ID: 950217599

View in Genome Browser
Species Human (GRCh38)
Location 3:11170431-11170453
Sequence CACACCCCACACTGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 567}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950217592_950217599 27 Left 950217592 3:11170381-11170403 CCAGCTTTGGATAAGCTCGCCAC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 950217599 3:11170431-11170453 CACACCCCACACTGGGCAGTGGG 0: 1
1: 0
2: 2
3: 48
4: 567
950217593_950217599 8 Left 950217593 3:11170400-11170422 CCACATGTTTATTTGTGCACCTA 0: 1
1: 0
2: 2
3: 14
4: 187
Right 950217599 3:11170431-11170453 CACACCCCACACTGGGCAGTGGG 0: 1
1: 0
2: 2
3: 48
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950217599 Original CRISPR CACACCCCACACTGGGCAGT GGG Intronic
900171075 1:1269145-1269167 CACACCCGAGACTGGGGAGAGGG + Intronic
900171097 1:1269224-1269246 CACACCCGAGACTGGGGAGAGGG + Intronic
900171118 1:1269303-1269325 CACACCCGAGACTGGGGAGAGGG + Intronic
900499481 1:2994237-2994259 CACACCCAACACACAGCAGTGGG - Intergenic
900607267 1:3529398-3529420 CAAGCCCCACACGGGGCAGGGGG + Intronic
902018619 1:13328281-13328303 CACATCCCAGACAGGGCGGTGGG - Intergenic
902801146 1:18831015-18831037 CACACCCCACAGATGGCAGTGGG + Intergenic
903163040 1:21502963-21502985 CACTTCCCAGACTGGGCAGCCGG + Intergenic
903287871 1:22288224-22288246 TCCACCCCACACTGGCCACTGGG + Intergenic
903519386 1:23935628-23935650 CACATCCCAGACGGGGCGGTGGG - Intergenic
903638017 1:24834173-24834195 CACATCCCAGACAGGGCGGTGGG + Intronic
904000464 1:27335789-27335811 CTCTCCCCATACTGGGCACTGGG - Exonic
904041843 1:27589965-27589987 CCCAGCCCACAGTGGGCACTAGG - Intronic
904532031 1:31176415-31176437 CACATCCCAGACGGGGCAGCGGG - Intergenic
905362810 1:37431934-37431956 CACACCACACACAGGGCTGAGGG + Intergenic
905993886 1:42364307-42364329 CACAGCCCACACTAAGGAGTGGG - Intergenic
906038978 1:42772141-42772163 CAGACACCACACTAGGCACTGGG - Intronic
906355998 1:45106338-45106360 CACATCCCAGACGGGGCAGCCGG - Intronic
906370300 1:45247960-45247982 CACTTCCCAGACTGGGCAGCCGG - Intronic
907140535 1:52181729-52181751 CACATCCCAGACGGGGCAGCGGG - Intronic
907897154 1:58702610-58702632 CACACCCCACACCCTGCACTGGG + Intergenic
907897212 1:58703112-58703134 CACACCCCACCCTGAGTAGCTGG - Intergenic
910406992 1:86899937-86899959 CACATCCCACACGGGGCGGCGGG + Intronic
911534034 1:99078842-99078864 CACATCCCAAACGGGGCAGCGGG + Intergenic
911534062 1:99078958-99078980 CACTTCCCAGACTGGGCAGCCGG + Intergenic
911602105 1:99857317-99857339 CACTTCCCAGACTGGGCAGCCGG + Intronic
912223899 1:107709205-107709227 CACCCTCCACACAGGTCAGTGGG - Intronic
912303001 1:108536283-108536305 CACATCCCAGACGGGGCAGCAGG + Intergenic
912569285 1:110609547-110609569 CCCACACCACACTGTGCAGGTGG + Intronic
912844100 1:113063882-113063904 CACTTCCCAGACTGGGCAGCCGG + Intergenic
914230916 1:145764443-145764465 CACATCCCAGACAGGGCGGTGGG - Intronic
914953984 1:152145027-152145049 CACATCCCAGACGGGGCAGCAGG + Intergenic
914987381 1:152472243-152472265 CACATCCCAGACGGGGCAGCGGG + Intergenic
915112749 1:153575080-153575102 CACATCCCAAACGGGGCGGTGGG - Intergenic
915328361 1:155092950-155092972 CAGACCCCACACAGGGCAAGGGG + Intergenic
915502308 1:156327894-156327916 CACATCCCAGACGGGGCGGTGGG - Intronic
916131700 1:161616870-161616892 CACTTCCCAGACTGGGCAGCCGG + Intronic
916800084 1:168208116-168208138 CACTTCCCAGACTGGGCAGCCGG + Intergenic
916864079 1:168837243-168837265 CACTTCCCAGACTGGGCAGCGGG - Intergenic
917126695 1:171694075-171694097 CACATCCCAGACGGGGCAGCAGG + Intergenic
917126721 1:171694191-171694213 CACTTCCCAGACTGGGCAGCCGG + Intergenic
918701850 1:187616583-187616605 CACATCCCAGACGGGGCAGCCGG - Intergenic
919625289 1:199904689-199904711 CACATCCCAGACGGGGCAGCGGG + Intergenic
919793228 1:201305716-201305738 CCCACCCTATACTGGGAAGTTGG - Intronic
920192654 1:204203386-204203408 CCCAGCCCACACTGCGCAGAAGG + Intronic
920263701 1:204706819-204706841 CACACCCCAACCTGGGGAGAAGG + Intergenic
920649029 1:207823184-207823206 CACACCCCACCCTGGCCACTCGG + Intergenic
920915862 1:210257559-210257581 CACAACCCTCTCTGGGCCGTGGG - Intergenic
921902817 1:220466868-220466890 CACATCCCAGACGGGGCGGTGGG + Intergenic
924765950 1:247032211-247032233 CACATCCCAGACGGGGCAGCGGG - Intergenic
924800756 1:247328616-247328638 CACACCCCATACTGTGCACTGGG - Intronic
924824077 1:247521870-247521892 CACTTCCCAGACTGGGCAGCCGG - Intronic
924824102 1:247521986-247522008 CACATCCCAGACGGGGCAGCGGG - Intronic
924943688 1:248830260-248830282 CACACCCCAGACGGGGCGGTGGG - Intergenic
1064109146 10:12523174-12523196 CACATCCCAGACGGGGCGGTGGG + Intronic
1064384404 10:14878302-14878324 CACACCCCACACCAACCAGTCGG + Intergenic
1065055271 10:21837401-21837423 CACTTCCCAGACTGGGCAGCCGG - Intronic
1065055297 10:21837517-21837539 CACATCCCAGACGGGGCAGTGGG - Intronic
1065594448 10:27296843-27296865 CACATCCCAGACGGGGCAGTGGG + Intergenic
1066085285 10:31969727-31969749 CACATCCCAGACAGGGCGGTGGG - Intergenic
1066325300 10:34352835-34352857 CACTTCCCAGACTGGGCAGCCGG - Intronic
1066390850 10:34976446-34976468 CACTTCCCAGACTGGGCAGCTGG - Intergenic
1067034101 10:42900275-42900297 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1067128942 10:43544035-43544057 CACTCCCCAGACGGGGCAGCCGG - Intergenic
1067479513 10:46585785-46585807 CACACCCTACCCTGGGCTGCTGG + Intronic
1067615225 10:47756013-47756035 CACACCCTACCCTGGGCTGCTGG - Intergenic
1067912035 10:50355763-50355785 CACTTCCCAGACTGGGCAGCCGG - Intronic
1069405179 10:68091428-68091450 CACACTCCAGCCTGGGCAATAGG - Intergenic
1069674715 10:70239166-70239188 CACATCCCAGACGGGGCAGCCGG + Intergenic
1069674863 10:70239699-70239721 CACATCCCAGACGGGGCAGCCGG + Intergenic
1069929034 10:71869910-71869932 CACATCCCAGACGGGGCAGCAGG + Intergenic
1069996019 10:72342611-72342633 CACACCCCGCCCAGGCCAGTGGG + Intronic
1070138337 10:73715573-73715595 CACATCCCAGACGGGGCAGCCGG + Intergenic
1070291984 10:75123201-75123223 CCCACCCCACCCTGTGCAGGGGG + Intronic
1070629730 10:78076172-78076194 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1070963500 10:80515642-80515664 CCCACCCCACACAGGGCAATCGG - Intronic
1071225166 10:83520583-83520605 CACATCCCAGACGGGGCAGCTGG - Intergenic
1071289792 10:84180592-84180614 CACTTCCCAGACTGGGCAGCCGG + Intronic
1071311544 10:84347958-84347980 CACTTCCCAGACTGGGCAGCCGG + Intronic
1071509167 10:86250579-86250601 CACCTCCCAGACTGGGCAGCTGG - Intronic
1071630626 10:87215964-87215986 CACACCCTACCCTGGGCTGCTGG - Intergenic
1072122929 10:92420085-92420107 CGCACCCCACAGTGAGCAGCTGG + Intergenic
1072684653 10:97529113-97529135 CACATCCCAGACGGGGCAGCGGG + Intronic
1073238165 10:102035894-102035916 CACTTCCCAGACTGGGCAGCTGG - Intronic
1073274918 10:102301770-102301792 CACTTCCCAGACTGGGCAGCTGG + Intronic
1073800726 10:107038673-107038695 CACCCCCAACCCTGGGCAGGGGG + Intronic
1075051032 10:119182549-119182571 CACATCCCAGACGGGGCGGTGGG + Intergenic
1075147480 10:119894520-119894542 CACACACCATTCTAGGCAGTGGG - Intronic
1075728582 10:124623177-124623199 CAGCCCCCACTCTGGGCACTAGG - Exonic
1077040206 11:517523-517545 CACTTCCCAGACGGGGCAGTCGG - Intergenic
1077131799 11:976663-976685 CACGCCCCACCCTGAACAGTGGG - Intronic
1077222621 11:1424304-1424326 CACCCCCCACATGAGGCAGTAGG - Intronic
1078016012 11:7615462-7615484 TACACCACACACTGAGCAGAGGG + Intronic
1078143407 11:8707525-8707547 CACAGCCCACCCTGGGCCCTAGG - Intronic
1078337288 11:10474344-10474366 GACAGACCACACAGGGCAGTGGG + Intronic
1079479341 11:20863613-20863635 CACCTCCCAGACTGGGCAGCCGG + Intronic
1081278271 11:41177907-41177929 CACCCCTCACACTTGGCTGTGGG - Intronic
1081323508 11:41718569-41718591 CACCCACCACACTTGGCAGAGGG + Intergenic
1081840513 11:46197808-46197830 CACACCACACTCTGGGCAGCAGG - Intergenic
1083091258 11:60201500-60201522 CACATCCCAGACAGGGCGGTGGG + Intronic
1083120733 11:60510093-60510115 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1083734541 11:64671916-64671938 CACATCCTACCCAGGGCAGTGGG + Intronic
1084206628 11:67598358-67598380 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1084338473 11:68475968-68475990 CACTTCCCAGACTGGGCAGCCGG + Intronic
1084672634 11:70616307-70616329 GCGACCCCACACTGGGCTGTCGG + Intronic
1084674215 11:70624733-70624755 GACACCCCACAGTGTGCAGGAGG + Intronic
1084711163 11:70844545-70844567 CACTCCCCACACTGAGCACCTGG + Intronic
1084815065 11:71640826-71640848 CAACCCCAAGACTGGGCAGTGGG - Intergenic
1084839177 11:71831316-71831338 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1084955179 11:72687413-72687435 CACACCCCACACTCTGCACCTGG + Intronic
1085073699 11:73571898-73571920 CACATCCCAGACGGGGCGGTGGG - Intronic
1085397736 11:76215539-76215561 CATACCCTACCCTGGGCAGTGGG - Intergenic
1085443380 11:76582696-76582718 CACATCCCAGACGGGGCAGCGGG + Intergenic
1085454714 11:76659299-76659321 CACACCCTGCTCTGGGCACTGGG - Exonic
1085480828 11:76821416-76821438 CACATCCCAGACGGGGCAGTGGG - Intergenic
1085646766 11:78229018-78229040 ACCACCCCTCACTGGGCAGGTGG - Intronic
1085862725 11:80253545-80253567 CACAGCCCACACTAGGGAATCGG - Intergenic
1086306536 11:85486235-85486257 AGCAGCCCACACAGGGCAGTGGG - Intronic
1086434894 11:86770973-86770995 CACCTCCCAGACTGGGCAGCCGG + Intergenic
1087487038 11:98770184-98770206 CACATCCCAGATGGGGCAGTGGG + Intergenic
1089148392 11:116346893-116346915 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1089510196 11:118991907-118991929 CACATCCCAGACGGGGCAGTGGG + Intergenic
1089510221 11:118992023-118992045 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1089520462 11:119059435-119059457 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1090152848 11:124403618-124403640 CACTTCCCAGACTGGGCAGCTGG + Intergenic
1090240965 11:125181581-125181603 CCCAGCCCTCACTGGGCAGCTGG - Intronic
1090432146 11:126655056-126655078 CTCACCCCACTGTGGGCAGGTGG + Intronic
1091172248 11:133529464-133529486 CACACCCAAGACAGGGCAGAGGG - Intronic
1091378535 12:41901-41923 CACATCCCAGACAGGGCGGTGGG - Intergenic
1091586161 12:1818090-1818112 CACATCCCAGACGGGGCGGTGGG - Intronic
1092185485 12:6475610-6475632 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1092185562 12:6475922-6475944 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1093038448 12:14354563-14354585 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1094492587 12:30970266-30970288 CAGCCCCCAGACTGGGCATTAGG - Intronic
1094717007 12:33023057-33023079 CACATCCCAAACGGGGCAGCGGG + Intergenic
1095113963 12:38330778-38330800 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1096041496 12:48520853-48520875 CACTTCCCAGACTGGGCAGCCGG + Intronic
1096181985 12:49556122-49556144 CACACACCACACAGTGGAGTGGG - Intronic
1096231086 12:49897328-49897350 TCCACCCCACACTGGACAGAGGG + Intronic
1096584268 12:52609390-52609412 CGCACCCCACACTTGCCAGATGG + Intronic
1096756296 12:53802649-53802671 CACAGCCCACACTGGGCACTGGG + Intergenic
1096856712 12:54488632-54488654 CACATCCCAGACGGGGCGGTGGG + Intergenic
1097037666 12:56134355-56134377 TTCCTCCCACACTGGGCAGTTGG - Exonic
1097089620 12:56494716-56494738 CACATCCCAGACGGGGCAGCCGG + Intergenic
1097138449 12:56879226-56879248 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1097152977 12:56993415-56993437 CACAAGCCACACTTGGCAGATGG - Intergenic
1097181910 12:57176483-57176505 CACTGTACACACTGGGCAGTGGG + Intronic
1097254725 12:57664961-57664983 CACATCCCAGACGGGGCAGCCGG - Intergenic
1097779517 12:63686764-63686786 CACATCCCAGACAGGGCATTGGG - Intergenic
1097899516 12:64858831-64858853 CACTCCCCACACTGTGCTCTAGG - Intronic
1100570795 12:95841728-95841750 CACATCCCAGACAGGGCGGTGGG + Intergenic
1100620870 12:96271455-96271477 CACACGCGCCACTGGGGAGTGGG - Intergenic
1101170657 12:102089386-102089408 CACATCCCAGACGGGGCAGCCGG + Intronic
1101885123 12:108655870-108655892 CACTTCCCAGACTGGGCAGCCGG - Intronic
1102268228 12:111507154-111507176 CACTTCCCAGACTGGGCAGCCGG - Intronic
1102268255 12:111507270-111507292 CACATCCCAGACGGGGCAGCGGG - Intronic
1102628567 12:114256505-114256527 CATACCACAAACTGGGCAATAGG + Intergenic
1102923308 12:116808861-116808883 CACCCCCAGCACTGGGCCGTTGG + Intronic
1103040570 12:117691824-117691846 CCCTCCCCACACTGGGTACTGGG + Intronic
1103414115 12:120732611-120732633 CACATCCCAGACGGGGCAGTGGG + Intronic
1103414142 12:120732727-120732749 CACTTCCCAGACTGGGCAGCCGG + Intronic
1104773465 12:131379086-131379108 TACCCCCGAGACTGGGCAGTGGG + Intergenic
1104856028 12:131902911-131902933 CACAAGCTACCCTGGGCAGTGGG - Intronic
1105267676 13:18836750-18836772 CACATCCCAGACCGGGCAGCCGG + Intergenic
1105267765 13:18837086-18837108 CACATCCCAGACAGGGCAGCTGG + Intergenic
1105633998 13:22199644-22199666 TACAGCCCACACTGACCAGTAGG - Intergenic
1105927455 13:25019966-25019988 CACATCCCAGACGGGGCAGCCGG + Intergenic
1105980610 13:25513307-25513329 CACATCCCAGACGGGGCGGTGGG + Intronic
1107042784 13:35966994-35967016 CACTTCCCAGACTGGGCAGCCGG - Intronic
1107562662 13:41571954-41571976 CACATCCCAGACTGGGCGGCCGG - Intronic
1107812716 13:44215685-44215707 CTAACCCCACACTGGGGAGTTGG + Intergenic
1108348085 13:49565505-49565527 CACTTCCCAGACTGGGCAGCCGG - Intronic
1108370266 13:49761729-49761751 CACTTCCCAGACTGGGCAGCCGG - Intronic
1108501922 13:51077796-51077818 CACATCCCAGACGGGGCGGTGGG - Intergenic
1108661875 13:52595244-52595266 CCCACACCACACTGGGGAGGAGG - Intergenic
1111014457 13:82359939-82359961 CACACCTCACACTTAGCAGATGG + Intergenic
1112000763 13:95207660-95207682 CAGTCCCCACGCTTGGCAGTTGG - Intronic
1112070616 13:95845930-95845952 CACTTCCCAGACTGGGCAGCCGG + Intronic
1112431688 13:99355792-99355814 CTCACCCCACTCTGTGCAGGGGG + Intronic
1114336629 14:21697779-21697801 CACATCCCAGACTGGGCGGCCGG - Intergenic
1115547387 14:34475951-34475973 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1115622389 14:35152896-35152918 CACTTCCCAGACTGGGCAGCCGG + Intronic
1116005432 14:39285950-39285972 CACTTCCCAGACTGGGCAGCCGG + Intronic
1116039063 14:39663611-39663633 CACACCCCACACTGGGCATATGG - Intergenic
1116409055 14:44601267-44601289 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1117747694 14:58887681-58887703 CTGACCCTACACTGGGCAGTGGG - Intergenic
1118209412 14:63751563-63751585 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1118256329 14:64209130-64209152 CACACCCCACACAGGACAGCTGG - Intronic
1118341290 14:64896033-64896055 CACATCCCAGACAGGGCGGTGGG + Intergenic
1118430846 14:65717434-65717456 CACATCCCAGACAGGGCAGCTGG + Intronic
1118890287 14:69903108-69903130 CACTTCCCAGACTGGGCAGCCGG - Intronic
1118901455 14:69989736-69989758 CAGGCCCCACACTGGGCACTGGG - Intronic
1118918984 14:70132822-70132844 CACAGCCCACCCTAGGCACTTGG + Intronic
1119722089 14:76898374-76898396 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1120406636 14:84099805-84099827 CACATCCCAGACGGGGCAGCGGG + Intergenic
1120745499 14:88147472-88147494 GAGACCCCACTCTGGTCAGTGGG - Intergenic
1120847582 14:89139546-89139568 CTCAGCCAACACTGGGCAGTAGG + Intronic
1120961165 14:90126252-90126274 CACAGCCCACACTTAGGAGTGGG - Intronic
1122328109 14:100894880-100894902 CACTGCCCCCAGTGGGCAGTGGG + Intergenic
1122885175 14:104707599-104707621 TAGCCCCCACACTGGGCAGGGGG - Exonic
1122893051 14:104741872-104741894 CACACCGCCCACGGTGCAGTTGG - Exonic
1123047246 14:105524990-105525012 CACGTCCCACACTGGCCACTGGG - Intergenic
1123429756 15:20204286-20204308 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1123918429 15:25054153-25054175 GACACCACAGGCTGGGCAGTGGG - Intergenic
1123918881 15:25056810-25056832 GACACCACAGGCTGGGCAGTGGG - Intergenic
1123919320 15:25059488-25059510 GACACCACAGGCTGGGCAGTAGG - Intergenic
1123920681 15:25067738-25067760 GACACCACAGGCTGGGCAGTGGG - Intergenic
1123921094 15:25070382-25070404 GACACCACAGGCTGGGCAGTGGG - Intergenic
1125862764 15:43014528-43014550 CACATCCCAGACGGGGCGGTGGG - Intronic
1125929277 15:43588987-43589009 CACACTCCACACTGGGCTAAAGG + Intronic
1125942444 15:43688819-43688841 CACACTCCACACTGGGCTAAAGG + Intergenic
1126023913 15:44427705-44427727 GACACCACACATTGCGCAGTCGG + Exonic
1126571561 15:50158245-50158267 CACTTCCCAGACTGGGCAGCCGG - Intronic
1127088434 15:55445835-55445857 CACATCCCAGACGGGGCAGCCGG + Intronic
1127088836 15:55447281-55447303 CACATCCCAGACTGGGCGGCTGG + Intronic
1127469439 15:59277095-59277117 CCCACCCCGTACAGGGCAGTGGG + Intronic
1127584208 15:60366452-60366474 CACATCCCAGACAGGGCGGTGGG - Intronic
1127644611 15:60946758-60946780 CACTTCCCAGACTGGGCAGCCGG - Intronic
1127785023 15:62348193-62348215 CACACCATGCACTGGGCTGTGGG + Intergenic
1128597509 15:68964864-68964886 CACATCCCAGACGGGGCAGCGGG + Intronic
1129008705 15:72396501-72396523 CACATCCCAGACGGGGCAGCAGG - Intergenic
1129313732 15:74728878-74728900 CACATCCCAGACGGGGCAGCAGG - Intergenic
1129431185 15:75503282-75503304 CACATCCCAGACGGGGCAGCGGG - Intronic
1130207648 15:81892527-81892549 CCCACCCCACACTGACCTGTGGG + Intergenic
1131621619 15:94073960-94073982 CACACCCTACCAAGGGCAGTAGG - Intergenic
1132073094 15:98797057-98797079 GCCACCCCACACAGGGCAGATGG - Intronic
1133013439 16:2927716-2927738 CACGCCCCACACTGGGCGCCAGG + Intronic
1133073556 16:3262966-3262988 CACACCCCACTTTGGGAAGCTGG - Intergenic
1133751596 16:8730232-8730254 CAGACCCTTCACTGGGCACTAGG - Intronic
1133787073 16:8981966-8981988 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1133796332 16:9049582-9049604 CACACTCCAGCCTGGGCAATGGG - Intergenic
1135191073 16:20355158-20355180 GACACACCACACTGGGCAGAGGG - Intronic
1135575553 16:23583267-23583289 CACTTCCCAGACTGGGCAGCCGG - Intronic
1135575582 16:23583383-23583405 CACTTCCCAGACTGGGCAGCCGG - Intronic
1135575609 16:23583499-23583521 CACATCCCAGACGGGGCAGTGGG - Intronic
1135694594 16:24575268-24575290 CACTTCCCAGACTGGGCAGCTGG + Intergenic
1135724891 16:24846470-24846492 CACTCTCCAAACTGGGAAGTTGG + Intronic
1138028189 16:53539223-53539245 CACATCCCAGACGGGGCGGTGGG - Intergenic
1138307291 16:55989282-55989304 CACACCCCAGACGGGGCAGCCGG - Intergenic
1138642640 16:58397235-58397257 CACATCCCAGACGGGGCAGCAGG + Intronic
1139606549 16:68022942-68022964 CGCGCCTCACACTGGGCCGTTGG - Exonic
1139623256 16:68163751-68163773 CACATCCCAGACGGGGCGGTGGG + Intronic
1141162367 16:81638026-81638048 CACCCCCCCCACTGGGGATTAGG + Intronic
1141843907 16:86593948-86593970 TGCACCCCAGACTGGGCACTGGG - Intergenic
1142939930 17:3372173-3372195 CACATCCCAGACGGGGCAGCGGG + Intergenic
1143884733 17:10057284-10057306 CACTTCCCAGACTGGGCAGCCGG - Intronic
1144541298 17:16145465-16145487 CACATCCCAGACGGGGCGGTGGG - Intronic
1144853985 17:18258230-18258252 CACACCCGCCCCTGGGCAGCCGG + Intronic
1145246298 17:21272043-21272065 CACCCAGCACACTGGGCTGTGGG - Intergenic
1145249023 17:21287389-21287411 CCCACCCCATCCTGGGCACTGGG + Intronic
1145746689 17:27325220-27325242 CACACCCTACACTGGGGAACTGG + Intergenic
1145750870 17:27354125-27354147 CACAGCCCACCCTGAGAAGTGGG + Intergenic
1145782843 17:27574968-27574990 CACTCCTCCCACTGGGCTGTAGG + Intronic
1146216464 17:30980712-30980734 CACATCCCAGACAGGGCGGTGGG + Intronic
1146731362 17:35195519-35195541 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1147277829 17:39333635-39333657 CACTTCCCAGACTGGGCAGCCGG - Intronic
1147676107 17:42206910-42206932 CACACTCCAGCCTGGGCAATAGG - Intronic
1147726939 17:42571694-42571716 AACACCTCACACTGGTCAGCTGG + Exonic
1149567168 17:57648627-57648649 CATTTCCCACTCTGGGCAGTGGG + Intronic
1150500141 17:65643056-65643078 CACACTCCAGAATGGCCAGTGGG - Intronic
1152298915 17:79484359-79484381 CACACCCAGCAGTGGGCACTGGG - Intronic
1152583759 17:81180201-81180223 CACCCCCAGCACTGGGCAGATGG + Intergenic
1152941385 17:83174484-83174506 CACACCATCCACTGGACAGTGGG - Intergenic
1154192689 18:12243551-12243573 CACCTCCCAGACTGGGCAGCCGG - Intergenic
1154276349 18:12964669-12964691 CACACTCCAGCCTGGGCAATAGG - Intronic
1154289988 18:13098529-13098551 CACATCCCAGACTGGGCGGCGGG + Intronic
1155998658 18:32359516-32359538 CTCACCCCAGGCTGGGGAGTGGG - Intronic
1158294910 18:55985174-55985196 CAGACACTACACTGGGTAGTAGG - Intergenic
1159570114 18:70103077-70103099 CACATCCCAGACGGGGCAGCCGG - Intronic
1160955910 19:1691634-1691656 CCCTCCCCACACGGGGCAGGGGG + Intergenic
1160992973 19:1868201-1868223 TCCAGCCCACACTGGGCAGGGGG - Intergenic
1161728909 19:5946910-5946932 CTCACCCCAAACAAGGCAGTGGG + Intronic
1162064541 19:8117126-8117148 CACCCTCCACACCAGGCAGTGGG + Intronic
1162602139 19:11677151-11677173 CACATCCTAGACAGGGCAGTGGG + Intergenic
1162602190 19:11677382-11677404 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1163004157 19:14387114-14387136 CACACACTACACTGGGGAGTGGG + Intronic
1163591249 19:18195208-18195230 CACACCCAACAGTGGGCTGGCGG + Intronic
1164012207 19:21212946-21212968 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1164016661 19:21260517-21260539 CACATCCCAGACGGGGCAGTTGG + Intronic
1164034819 19:21443829-21443851 CACATCCCAGACGGGGCAGCGGG + Intronic
1164034845 19:21443945-21443967 CACTTCCCAGACTGGGCAGCCGG + Intronic
1164043229 19:21511426-21511448 CACATCCCAGACGGGGCAGTGGG + Intronic
1164064973 19:21707842-21707864 CACTTCCCAGACTGGGCAGCTGG - Intergenic
1164066401 19:21720992-21721014 CACATCCCAGACAGGGCGGTGGG - Intergenic
1164168615 19:22703399-22703421 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1164231257 19:23290315-23290337 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1164256704 19:23533837-23533859 CACTTCCCAGACTGGGCAGCCGG + Intronic
1164659378 19:29949415-29949437 CACTTCCCAGACTGGGCAGCCGG + Intronic
1164908041 19:31983676-31983698 CACACCCACCACTGAGCAGAAGG + Intergenic
1165768351 19:38364351-38364373 CACATCCCAGACGGGGCAGCGGG + Intronic
1165827073 19:38711586-38711608 CACAGCCCACCCTGGGAGGTGGG + Intronic
1166016114 19:39980532-39980554 CACAGCCCAGACTGTGCAGGTGG + Intronic
1167291047 19:48625382-48625404 CACCCCCCATACGGTGCAGTGGG - Intronic
1167851117 19:52203157-52203179 CCCTCCCCACACTGGACAGATGG + Intronic
1167924472 19:52811538-52811560 CACATCCCAGACAGGGCGGTGGG - Intronic
1168000645 19:53443352-53443374 CAGACCCAACACCGGGCTGTGGG + Intronic
1168114902 19:54217057-54217079 CAGACCCCACACTCAGCAGAAGG - Exonic
925385804 2:3460922-3460944 CACCTCCCACACTGGGCATCAGG + Intronic
925407650 2:3616264-3616286 CACTTCCCAGACTGGGCAGCCGG + Intronic
925829952 2:7884113-7884135 CATACCCAAGACTGGGCAATTGG - Intergenic
926252807 2:11165408-11165430 CACTTCCCAGACTGGGCAGCCGG + Intronic
926252836 2:11165521-11165543 CACTTCCCAGACTGGGCAGCCGG + Intronic
927277358 2:21273205-21273227 CACACTGCACACGTGGCAGTGGG - Intergenic
927320446 2:21738316-21738338 CACTCCCCACACTGGGCTCTTGG - Intergenic
928081991 2:28319929-28319951 CACAGCACACACTGCGCAGTGGG - Intronic
928687241 2:33761692-33761714 CACTTCCCAGACTGGGCAGCCGG + Intergenic
929238358 2:39628539-39628561 CACATCCCAGACGGGGCGGTGGG + Intergenic
929744363 2:44640603-44640625 CACACCACACACTGCCCAATTGG + Intronic
930727814 2:54698887-54698909 CACTTCCCAGACTGGGCAGCCGG - Intergenic
931479869 2:62630186-62630208 CACTTCCCAGACTGGGCAGCCGG - Intergenic
932128224 2:69164281-69164303 CACAGCCCACTCTTGGCAGTTGG + Intronic
932410338 2:71543366-71543388 CACTTCCCAGACTGGGCAGCCGG + Intronic
932451085 2:71811325-71811347 CACATCCCACACTTGAGAGTTGG + Intergenic
932718867 2:74123749-74123771 CACTTCCCAGACTGGGCAGCCGG - Intergenic
932903445 2:75725225-75725247 CACACCCCAGACGGGGCGGTGGG - Intergenic
933181468 2:79231478-79231500 CATACCCAAGACTGGGCAATTGG - Intronic
933869014 2:86549172-86549194 CACTTCCCAGACTGGGCAGCCGG + Intronic
934522188 2:95026468-95026490 CACCCCGCACACGGGGCAGAAGG - Intronic
934998606 2:98989196-98989218 CACTTCCCAGACTGGGCAGCGGG + Intergenic
936091887 2:109506940-109506962 GCCACCCCACACAGAGCAGTGGG + Intergenic
936186399 2:110307178-110307200 CACTTCCCAGACTGGGCAGCCGG - Intergenic
936316581 2:111429447-111429469 CAGAGTCCACAGTGGGCAGTTGG + Intergenic
936345562 2:111672564-111672586 CACTTCCCAGACTGGGCAGCCGG - Intergenic
936481721 2:112890946-112890968 CACACCCGACAGTTGGCAGTGGG + Intergenic
937381744 2:121383496-121383518 CCCACCCCACACTCGGAGGTGGG - Intronic
938229678 2:129647638-129647660 CAGGCTCCACACTGGGCACTGGG - Intergenic
940134105 2:150416543-150416565 CACATCCCACACTGGTCCATCGG - Intergenic
940643222 2:156368207-156368229 CACATCCCAGACAGGGCAGTGGG - Intergenic
940756139 2:157685249-157685271 AACACCCCACGCTGTGAAGTGGG + Intergenic
941197540 2:162470313-162470335 CACATCCCAGACAGGGCACTAGG - Intronic
941200148 2:162498462-162498484 CAGAGTCCACATTGGGCAGTGGG - Intronic
941793394 2:169575595-169575617 CACATCCCAGACGGGGCGGTGGG + Intergenic
941822429 2:169856338-169856360 CACTTCCCAGACTGGGCAGCCGG + Intronic
942012135 2:171774560-171774582 CACTTCCCAGACTGGGCAGCTGG - Intergenic
942012160 2:171774676-171774698 CACATCCCAGACGGGGCGGTGGG - Intergenic
942021068 2:171867022-171867044 CACATCCCAGACGGGGCGGTGGG + Intronic
942355584 2:175108057-175108079 CACTTCCCAGACTGGGCAGCCGG - Intronic
942621071 2:177845380-177845402 CACATCCCAGACGGGGCAGCGGG + Intronic
943005711 2:182386335-182386357 CACTTCCCAGACTGGGCAGCCGG - Intronic
943100269 2:183479000-183479022 CACTTCCCAGACTGGGCAGCCGG - Intergenic
943323410 2:186472895-186472917 CACATCCCAGACAGGGCGGTGGG - Intergenic
943863260 2:192894379-192894401 CACTTCCCAGACTGGGCAGCCGG - Intergenic
944083302 2:195814774-195814796 CACACTTCAGCCTGGGCAGTGGG - Intronic
944598915 2:201284028-201284050 CACATCCCAGACAGGGCGGTGGG + Intronic
945530742 2:210950631-210950653 CACTTCCCAGACTGGGCAGCCGG - Intergenic
945741011 2:213661039-213661061 CAGACCCAACACCAGGCAGTGGG - Intronic
945835856 2:214835706-214835728 CACATCCCAGACAGGGCGGTGGG + Intergenic
945919661 2:215742885-215742907 CTCACCCCACACGTGCCAGTTGG + Intergenic
945970481 2:216226907-216226929 CACATCCCAGACAGGGCGGTGGG + Intergenic
947797771 2:232905748-232905770 CACATCCCAGACAGGGCGGTGGG - Intronic
948639970 2:239369345-239369367 CCCACCCCCCGCCGGGCAGTCGG - Intronic
1169085622 20:2823713-2823735 CACATCCCAGACAGGGCGGTGGG - Intergenic
1169125822 20:3125833-3125855 CACATCCCAAACGGGGCAGCCGG - Intronic
1169246860 20:4032533-4032555 CACATCCCAGACAGGGCGGTGGG - Intergenic
1170202481 20:13760401-13760423 CACACCCCAGACGGGGCGGCAGG - Intronic
1170508939 20:17057391-17057413 CACACCACTCCCTGGCCAGTTGG - Intergenic
1170592143 20:17779066-17779088 CACTTCCCAGACTGGGCAGCAGG - Intergenic
1171848522 20:30292001-30292023 CACATCCCAGACGGGGCAGCGGG + Intergenic
1172279912 20:33701375-33701397 CACATCCCAGACGGGGCAGCAGG - Intergenic
1172337831 20:34132335-34132357 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1172337857 20:34132451-34132473 CACATCCCAGACGGGGCAGCGGG - Intergenic
1172401907 20:34658599-34658621 CACATCCCAGACGGGGCGGTGGG - Intronic
1172717796 20:36977044-36977066 CACATCCCAGACGGGGCAGCAGG + Intergenic
1172720927 20:37000098-37000120 CACATCCCAGACGGGGCAGCAGG - Intronic
1172771088 20:37383051-37383073 CACACCCCATGCTAGGCACTGGG + Intronic
1172918609 20:38461890-38461912 CACATCCCAGACGGGGCAGCGGG + Intergenic
1174449466 20:50610402-50610424 TACTCCCCACACTGCCCAGTGGG - Intronic
1174483132 20:50845091-50845113 CACACCCCACCCTGTGAAGAGGG + Intronic
1175139648 20:56850830-56850852 CACACACCACACAGGAAAGTTGG + Intergenic
1175697691 20:61114875-61114897 CACACTCCACTGTGGGCAGTGGG + Intergenic
1175858288 20:62134597-62134619 GAGACCCCACCCTTGGCAGTGGG - Exonic
1175871473 20:62211378-62211400 CCCACGCCACCCTCGGCAGTTGG - Intergenic
1176853067 21:13936456-13936478 CACATCCCAGACGGGGCGGTCGG + Intergenic
1178729011 21:35081967-35081989 CTCAGCCCACACTTGGCATTTGG + Intronic
1178902112 21:36606280-36606302 CCCACCCCAAAGTGGGGAGTTGG - Intergenic
1179135861 21:38679053-38679075 CACACCCCAGCCTGGGAAATGGG - Intergenic
1179426096 21:41279906-41279928 CCCACCCCTCAGTTGGCAGTGGG + Intronic
1179635990 21:42709718-42709740 CACACCCCAGCCTGGGCAACAGG - Intronic
1179787472 21:43737923-43737945 CACATCCCACAGTGGGCAGGAGG + Intronic
1179803305 21:43822192-43822214 CACATCCCAGACAGGGCGGTGGG - Intergenic
1179877715 21:44279579-44279601 TACACCCAACACTGGGCTGGTGG + Intergenic
1179973731 21:44851179-44851201 CACACGCAACACAGGGAAGTCGG - Exonic
1180725768 22:17945614-17945636 CCCTCCCCTCCCTGGGCAGTAGG - Intronic
1181314247 22:21961526-21961548 CACACTCCACAGTGGGCTGAGGG + Intronic
1182331067 22:29552275-29552297 CACTTCCCAGACTGGGCAGCCGG - Intronic
1182399761 22:30066588-30066610 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1182806989 22:33081062-33081084 CATACCTCACACTGGGGAATAGG - Intergenic
1183537255 22:38410203-38410225 CACATCCCAGACGGGGCAGCGGG + Intergenic
1183871763 22:40745747-40745769 CACATCCCAGACAGGGCGGTGGG + Intergenic
1184145458 22:42607714-42607736 CACATCCCAGACGGGGCAGCGGG - Intronic
1184202582 22:42981130-42981152 CACATCCCAGACAGGGCGGTGGG - Intronic
1184651123 22:45919928-45919950 CAGACCCCACCCTGGTCAGAGGG + Intergenic
1185344856 22:50306751-50306773 CACAGCCCACAGTGGGCAGACGG + Intronic
1203280162 22_KI270734v1_random:125854-125876 CACATCCCAGACGGGGCAGCGGG + Intergenic
949518264 3:4826564-4826586 CTCACCCCACCCTGTGCACTTGG + Intronic
950060779 3:10070068-10070090 CACATCCCAGACGGGGCGGTGGG - Intronic
950217599 3:11170431-11170453 CACACCCCACACTGGGCAGTGGG + Intronic
950529378 3:13544428-13544450 CACACCCCCAGCTGGGCAATAGG + Intergenic
951290520 3:20867141-20867163 CACATCCCAGACGGGGCGGTGGG + Intergenic
953322355 3:41983551-41983573 CACTTCCCAGACTGGGCAGCCGG + Intergenic
953456273 3:43044835-43044857 CACACCCAACACGAGGCCGTGGG + Intronic
953823268 3:46228141-46228163 AAGACCACAAACTGGGCAGTAGG - Intronic
953966256 3:47309505-47309527 CACTTCCCAGACTGGGCAGCCGG + Intronic
954126965 3:48536997-48537019 CACACCCCATCCTGGGCAGCTGG + Intronic
955256562 3:57338354-57338376 CACATCCCAGACGGGGCAGCCGG - Intronic
957789223 3:84918603-84918625 CACTTCCCAGACTGGGCAGACGG - Intergenic
958173581 3:89967052-89967074 TACATCTCACACTGGGCTGTGGG + Intergenic
958406460 3:93761966-93761988 CACCTCCCACACGGGGCAGCCGG + Intergenic
959588665 3:108051683-108051705 CACACCCAAAACTGGAAAGTAGG - Intronic
959683737 3:109124019-109124041 CACATCCCAGACGGGGCAGCAGG - Intergenic
960780670 3:121313946-121313968 CACATCCCAGACAGGGCGGTGGG + Intronic
961554765 3:127690361-127690383 CTCACCCCACAAGGGGCAGGTGG - Exonic
961704353 3:128773080-128773102 CACTTCCCAGACTGGGCAGCCGG - Intronic
961861617 3:129921010-129921032 CACACCCTGCACTTGGCTGTGGG - Intergenic
962302506 3:134254576-134254598 CATACATCAAACTGGGCAGTGGG - Intergenic
962688770 3:137872641-137872663 CACTTCCCAGACTGGGCAGCCGG - Intergenic
963498344 3:146096530-146096552 CACATCCCAGACAGGGCGGTGGG - Intronic
963776447 3:149445249-149445271 CACTTCCCAGACTGGGCAGCCGG + Intergenic
965302280 3:167018594-167018616 CACCTCCCAGACTGGGCAGCTGG - Intergenic
965649999 3:170923490-170923512 CACTTCCCAGACTGGGCAGCCGG - Intergenic
965650023 3:170923603-170923625 CACATCCCAGACGGGGCAGCGGG - Intergenic
966206746 3:177413161-177413183 CACTTCCCAGACTGGGCAGCTGG + Intergenic
967176055 3:186864184-186864206 CACATCCCAGACAGGGCGGTGGG - Intergenic
967682021 3:192375057-192375079 CACAACACACAAAGGGCAGTAGG - Intronic
967922485 3:194623459-194623481 CTCATCCCACCCTGGGCATTTGG + Intronic
968042486 3:195599970-195599992 CACTTCCCAGACTGGGCAGCCGG + Intergenic
968139456 3:196244296-196244318 CACTTCCCAGACTGGGCAGCCGG - Intronic
968747436 4:2367654-2367676 AGAACCCCACAGTGGGCAGTGGG + Intronic
968873875 4:3255054-3255076 CACCCACCAAACTGGGCAGGTGG - Intronic
970287832 4:14538084-14538106 TCCTTCCCACACTGGGCAGTAGG + Intergenic
971524370 4:27598000-27598022 CAAACCCCACACAGTTCAGTGGG + Intergenic
972304671 4:37820321-37820343 CACTTCCCAGACTGGGCAGCCGG - Intergenic
972594587 4:40518691-40518713 GACACCCCTGATTGGGCAGTAGG - Intronic
972700751 4:41491523-41491545 CACATCCCATACTGGGCGGCCGG + Intronic
972708048 4:41564909-41564931 CAAACTCCTCACAGGGCAGTAGG - Intronic
972939683 4:44181737-44181759 CACTTCCCAGACTGGGCAGCCGG - Intronic
973263457 4:48186832-48186854 CACCTCCCAGACGGGGCAGTGGG - Intronic
973683934 4:53350260-53350282 CCCAACCCACACTGGGCAAAAGG + Intronic
974718985 4:65711944-65711966 CACACCCCACACAGGGCTCCAGG + Intergenic
974870495 4:67636882-67636904 CACTTCCCAGACTGGGCAGCCGG - Intronic
975063757 4:70037443-70037465 CACTTCCCAGACTGGGCAGCCGG - Intergenic
979702470 4:123684847-123684869 CACTTCCCAGACTGGGCAGCCGG - Intergenic
982026198 4:151255376-151255398 CACATCCCAGACGGGGCAGCGGG + Intronic
982075241 4:151731605-151731627 CACTTCCCAGACTGGGCAGCCGG - Intronic
982075266 4:151731721-151731743 CACATCCCAGACGGGGCAGCGGG - Intronic
982911840 4:161151686-161151708 CACACTCCAGCCTGGGCAGCAGG + Intergenic
983613692 4:169678969-169678991 CACTTCCCACACTGGGCGGCCGG + Intronic
984804275 4:183737138-183737160 CACATCCCAGACAGGGCGGTGGG + Intergenic
984813752 4:183818934-183818956 CACTTCCCAGACTGGGCAGCGGG + Intergenic
985667264 5:1187623-1187645 CACCCACCACACTGGGCTGAAGG + Intergenic
986338515 5:6771925-6771947 CAGGCCCCACTCTGGGCACTTGG + Intergenic
988532663 5:32040241-32040263 CACATCCCAGACGGGGCAGCCGG - Intronic
989068228 5:37484060-37484082 CACTTCCCAGACTGGGCAGCTGG + Intronic
989574689 5:42979186-42979208 CACTTCCCAGACTGGGCAGCCGG - Intergenic
989633418 5:43510931-43510953 CACTTCCCAGACTGGGCAGTCGG - Intronic
989634813 5:43522107-43522129 CACATCCCAGACGGGGCAGCGGG - Intergenic
989655968 5:43746480-43746502 CACTTCCCAGACTGGGCAGCCGG + Intergenic
989663534 5:43824871-43824893 CACTTCCCAGACTGGGCAGCCGG + Intergenic
989828812 5:45890466-45890488 CACTTCCCAGACTGGGCAGCCGG - Intergenic
990297816 5:54420869-54420891 CACTTCCCAGACTGGGCAGCCGG + Intergenic
991375151 5:65958125-65958147 CACTTCCCAGACTGGGCAGCCGG + Intronic
992442943 5:76812251-76812273 CACATCCCAGACAGGGCGGTGGG - Intergenic
992872830 5:81023803-81023825 CTCTCCCCATACTGGGCATTTGG + Intronic
992964256 5:81983852-81983874 CACATCCCAGACGGGGCAGCGGG + Intronic
995216486 5:109601030-109601052 CACTTTTCACACTGGGCAGTTGG + Intergenic
995456782 5:112360724-112360746 CACTTCCCAGACTGGGCAGCCGG - Intronic
995994419 5:118282512-118282534 CACTTCCCAGACTGGGCAGCCGG - Intergenic
996054059 5:118964930-118964952 CACTTCCCAGACTGGGCAGCCGG - Intronic
996159832 5:120147912-120147934 CACTTCCCAGACTGGGCAGCCGG - Intergenic
997530067 5:134576583-134576605 CACAGGCCACAGTGGACAGTTGG + Intronic
997691695 5:135831736-135831758 CACACAACACACTGGGGAATTGG + Intergenic
998060009 5:139112335-139112357 CACTTCCCAGACTGGGCAGCCGG - Intronic
999455688 5:151714235-151714257 CACACCCCAGACGGGGCGGCGGG + Intergenic
999455716 5:151714351-151714373 CACTTCCCAGACTGGGCAGCCGG + Intergenic
999532719 5:152480315-152480337 CACTTCCCAGACTGGGCAGCCGG + Intergenic
999604214 5:153297131-153297153 CACATCCCAGACGGGGCAGCGGG + Intergenic
1001882306 5:175254932-175254954 CACACAACAGGCTGGGCAGTGGG - Intergenic
1002031515 5:176433766-176433788 CACATCCCAGACTGGGCAGCGGG - Intergenic
1002315335 5:178339712-178339734 CCCACCCCATACAAGGCAGTGGG - Intronic
1002626205 5:180531374-180531396 CACATCCCACACGGGGCGGCGGG + Intronic
1003014856 6:2460207-2460229 CACACACCACACCGTGCACTGGG + Intergenic
1003526993 6:6906330-6906352 CACCCCCCACATTGGGCATGGGG + Intergenic
1004279836 6:14271242-14271264 CACTAGCCACACTGGGCGGTAGG + Intergenic
1005667881 6:28076595-28076617 CTCCTCCCACACTGGGCAGAGGG + Intergenic
1005837164 6:29718541-29718563 CACATCCCAGACAGGGCGGTGGG - Intergenic
1006108584 6:31730741-31730763 CACACTCCAAAATGGCCAGTGGG - Exonic
1006546618 6:34786471-34786493 CACATCCCAGACGGGGCAGCAGG - Intergenic
1006826813 6:36941627-36941649 CACATCCCAGACTGGGCGGCGGG - Intergenic
1008184383 6:48371486-48371508 CACATCCCAGACGGGGCAGCGGG + Intergenic
1008909834 6:56720947-56720969 CACCCCCCAGACGGGGCAGCCGG + Intronic
1008919194 6:56824612-56824634 CACATCCCAGACGGGGCAGCGGG - Intronic
1008926656 6:56895369-56895391 CACATCCCAGACAGGGCGGTGGG + Intronic
1009622732 6:66097089-66097111 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1010030532 6:71266784-71266806 CACATCCCAGACGGGGCAGCAGG + Intergenic
1010192117 6:73205865-73205887 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1010300691 6:74255470-74255492 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1011426901 6:87239857-87239879 CACTTCCCAGACTGGGCAGCCGG + Intronic
1011474273 6:87736326-87736348 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1011476145 6:87751433-87751455 CACATCCCAGACGGGGCAGCGGG + Intergenic
1012479419 6:99650420-99650442 CACATCCCAGACGGGGCAGCGGG + Intergenic
1012899659 6:104991518-104991540 CACTTCCCAGACTGGGCAGCCGG + Intronic
1013215789 6:108026126-108026148 CACACCCCACTGTGGTCAGAGGG - Intergenic
1013244941 6:108277424-108277446 CCCAGCCCACACTGAGCAGCAGG + Intergenic
1013530855 6:111017718-111017740 CACTTCCCAGACTGGGCAGCCGG + Intronic
1014764280 6:125389479-125389501 CACATCCCAGACAGGGCGGTGGG + Intergenic
1017676820 6:156822809-156822831 CACACAGAACAGTGGGCAGTGGG - Intronic
1017855869 6:158349662-158349684 CACATCCCAGACGGGGCAGCCGG + Intronic
1018471037 6:164098173-164098195 CACACCACACACGGGGAGGTGGG + Intergenic
1019331950 7:464664-464686 CTCACCCCACCCTGTGCAGTAGG + Intergenic
1019651475 7:2161595-2161617 CACTTCCCAGACTGGGCGGTCGG - Intronic
1019674398 7:2302748-2302770 CACATCCCAGACGGGGCGGTGGG - Intronic
1020157222 7:5736610-5736632 CACTTCCCAGACTGGGCAGCCGG - Intronic
1020844183 7:13261741-13261763 CACACTCCAGCCTGGGCAATAGG - Intergenic
1021647329 7:22800813-22800835 CACATCCCAGACGGGGCGGTGGG - Intergenic
1021672511 7:23046723-23046745 CACATCCCAGACAGGGCAGTGGG + Intergenic
1024095598 7:45980154-45980176 CACAGCCAACACCTGGCAGTGGG + Intergenic
1024479415 7:49848462-49848484 CACAGCCGACCCTGGGCAGGTGG - Intronic
1024910738 7:54444319-54444341 CACATCCCAGACGGGGCAGCTGG - Intergenic
1025573043 7:62600037-62600059 CACATCCCAGACGGGGCAGTGGG + Intergenic
1025821686 7:64968459-64968481 CACATCCCACACGGGGCAGCAGG + Intergenic
1025828917 7:65033451-65033473 CACTTCCCAGACTGGGCAGTCGG - Intergenic
1025852810 7:65258076-65258098 CACATCCCAGACAGGGCGGTGGG - Intergenic
1025979570 7:66394464-66394486 CACATCCCAGACAGGGCGGTGGG + Intronic
1026007967 7:66614559-66614581 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1026341700 7:69439805-69439827 CAGACACCACCCTGGGCATTGGG + Intergenic
1027250998 7:76398647-76398669 CACACCCTACCCTAGGCAGTGGG - Intronic
1027909032 7:84224718-84224740 CACATCACCCACTGGGAAGTAGG + Intronic
1028548145 7:92027014-92027036 CACATCCCAGACAGGGCAGCCGG - Intronic
1029376300 7:100178752-100178774 GACACCAGAAACTGGGCAGTGGG - Intronic
1029525648 7:101092278-101092300 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1030365141 7:108637330-108637352 CCCACCCCACACTGGGAAAAGGG - Intergenic
1031022000 7:116638643-116638665 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1032056600 7:128689291-128689313 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1032156979 7:129476680-129476702 CACTTCCCAGACTGGGCAGCCGG + Intronic
1033293999 7:140114658-140114680 CACTCCCCAGACTGGGCAGCCGG - Intronic
1033674004 7:143519855-143519877 CAGACAGCACACTGGGCAGGTGG - Intergenic
1034089999 7:148354858-148354880 CACACCCCACCCTGGGCTCGTGG + Intronic
1034137328 7:148783016-148783038 GAAAGCCCACACTGGGCAGCAGG - Intronic
1035057590 7:156046330-156046352 CACACGCCCCACAGGGCAGGGGG + Intergenic
1036737141 8:11329804-11329826 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1036794093 8:11742955-11742977 CCCAGCCCAGACTGGGCAGGAGG - Intronic
1037549445 8:19956282-19956304 CAAATCCCACACTGAGCACTGGG - Intronic
1037776443 8:21838834-21838856 CCCACCCCACCCTGAGCAGGCGG - Intergenic
1038595075 8:28880902-28880924 CACATCCCAGACAGGGCGGTGGG - Intronic
1039881231 8:41626615-41626637 CACATCCCAGACGGGGCGGTGGG + Intergenic
1040785448 8:51159057-51159079 CACATCCCAGACGGGGCAGCAGG - Intergenic
1041066196 8:54085468-54085490 CACTTCCCAGACTGGGCAGAGGG - Intronic
1042051344 8:64711469-64711491 CAAAACCAACACTGGGCAGATGG - Intronic
1042133948 8:65616623-65616645 CACTTCCCAGACTGGGCAGCCGG - Intronic
1042290805 8:67167802-67167824 CACTTCCCAGACTGGGCAGCCGG + Intronic
1042485313 8:69340433-69340455 CACACCCGAGACTGGGCAATTGG - Intergenic
1043961669 8:86424310-86424332 CACTTCCCAGACTGGGCAGCCGG + Intronic
1044581942 8:93833573-93833595 CACATCCCAGACGGGGCAGCCGG + Intergenic
1044582243 8:93834539-93834561 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1047485957 8:125330833-125330855 CAAACCCCACACTTGACAGCTGG - Intronic
1048496904 8:134942955-134942977 GACACCCCACACTGAGCAGCAGG - Intergenic
1048962465 8:139591989-139592011 CACACTCCAGCCTGGGCAATGGG + Intergenic
1048997907 8:139805384-139805406 AAGACCCCACACTCGGCAGGTGG + Intronic
1049476081 8:142797541-142797563 CACACCCCACCCGGGGCAGCAGG - Intergenic
1049481656 8:142827199-142827221 CACATCCCAGACGGGGCAGCTGG + Intergenic
1050417727 9:5433755-5433777 CACATCCCAGACGGGGCAGCCGG - Intronic
1050571939 9:6949354-6949376 CACTTCCCAGACTGGGCAGAGGG + Intronic
1051181176 9:14413311-14413333 CACACTCCACAATGAGGAGTGGG + Intergenic
1051258025 9:15234002-15234024 CACATCCCAGACGGGGCAGCGGG - Intronic
1051615355 9:19000486-19000508 CACTTCCCAGACAGGGCAGTGGG - Intronic
1052259116 9:26492794-26492816 CACATCCCAGACGGGGCAGCCGG - Intergenic
1052492904 9:29189480-29189502 CACATCCCAGACGGGGCGGTGGG + Intergenic
1052881014 9:33600934-33600956 CACATCCCAGACGGGGCGGTGGG - Intergenic
1052887947 9:33667600-33667622 CACTTCCCAGACTGGGCAGCGGG - Intergenic
1052887975 9:33667716-33667738 CACATCCCAGATGGGGCAGTGGG - Intergenic
1053048080 9:34936715-34936737 CACATCCCAGACGGGGCGGTGGG - Intergenic
1053124234 9:35566651-35566673 CACATCCAACACTGGCCACTGGG - Intergenic
1054359651 9:64100836-64100858 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1055329202 9:75164289-75164311 CAGACCCAACACTAGGCCGTGGG - Intergenic
1056097772 9:83272670-83272692 CACTTCCCAGACTGGGCAGCCGG - Intronic
1056229175 9:84526858-84526880 CACATCCCAGACAGGGCAGCCGG + Intergenic
1057630519 9:96715869-96715891 CACATCCCAGACGGGGCAGCGGG + Intergenic
1057716221 9:97498282-97498304 CACATCCCAGACGGGGCAGTGGG + Intergenic
1058049591 9:100392799-100392821 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1058244260 9:102603776-102603798 CACTTCCCAGACTGGGCGGTTGG + Intergenic
1058375505 9:104316805-104316827 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1059118178 9:111617727-111617749 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1059879981 9:118678437-118678459 CACTTCCCAGACTGGGCAGCTGG + Intergenic
1060239860 9:121893694-121893716 CACACCCCACAGAGAGCTGTAGG + Intronic
1060351736 9:122867009-122867031 CACATCCCAGACGGGGCGGTGGG - Intronic
1060351957 9:122867670-122867692 CACATCCCAGACGGGGCGGTGGG - Intronic
1060625498 9:125108322-125108344 CACTTCCCAGACTGGGCAGCTGG - Intronic
1060754755 9:126204420-126204442 CACACCCCAGCCTGGCCAGCGGG + Intergenic
1061143054 9:128780163-128780185 CACATCCCAGACGGGGCAGCAGG - Intergenic
1061487238 9:130926115-130926137 CACACCCCAACCGGGGCAGGAGG + Intronic
1061625919 9:131840606-131840628 CACACCCCATAATAAGCAGTGGG + Intergenic
1061976171 9:134068778-134068800 CCCGCCCCTCACTGGGCAGATGG - Intergenic
1061977270 9:134075765-134075787 CACATCCCAGACAGGACAGTGGG - Intergenic
1062080719 9:134622003-134622025 CACACCCCACATTGAGGAGCAGG + Intergenic
1062712449 9:137983962-137983984 CACACCTCACACTGAGCTCTTGG - Intronic
1189204075 X:39222621-39222643 GAAACCCCACACTGGACAGCTGG + Intergenic
1189210171 X:39277535-39277557 CACATCCCAGACGGGGCAGTGGG - Intergenic
1189421585 X:40862249-40862271 CACATCCCAGACGGGGCAGCCGG - Intergenic
1190769546 X:53503898-53503920 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1191069071 X:56380671-56380693 CACTTCCCAGACTGGGCAGCCGG + Intergenic
1191090469 X:56615720-56615742 CAGACCCAACACCAGGCAGTGGG + Intergenic
1192106955 X:68326509-68326531 CACATCCCAGACAGGGCGGTGGG - Intronic
1192252100 X:69422001-69422023 CACATCCCAGACGGGGCAGCGGG - Intergenic
1192324767 X:70122933-70122955 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1192663687 X:73068283-73068305 CACATCCCAGACGGGGCGGTTGG - Intergenic
1193328927 X:80214990-80215012 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1193924301 X:87465840-87465862 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1194181142 X:90713599-90713621 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1194714754 X:97275783-97275805 CACTTCCCAGACTGGGCAGCCGG + Intronic
1195223443 X:102768502-102768524 CACACACTATACTAGGCAGTTGG - Intergenic
1196143940 X:112296488-112296510 CAAACCCCATACTGAGCAGTTGG + Intergenic
1197455596 X:126673709-126673731 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1197800584 X:130343667-130343689 CTAACCCCAGACTGGGCAATGGG + Intronic
1197886122 X:131220128-131220150 CCCACCCCACAGTGGCCAGATGG - Intergenic
1198246816 X:134839301-134839323 CACATCCCAGACGGGGCAGCGGG - Intronic
1199230938 X:145436273-145436295 CACATCCCAGACTGGGCGGCGGG - Intergenic
1200527760 Y:4295488-4295510 CACTTCCCAGACTGGGCAGCCGG - Intergenic
1200952971 Y:8918402-8918424 CACTTCCCAGACTGGGCAGCCGG + Intergenic