCAGGG - Intronic
1055675392 9:78653926-78653948 TGGGGTGTGGAGAGGGGGGAGGG + Intergenic
1055981695 9:82009916-82009938 TGGGGAACGGAGAAGCAGCAGGG + Intergenic
1056096005 9:83254115-83254137 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1056591565 9:87969351-87969373 TGGGCCAGGGAGAAGGAACAGGG + Intronic
1056832721 9:89929810-89929832 TGGGGAAGGGAGCAGGGGCTGGG + Intergenic
1056832729 9:89929829-89929851 TGGGGAAGGGAGCAGGGGCTGGG + Intergenic
1057051478 9:91927473-91927495 TGGTGAATGGAGGTGGGGCATGG - Intronic
1057138287 9:92710531-92710553 GGGGTCCTGGGGAAGGGGCATGG + Intergenic
1057573192 9:96219355-96219377 CGCGTCCTGGAGAAGGGGCACGG + Intergenic
1057748779 9:97773230-97773252 TGGAGCCTGGGGGAGGGGCAAGG - Intergenic
1057907812 9:98995634-98995656 TGGGCCTTGGAGAATGAGCAGGG - Intronic
1057967406 9:99517679-99517701 AGGGGCTTGGAGAAGAGGGAGGG - Intergenic
1059582950 9:115572211-115572233 TTGGGCAGGGGGAGGGGGCAGGG - Intergenic
1059977990 9:119738273-119738295 TGTGGTAAGGAGAAGGGGAATGG - Intergenic
1060163935 9:121392976-121392998 TGGGGGAAGGGGAAGGGGAAGGG + Intergenic
1060183209 9:121547913-121547935 TGGAGAAGGGAGATGGGGCAGGG - Intergenic
1060341770 9:122783594-122783616 TGGGGCTTGGACCAGGGACATGG + Intergenic
1060739374 9:126088199-126088221 TGTGGCATGGATCAGGAGCAGGG - Intergenic
1060973511 9:127752397-127752419 TGGGGCCTGGAGGTGGGGGAAGG - Intronic
1060994985 9:127870805-127870827 CGGGGCATGGGAATGGGGCATGG + Intronic
1060994990 9:127870818-127870840 TGGGGCATGGGAATGGGGCATGG + Intronic
1061042631 9:128148869-128148891 TGGGGCAAGGAGAGGGGCAAGGG + Intergenic
1061139113 9:128753635-128753657 TGGGGCCGGGGGAAGGGGCAAGG - Intronic
1061181471 9:129027516-129027538 TGGGGGATGGAGAGAGGGCTGGG - Intronic
1061942671 9:133891734-133891756 GGAGGCATGGAGGAGAGGCAGGG + Intronic
1062033288 9:134371676-134371698 TGGGGTATGGAGGACGGGCCTGG + Intronic
1062136354 9:134930404-134930426 TTAGGCATGGAGGAGAGGCAGGG - Intergenic
1062143736 9:134976726-134976748 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1062246940 9:135573947-135573969 TGGGGAATAGAGAAATGGCAGGG + Intergenic
1062270739 9:135707235-135707257 TGGGGGAATGAGCAGGGGCATGG + Intronic
1062338773 9:136084269-136084291 TGGGGCATGCAGTAGGGGAGGGG - Intronic
1062399065 9:136364554-136364576 TGCGTCCTGGAGAAGGGGGAAGG + Exonic
1062510918 9:136905427-136905449 TGGGGGCTGGAGCAGGGGAATGG + Intronic
1062534591 9:137015873-137015895 TGGGACAGGGAGGTGGGGCATGG + Intronic
1062564524 9:137158263-137158285 AGGAGCAGGGAGAAGGAGCAGGG + Intronic
1185459800 X:328813-328835 GGGGGCAGGGAGGGGGGGCAGGG - Intergenic
1185860417 X:3573500-3573522 TGGGGAAGGGAGAGGAGGCAGGG + Intergenic
1185926938 X:4157543-4157565 TGGTGCAAGGTGAAGGTGCAAGG - Intergenic
1186075956 X:5879181-5879203 AGGGGCATGGATAAGAGGAACGG + Intronic
1187541950 X:20205566-20205588 TGGGGCATGGTGAAAGGGGGTGG - Intronic
1187635465 X:21223098-21223120 TGGGGTGTGGAGAGGGGGGAGGG + Intergenic
1187682980 X:21786642-21786664 TGGGGAAGTGAGAAAGGGCAGGG - Intergenic
1188122513 X:26326617-26326639 TGGGGGATGGGGAATGGGAATGG - Intergenic
1188841585 X:35024162-35024184 TAGGTCCTGGAGAAGGGACAAGG + Intergenic
1189113559 X:38320278-38320300 CGGGGCAAGGGGCAGGGGCAGGG + Intronic
1189436581 X:40998174-40998196 TGGGGCACGGACAGGGGCCAGGG + Intergenic
1189551904 X:42101982-42102004 TGGGGCATGGGGGAGGGGTGGGG + Intergenic
1190092994 X:47455958-47455980 TGGAGCAAGGAGAGGGGCCATGG - Exonic
1190146475 X:47895881-47895903 TGGAGCAAGGAGAGGGGCCATGG + Exonic
1190222582 X:48521922-48521944 TGGGGGAGGGAGCAGGGGCCGGG - Intronic
1190282545 X:48940558-48940580 TGGGCCATGGGGGAGTGGCAAGG - Intronic
1191757566 X:64610359-64610381 TGGGGTAGGGAGAGGGGGGAGGG - Intergenic
1191767346 X:64712673-64712695 TGGGGCAGGGGGAGGGGGAAGGG - Intergenic
1192321260 X:70092392-70092414 TGGGGTAGGGAGAAGTGGGAAGG + Intergenic
1193316951 X:80076010-80076032 TGGGGTTGGGAGAAGGGGGAGGG + Intergenic
1193632586 X:83908564-83908586 TGGGGTAGGGGGAGGGGGCAGGG - Intergenic
1194998990 X:100623884-100623906 TGGGGTGTGGGGAAGGGGGAGGG - Intergenic
1195343479 X:103926550-103926572 TGGAGCAGGGAGAAGGGGCTAGG + Intronic
1195363489 X:104106769-104106791 TGGAGCAGGGAGAAGGGGCTAGG - Intronic
1195405847 X:104512418-104512440 TGGGGCCTGGTGAAGGGTCGGGG - Intergenic
1195450277 X:105003781-105003803 TGGGGCCTGGAGGTGGGGAATGG - Intronic
1195889137 X:109672291-109672313 TGGGGAGGGGAGAGGGGGCAGGG + Intronic
1196165371 X:112531729-112531751 TGGGGCATGGAAAAAAGGGATGG - Intergenic
1196171787 X:112596118-112596140 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1196198401 X:112858878-112858900 AGGGGAATGGGGAAGGGGAAAGG - Intergenic
1197034175 X:121854304-121854326 TGTGGCAGGGAGAGAGGGCATGG - Intergenic
1197373953 X:125659269-125659291 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1197638444 X:128942193-128942215 TGGGCCTTGGAGAAGGGACAGGG + Intergenic
1197659682 X:129156749-129156771 TGGGGTAGGGAGAGGGGGGAGGG - Intergenic
1197849153 X:130838519-130838541 TTAGGAATGGAGAAGGGGAAGGG - Intronic
1198553101 X:137765072-137765094 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1199013645 X:142786251-142786273 TGGGGCAGGGGGAGGGGGGAGGG - Intergenic
1199080736 X:143574332-143574354 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1199286385 X:146059173-146059195 TGGAGCATGGGGAAGAGGGATGG + Intergenic
1199351722 X:146809939-146809961 TGGGGCAAAGAGAAGGGGTTTGG - Intergenic
1199352185 X:146814554-146814576 TGGGGCAAAGAGAAGGGGTTTGG + Intergenic
1199469096 X:148173559-148173581 TGGGGTATGGGGAGGGGGGAGGG + Intergenic
1199722343 X:150550907-150550929 TGGGCCATGCAGAAGGGCCAGGG + Intergenic
1199767520 X:150952130-150952152 TAGGGCAGGGGGCAGGGGCAGGG + Intergenic
1199929354 X:152502947-152502969 TGGGGTGGGGGGAAGGGGCAGGG + Intergenic
1200225019 X:154412412-154412434 TTGGGCATGGAGCAGGACCAAGG + Intronic
1200675850 Y:6145742-6145764 TGTGGGTTGGGGAAGGGGCAAGG - Intergenic
1200804823 Y:7422489-7422511 TGGGGAAGGGAGAGGGGGCAGGG - Intergenic
1200889273 Y:8305839-8305861 TGGGGCGGGGGGAAGGGGGAGGG - Intergenic
1201283414 Y:12360034-12360056 TGGGGCCTGGAGGTGGGGCCGGG - Intergenic
1201288815 Y:12402419-12402441 TGGGGCGGGGAGAGGGGGGAGGG - Intergenic
1201519293 Y:14854872-14854894 AGGGGCATGGATAAGAGGAATGG - Intergenic