ID: 950223206

View in Genome Browser
Species Human (GRCh38)
Location 3:11212479-11212501
Sequence AATCCAGGTAGAGGACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950223201_950223206 12 Left 950223201 3:11212444-11212466 CCCATCTGGGGCAGGCCTGGAAA 0: 1
1: 0
2: 0
3: 18
4: 180
Right 950223206 3:11212479-11212501 AATCCAGGTAGAGGACCCACTGG 0: 1
1: 0
2: 1
3: 11
4: 91
950223202_950223206 11 Left 950223202 3:11212445-11212467 CCATCTGGGGCAGGCCTGGAAAA 0: 1
1: 0
2: 0
3: 33
4: 233
Right 950223206 3:11212479-11212501 AATCCAGGTAGAGGACCCACTGG 0: 1
1: 0
2: 1
3: 11
4: 91
950223203_950223206 -3 Left 950223203 3:11212459-11212481 CCTGGAAAATCTACTCTGCAAAT 0: 1
1: 1
2: 2
3: 26
4: 257
Right 950223206 3:11212479-11212501 AATCCAGGTAGAGGACCCACTGG 0: 1
1: 0
2: 1
3: 11
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950223206 Original CRISPR AATCCAGGTAGAGGACCCAC TGG Intronic
901208651 1:7511963-7511985 AATCCAGATTCAGGAACCACAGG + Intronic
904732553 1:32606007-32606029 AACCCAAGCAGAGGAGCCACCGG - Intronic
907323240 1:53618849-53618871 AATCCAGGGAAAGGACCCCCAGG + Intronic
918005745 1:180540654-180540676 ACTCTAGGTAGAGGCACCACGGG - Intergenic
918427688 1:184426946-184426968 CATACAGGTAAAGGAACCACAGG + Intronic
921227175 1:213031885-213031907 AATCCAGGTTGAAGGCTCACTGG - Intergenic
1064625883 10:17260908-17260930 AATCTAGGTAGAGGAGTCAGGGG - Intergenic
1065724955 10:28660491-28660513 AAGACAGGGAGAGGACACACAGG - Intergenic
1067562351 10:47312705-47312727 CATCCAGGAAGAGGACCCCAAGG - Exonic
1070328352 10:75401953-75401975 AATCGAGGGAGGGGACACACAGG - Intergenic
1072463406 10:95641029-95641051 ATTCCAGGTAGAGGACAGGCAGG - Intronic
1073860441 10:107732371-107732393 AATCTATGATGAGGACCCACAGG + Intergenic
1075467504 10:122662540-122662562 AATCCTCGTAGAGGACCCTAAGG - Intergenic
1078728570 11:13955229-13955251 AATTCAAGAAGAGAACCCACGGG - Intergenic
1085319426 11:75564914-75564936 AATCCTGGTGGAAGACCCTCAGG - Intronic
1088823675 11:113476298-113476320 AATCCAGAGAGGGGACCCCCAGG + Intergenic
1090965447 11:131593934-131593956 AATCCATGTAAAAGATCCACTGG - Intronic
1093812029 12:23503074-23503096 AATGCAGGTAGAGGACGGGCGGG + Intergenic
1100397776 12:94199607-94199629 AAAGGAGGTAGAGAACCCACAGG - Intronic
1102182184 12:110920940-110920962 ATTCCAGGTAGAGGGCACACAGG - Intergenic
1104861792 12:131927899-131927921 TATGCAGGTAGAGAAACCACAGG - Intergenic
1109275502 13:60299311-60299333 AAGCCAGGTGGAGGATACACAGG - Intergenic
1120617596 14:86727113-86727135 CATCCACCTAGAGGACCCAATGG + Intergenic
1121240572 14:92427198-92427220 CATCCAGGCAGAGGTCACACTGG + Intronic
1135775191 16:25251945-25251967 AATCCCGGTAGAGGTCCCTTTGG + Exonic
1138555196 16:57766819-57766841 AAGCCAGGTCGAGGACCCCGAGG + Intronic
1141629757 16:85280902-85280924 AATTCAGCCCGAGGACCCACGGG - Intergenic
1142403165 16:89871631-89871653 TCTCCAGGGAGAGGATCCACAGG + Intergenic
1146762211 17:35488467-35488489 TATCCAGTTAGAGGAGCCACTGG - Intronic
1160490704 18:79334858-79334880 GTTCCAGGTAGGAGACCCACCGG + Intronic
1162944981 19:14037611-14037633 ATTCCAGGAAGAGGAAACACAGG - Intronic
1163847831 19:19647209-19647231 CCTCCAGGTAGAGGACGCTCTGG + Exonic
1167148541 19:47696204-47696226 AACCCAGGCAGAGGACACCCAGG + Intronic
1167520071 19:49949433-49949455 AAACCAGGCAGAGGAGGCACAGG - Exonic
1167676868 19:50892725-50892747 ACTCCAGGTACAGAACCCATGGG - Intergenic
1168367918 19:55805339-55805361 AATCCAGGCATAGAACACACGGG + Intronic
927410623 2:22821127-22821149 AATTGAATTAGAGGACCCACAGG + Intergenic
927489041 2:23508393-23508415 AAGCCCGGTAGAGGTCCCATCGG - Intronic
927490944 2:23520491-23520513 AATCCAAGGAGGGGACCTACTGG + Intronic
929413953 2:41728479-41728501 AAGGCAGGTAGAGGACCTATAGG + Intergenic
936976923 2:118229840-118229862 AGTCCAGGCAGAGAAGCCACTGG - Intergenic
945213777 2:207412047-207412069 AAGCCAGGAAGAGGGCCCTCCGG + Intergenic
948074645 2:235156433-235156455 AATCCAGGTGGAGGTACCAGCGG - Intergenic
948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG + Intergenic
1169392154 20:5198943-5198965 AATCAATCTAGAGGTCCCACTGG - Intergenic
1169764901 20:9138486-9138508 AAAACAGGGAGAAGACCCACTGG + Intronic
1172838964 20:37890677-37890699 AAACCAGGTAGAGGGCCCCAGGG - Intergenic
1173547003 20:43905355-43905377 AATCCAGGTGGTGGATACACAGG - Intergenic
1178052091 21:28759112-28759134 AAACCAAGTGCAGGACCCACTGG - Intergenic
1183684591 22:39354420-39354442 TATCCAGGCAGAGAACCCACAGG - Intronic
950223206 3:11212479-11212501 AATCCAGGTAGAGGACCCACTGG + Intronic
960210520 3:114959415-114959437 AATCCAGGTGGATTGCCCACTGG + Intronic
962407461 3:135112168-135112190 AATTCAGATAGAGGATCCAGAGG + Intronic
968941384 4:3640519-3640541 GCTCCAGGTGGAGGACCCCCGGG + Intergenic
969838251 4:9860876-9860898 AATCCAGGCAGAGGAGCAGCTGG - Intronic
976149092 4:82075287-82075309 AATCCAGGTTGAGTTCCCACTGG + Intergenic
976718267 4:88146249-88146271 AACCCAGCTAGGGAACCCACAGG - Intronic
979224269 4:118265976-118265998 GGTCCAGGTACAGGATCCACTGG + Intergenic
979951337 4:126897300-126897322 AATCCAGGCAGAGGATCCCAAGG + Intergenic
980541667 4:134203138-134203160 CAGGCAGGTAAAGGACCCACTGG + Intergenic
981156121 4:141438361-141438383 AATCAAGGTAGAAGACACAGAGG - Intergenic
983265599 4:165504870-165504892 AACCCAGGTTAAAGACCCACCGG + Intergenic
983784762 4:171716955-171716977 AATCCAGGAAAAGAACCCTCAGG + Intergenic
984658068 4:182341401-182341423 AATTAAGGAAAAGGACCCACAGG - Intronic
985609899 5:881610-881632 GATCCAGGAAGAGGAGGCACTGG + Intronic
985612020 5:894603-894625 ACAGCTGGTAGAGGACCCACAGG + Intronic
985664691 5:1175918-1175940 ACTCCAGGTACAGAACCCAGAGG - Intergenic
988744720 5:34123118-34123140 GGTCCAGGCAGAGAACCCACAGG + Intronic
989195915 5:38716081-38716103 AATCCAAGATGAGGACACACTGG - Intergenic
991997191 5:72399951-72399973 AATGCAGGAAAAGGACTCACAGG + Intergenic
998569433 5:143244202-143244224 TCTCCAGTTAGATGACCCACAGG + Intergenic
1001425853 5:171621938-171621960 ATTCCAGGTGGAAGACCCAGTGG - Intergenic
1002993440 6:2259226-2259248 ATGCCAGGTACAGGACCCAGGGG + Intergenic
1004766557 6:18734674-18734696 AATGCAGGTAGATTTCCCACAGG - Intergenic
1005831664 6:29675969-29675991 CATCCTGGTAAAGGACCCTCTGG + Exonic
1006255524 6:32829438-32829460 CATCCAGGATGAGGACCCGCGGG + Exonic
1008494438 6:52118375-52118397 GATCCAGCTAGAGGACTCACAGG + Intergenic
1015382886 6:132589566-132589588 AGGCCAGGTAGATGACCAACTGG + Exonic
1015715061 6:136183860-136183882 AATCAAGGTTGAGGACACAGGGG + Intronic
1019122050 6:169811562-169811584 CAGCTGGGTAGAGGACCCACAGG - Intergenic
1019812879 7:3177320-3177342 ATTCCTGGTAGAGGAACCACAGG - Intergenic
1035238411 7:157515055-157515077 GAGCCAGGCAGAGGACCCTCAGG + Intergenic
1035784114 8:2248774-2248796 ACTCCAGGAAGAGGAGCCAGGGG + Intergenic
1035784312 8:2249382-2249404 ACTCCAGGAAGAGGAACCAGGGG + Intergenic
1035808347 8:2471837-2471859 ACTCCAGGAAGAGGAACCAGGGG - Intergenic
1037084839 8:14836048-14836070 AATCAAGGTAGAGGGCCTAAAGG - Intronic
1042292009 8:67178703-67178725 ATTCCAGGAAGAGGCCCCAGTGG + Intronic
1042301385 8:67286276-67286298 AATCCAGATAAAGGACACACAGG + Intronic
1044200895 8:89434682-89434704 AATCTAGGTTTAGGACCCTCTGG + Intergenic
1044527590 8:93269113-93269135 AGCCCAGGTAGAGGAGGCACAGG - Intergenic
1046930655 8:119838683-119838705 AATCCAAGAAAAGGGCCCACTGG - Intronic
1047234747 8:123030661-123030683 AATCCAGTTCCTGGACCCACAGG + Exonic
1048370870 8:133775013-133775035 TCTCCAGGTAGAGGAACCAGCGG - Intergenic
1048692900 8:136988598-136988620 AACCCAGGCAGAGGCACCACTGG - Intergenic
1048885711 8:138907785-138907807 AAAACAGAGAGAGGACCCACAGG + Intronic
1049910193 9:258473-258495 AATCCAGGTAGAGGAGGGAGTGG + Intronic
1050890766 9:10821481-10821503 AATCCAGGTTGAGGACTAAAAGG - Intergenic
1055212328 9:73811749-73811771 AATCTAGGTAGAGCACCCATAGG - Intergenic
1058721494 9:107768554-107768576 AATCCAGGTTAAGGACCCCCTGG - Intergenic
1061714964 9:132513306-132513328 AATCCAGGTAGTGGGTTCACGGG - Intronic
1186481994 X:9903062-9903084 CATCCAGGAAGATGACCCTCAGG - Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1202180520 Y:22135964-22135986 AATCCTGTCAGAGGATCCACAGG + Intergenic
1202210840 Y:22450435-22450457 AATCCTGTCAGAGGATCCACAGG - Intergenic