ID: 950218247

View in Genome Browser
Species Human (GRCh38)
Location 3:11174973-11174995
Sequence GAAACCAAGCCACACCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950218247_950218250 -10 Left 950218247 3:11174973-11174995 CCCACTTGGTGTGGCTTGGTTTC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 950218250 3:11174986-11175008 GCTTGGTTTCATGGTTCATGTGG 0: 1
1: 0
2: 0
3: 22
4: 154
950218247_950218253 20 Left 950218247 3:11174973-11174995 CCCACTTGGTGTGGCTTGGTTTC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 950218253 3:11175016-11175038 CCCCTCTCCCCATCAGTGTTTGG 0: 1
1: 0
2: 1
3: 14
4: 369
950218247_950218259 29 Left 950218247 3:11174973-11174995 CCCACTTGGTGTGGCTTGGTTTC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 950218259 3:11175025-11175047 CCATCAGTGTTTGGTGATACAGG 0: 1
1: 0
2: 0
3: 9
4: 85
950218247_950218251 -4 Left 950218247 3:11174973-11174995 CCCACTTGGTGTGGCTTGGTTTC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 950218251 3:11174992-11175014 TTTCATGGTTCATGTGGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950218247 Original CRISPR GAAACCAAGCCACACCAAGT GGG (reversed) Intronic
900586613 1:3435637-3435659 GACACAAACCCACACCAAGGCGG - Exonic
902818852 1:18931311-18931333 AAAACCAGGCCACTCCAAGGAGG + Intronic
903051822 1:20606760-20606782 GAAAGTAAGCCATACCAACTAGG - Intronic
907631579 1:56088679-56088701 GGAACTAATCCACAGCAAGTGGG - Intergenic
908357008 1:63331574-63331596 GAACCCAAGGCTCTCCAAGTGGG - Intergenic
910809702 1:91223820-91223842 CAAACCAAGCCAAACCAAAATGG + Intergenic
912974372 1:114314643-114314665 GCAACCAAGCAAAGCCAAGTTGG + Intergenic
916165776 1:161966156-161966178 GAAACCAAGCCACACAACACAGG + Intergenic
916759253 1:167801895-167801917 GAACTCCAGCCAGACCAAGTGGG + Intergenic
918312294 1:183293407-183293429 CATACCAAGCCACACCCAGTGGG + Intronic
919635839 1:200002721-200002743 GCCACCGTGCCACACCAAGTTGG - Intergenic
1067298141 10:44986994-44987016 GATACCAACCAACTCCAAGTAGG - Intronic
1069963366 10:72092498-72092520 GAAACGAAGACACAGCAAGAAGG - Intergenic
1072581555 10:96744453-96744475 GAAACCAAGTCACACAGAGAGGG - Intergenic
1074879614 10:117645513-117645535 GAGACCAGGCTTCACCAAGTTGG - Intergenic
1075655484 10:124158354-124158376 GAAGCCAAACCATATCAAGTAGG + Intergenic
1076103369 10:127800646-127800668 GATACCAATCCACACCCAATAGG + Intergenic
1078350032 11:10585452-10585474 GAAACCAAGGCTCAAAAAGTAGG + Intronic
1078989646 11:16633560-16633582 AAGACAAAGCCACACAAAGTGGG - Intronic
1079083185 11:17428130-17428152 GAAACCAGGGACCACCAAGTGGG - Intronic
1083739915 11:64703404-64703426 GAAACCAAGACTCAGAAAGTAGG + Intronic
1089555089 11:119311764-119311786 GAGACCAGGTCACCCCAAGTGGG - Intronic
1089607877 11:119652118-119652140 GACAGCAAGGCACACCAAATGGG - Intronic
1089709159 11:120302514-120302536 AAATCCAAGCTACAGCAAGTGGG + Intronic
1090172352 11:124616158-124616180 GAAACCAAGCACCACCAACTGGG + Intronic
1095306723 12:40647189-40647211 TAAACAAATCCACACCATGTTGG + Intergenic
1096419012 12:51440149-51440171 GAGACCAATCTACACCAAATGGG + Intronic
1096840613 12:54377628-54377650 GAAAGAAAGACAGACCAAGTTGG + Intronic
1099885942 12:88530545-88530567 GAAACAAACACACACCAATTAGG - Intronic
1101692252 12:107093341-107093363 GAAACCTCGCCCCACCAAGGCGG + Exonic
1102624237 12:114221744-114221766 GAAAACAAGCCCAACCAAGCAGG + Intergenic
1103703034 12:122857772-122857794 GAAACCACTCCACACCCACTAGG - Intronic
1103905339 12:124324854-124324876 GAAACCAAGTCAGGCCAGGTGGG - Exonic
1105710421 13:23002753-23002775 GAAACTAAGACCCACCAAATTGG - Intergenic
1105879257 13:24589476-24589498 CAAACCCAGTGACACCAAGTTGG - Intergenic
1105920578 13:24959582-24959604 CAAACCCAGTGACACCAAGTTGG + Intergenic
1108209970 13:48128089-48128111 AAAACCAAACCAAACCAAATGGG - Intergenic
1108912216 13:55569203-55569225 GAAACCAAGGAACACTAAATGGG + Intergenic
1111620070 13:90713812-90713834 GAAAGCAAGCTCCAACAAGTAGG + Intergenic
1116736056 14:48693434-48693456 GAAACCCAACCACACTATGTGGG + Intergenic
1118481250 14:66168374-66168396 AATACCACTCCACACCAAGTAGG - Intergenic
1119800793 14:77443426-77443448 GTAACCAAGACACACAAGGTTGG - Intronic
1127873233 15:63090630-63090652 GAAAGTGAGCCAGACCAAGTGGG + Intergenic
1130987151 15:88852030-88852052 GAACCCAAGCCATACCAACCTGG - Exonic
1131336936 15:91558136-91558158 GAATCCAAACCATATCAAGTGGG + Intergenic
1136674368 16:31888370-31888392 GAAATCAAGCCAGAACAATTAGG - Intronic
1139753093 16:69120994-69121016 GAAAGCAAGCTACACCAAGGTGG - Intronic
1146102771 17:30001151-30001173 GAAAGCATGCCACACCATGCAGG - Intronic
1146941373 17:36846403-36846425 GAAGCCAAGCCAGAAAAAGTGGG + Intergenic
1154108315 18:11544578-11544600 ACAACCAACCCCCACCAAGTGGG - Intergenic
1157720776 18:49922440-49922462 ACAACCAAGCCACAGCATGTAGG - Intronic
1157742209 18:50103400-50103422 TTAACCAACCCACACCAGGTAGG - Intronic
1159501118 18:69271336-69271358 AAGTCCAAGCCACACCAAGTAGG + Intergenic
1160331918 18:78001535-78001557 GAAAGCAAGCCTTACAAAGTTGG - Intergenic
1166348503 19:42182041-42182063 GAAACGAAGGCACACAAAGCAGG + Intronic
1166588027 19:43968758-43968780 GGCTCCATGCCACACCAAGTGGG - Intronic
1166590078 19:43989649-43989671 GACAAGAAGTCACACCAAGTAGG - Intronic
926989478 2:18662236-18662258 AAAACCAAGCAACACAAAGTTGG + Intergenic
928370298 2:30735658-30735680 GAAACCAAGTGACCCCTAGTCGG + Intronic
932922255 2:75929754-75929776 GAAACCAAGCATCACAATGTGGG + Intergenic
937899609 2:127008536-127008558 GATACCAACTCACACCCAGTAGG - Intergenic
943354900 2:186841249-186841271 GAAAGAAAGCCACACAAAGCAGG - Intronic
944632255 2:201639258-201639280 GAAACCATGACACAGAAAGTGGG + Intronic
945011295 2:205466684-205466706 AAAACCAAGCCACACATATTAGG - Intronic
945745445 2:213714887-213714909 GAACCCAACCCCCACTAAGTAGG + Intronic
948080922 2:235204496-235204518 GAAGCCAAGCCAAACCACATGGG + Intergenic
1169738470 20:8863798-8863820 GAAGGCAAACCACACAAAGTTGG + Intronic
1170735735 20:19012775-19012797 GAAATCAAGCCAGGCCAAATGGG + Intergenic
1171309055 20:24131404-24131426 GAAACCCATCCAAACCAAGATGG - Intergenic
1173447076 20:43128783-43128805 GAAACCCAGCCAGACAGAGTGGG - Intronic
1173448208 20:43138840-43138862 GAAACCAAACCACAACCAGGTGG + Intronic
1173638273 20:44580227-44580249 GAAACCAAAGCACAGCAAGAAGG + Intronic
1174450628 20:50617901-50617923 GAAACCAGGCCAGACGCAGTGGG - Intronic
1176269525 20:64228629-64228651 GACACAAACCCCCACCAAGTAGG - Intronic
1177163051 21:17570173-17570195 GAAACCATGACACAGCAAGCAGG - Intronic
1178985448 21:37298969-37298991 GAAACCAGCACACACCAAGATGG - Intergenic
1179947314 21:44687076-44687098 GAAACCAAGCCACAGGACGAAGG + Intronic
1180652917 22:17393692-17393714 GAAACCACTTCACACCAACTAGG - Intronic
1181944683 22:26506940-26506962 GAAACAAAGCCCCACCAGGTCGG + Intronic
1183066249 22:35365125-35365147 GAAACCAAGGTCCAGCAAGTTGG - Intergenic
1183549448 22:38472898-38472920 GAGACCAAGCCTGACCAACTTGG - Intronic
1184258375 22:43300320-43300342 GAAACCACGCCACACCCACTAGG - Intronic
1184538681 22:45105336-45105358 GAAACCAAGCCCCACCCTATGGG + Intergenic
950218247 3:11174973-11174995 GAAACCAAGCCACACCAAGTGGG - Intronic
950543717 3:13626864-13626886 CAAACCAGGCCACAGCAAGGGGG - Intronic
950676587 3:14557845-14557867 GAAACTAAGGCACACTGAGTTGG - Intergenic
953902990 3:46853750-46853772 ACCACCAAGCCAAACCAAGTGGG + Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
955024140 3:55151022-55151044 GACCCCCAGCCACACCAAGGAGG + Intergenic
956623827 3:71247570-71247592 GAAATCAAGACACACCAGGCAGG + Intronic
958697763 3:97548207-97548229 GAAAACAAGACACACCCAGGAGG - Intronic
958829345 3:99068453-99068475 GAAGGCATGCCACACCATGTGGG - Intergenic
960242816 3:115365712-115365734 GACACAATGCCACACCAAGAGGG + Intergenic
962379256 3:134884002-134884024 TAAGCCAGGCCACACCAAGGTGG + Intronic
965675109 3:171186359-171186381 AAAACCAAGCCATACCCTGTTGG - Intronic
967493855 3:190121545-190121567 GACACACATCCACACCAAGTTGG - Intronic
968477581 4:819611-819633 GAAACCAAGTCTCCCCAAGTTGG + Intronic
969397613 4:6932877-6932899 GGAACCCAGCCACACCATGATGG - Intronic
969554879 4:7900467-7900489 GAAACCAACACAAACTAAGTCGG + Intronic
979305417 4:119136951-119136973 GAAATCAAGCTAAACCATGTGGG - Intronic
987605473 5:20129638-20129660 AAAACCAAGATAAACCAAGTAGG + Intronic
993363206 5:87003282-87003304 GAAACCAAGCCACCCCCAACAGG + Intergenic
994745294 5:103669971-103669993 GAGCCCAAGCGCCACCAAGTTGG + Intergenic
994791064 5:104225544-104225566 GAAACCGGGCTACACCACGTTGG - Intergenic
999549482 5:152670575-152670597 GAAACAAAGCTTCACCATGTTGG - Intergenic
1004633494 6:17444448-17444470 GAAACCAAGTTTCACCATGTTGG - Intronic
1006589181 6:35141571-35141593 GAAGCCGAGCCACACCCAGGAGG + Exonic
1010375858 6:75169252-75169274 GAAACTAAACCAAAGCAAGTCGG - Intronic
1012326483 6:97925758-97925780 GAAACCATGCCAAAACAGGTAGG - Intergenic
1013717739 6:112983540-112983562 GAAAAGAGGCAACACCAAGTTGG - Intergenic
1015323177 6:131898725-131898747 GACACAGACCCACACCAAGTTGG + Intergenic
1017061792 6:150491325-150491347 GAAACCTGGCCACACCACCTGGG - Intergenic
1019555462 7:1627622-1627644 GAGACCAAGCCACACTCATTGGG - Intergenic
1023762862 7:43483092-43483114 AAAACCAAGGCACAGCAAGCGGG - Intronic
1026143609 7:67726839-67726861 AAAACCCACCAACACCAAGTTGG - Intergenic
1029214972 7:98941360-98941382 GAGACCAGGTCACACCATGTTGG + Intronic
1029366844 7:100122073-100122095 GAAACCGAGGCACAGCAAGCAGG + Intronic
1035706050 8:1675810-1675832 AAAACAAAACCAAACCAAGTAGG - Intronic
1037377731 8:18250160-18250182 GCAACCAAGCAGCACAAAGTGGG + Intergenic
1044118110 8:88359415-88359437 GACACCACTTCACACCAAGTAGG - Intergenic
1051349651 9:16186871-16186893 GAAAGCAAACCAGACCATGTGGG - Intergenic
1185716648 X:2348064-2348086 GAACCCAAGCCAGGCCAATTGGG + Intronic
1187275849 X:17816210-17816232 CAAACCCAGTCACACCAAGGTGG - Intronic
1188559094 X:31447705-31447727 GAAAACAACCCAGACCAGGTGGG + Intronic
1193180925 X:78455908-78455930 CAAGACAAGCCACACCATGTGGG + Intergenic
1198007229 X:132507787-132507809 GAAACTAAGACACACCAAATTGG - Intergenic
1199538881 X:148935597-148935619 GAAACCAAGGATCACGAAGTTGG - Intronic
1202598870 Y:26572091-26572113 CAAACCCAGTGACACCAAGTTGG - Intergenic