ID: 950224907

View in Genome Browser
Species Human (GRCh38)
Location 3:11225504-11225526
Sequence TCTTTGGAGCACTCAGTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950224900_950224907 16 Left 950224900 3:11225465-11225487 CCCGAGGGATGATCAGGGAAGAG 0: 1
1: 0
2: 0
3: 25
4: 369
Right 950224907 3:11225504-11225526 TCTTTGGAGCACTCAGTGACGGG 0: 1
1: 1
2: 1
3: 11
4: 124
950224901_950224907 15 Left 950224901 3:11225466-11225488 CCGAGGGATGATCAGGGAAGAGG 0: 1
1: 0
2: 6
3: 46
4: 366
Right 950224907 3:11225504-11225526 TCTTTGGAGCACTCAGTGACGGG 0: 1
1: 1
2: 1
3: 11
4: 124
950224896_950224907 25 Left 950224896 3:11225456-11225478 CCAGGTAGCCCCGAGGGATGATC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 950224907 3:11225504-11225526 TCTTTGGAGCACTCAGTGACGGG 0: 1
1: 1
2: 1
3: 11
4: 124
950224899_950224907 17 Left 950224899 3:11225464-11225486 CCCCGAGGGATGATCAGGGAAGA 0: 1
1: 0
2: 0
3: 8
4: 116
Right 950224907 3:11225504-11225526 TCTTTGGAGCACTCAGTGACGGG 0: 1
1: 1
2: 1
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950224907 Original CRISPR TCTTTGGAGCACTCAGTGAC GGG Intronic
901225869 1:7612722-7612744 ACTGTGGACCACTCAGAGACAGG + Intronic
903446954 1:23428623-23428645 TCTTTTGAGCCCCCAGTGTCTGG - Exonic
910673247 1:89794503-89794525 TCTTTACAGGACTCAGTGACTGG - Intronic
915079896 1:153344967-153344989 TCCTGGGAGCTCTCAGAGACAGG + Intronic
915898239 1:159827717-159827739 GCTTTGGAGCTCTCAGGGCCAGG - Intronic
922788026 1:228293058-228293080 TCTCTGGAGCACTCTGTGGGGGG - Intronic
923120570 1:230986266-230986288 TCATTGGATCACTCGGTAACTGG + Intronic
923405974 1:233660815-233660837 TCTTAGGTGCTCTCAGTGAGAGG - Intronic
923642670 1:235780947-235780969 TATTTGGAGTAGTCATTGACTGG + Exonic
1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG + Intronic
1065740357 10:28791645-28791667 TGTTTGGAGCAATCAAGGACTGG - Intergenic
1065794439 10:29292846-29292868 TCTTTGGAGAAGTCAGCCACAGG - Intronic
1066019949 10:31288411-31288433 TCATTGGAGCATTCAGTCAGAGG + Intergenic
1069185367 10:65415717-65415739 GCTTTGGATGAGTCAGTGACTGG + Intergenic
1069332007 10:67303834-67303856 TCCTAGGAGAATTCAGTGACAGG - Intronic
1069705006 10:70453052-70453074 TCTTTGGTACAGTCAGTGCCTGG - Intergenic
1076012934 10:127004870-127004892 ACTATGGGCCACTCAGTGACTGG + Intronic
1076783177 10:132735666-132735688 TCCTTGGTGCCCTCAGTGGCAGG + Intronic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1078509559 11:11975479-11975501 TCCTGGGAGCACTCAGGGCCTGG - Intronic
1079330616 11:19529763-19529785 TCTTCAAATCACTCAGTGACCGG + Intronic
1079377221 11:19904284-19904306 ACTTTTGAATACTCAGTGACTGG - Intronic
1080524783 11:33104207-33104229 TCCTTGGAGTACTCACTGAGTGG - Intronic
1085170383 11:74444722-74444744 TCCTTGGAGCATCCAGTGATTGG + Intergenic
1086009013 11:82076272-82076294 TCTTAGGAACGCTCAGGGACAGG - Intergenic
1089002388 11:115062815-115062837 TCTCTGCAACACTCAGTGTCTGG + Intergenic
1090752783 11:129762128-129762150 TCTTTGGAAGTCTCAGTGAGGGG - Intergenic
1094039964 12:26112239-26112261 TCTTTGGATCACACAGTGCCTGG + Intergenic
1096663525 12:53145776-53145798 TCTATTGAGCCCTCAGTGATTGG + Intergenic
1097145473 12:56936646-56936668 TCTTTGTAGCACTCAGTGACCGG - Intergenic
1097151165 12:56980989-56981011 TCTCTGTGGCCCTCAGTGACCGG - Intergenic
1098975568 12:76898723-76898745 TCTTTCCAGCACTCTGTGCCTGG - Intergenic
1103888086 12:124217615-124217637 TCGTTAGAGGACACAGTGACAGG + Intronic
1106340544 13:28822618-28822640 TCTTTGGAGCCCTCTGGGAGGGG + Intronic
1110496650 13:76175418-76175440 TCTTGTGAGAACTCAGTGTCAGG + Intergenic
1112908966 13:104458647-104458669 TCCTTGCAGGACTCAGTCACTGG - Intergenic
1113234932 13:108261919-108261941 ACTTTTGAGCACTGAGTTACTGG - Intronic
1114928155 14:27431322-27431344 TCTTTGGAAAACTCCATGACTGG - Intergenic
1117780147 14:59223648-59223670 TCTTTGGGTCACTCAGTAAGTGG + Intronic
1118791019 14:69093204-69093226 TTTTTGGAGCACTGAATTACTGG + Intronic
1121072901 14:91040810-91040832 TCTGTAGAGCACTCAGTGCTTGG - Intronic
1121489024 14:94344617-94344639 TATTTGGGGCACTCAGTCCCTGG - Intergenic
1121635621 14:95452113-95452135 TCTTTGTACCTCTCAATGACTGG - Intronic
1123178571 14:106445294-106445316 TATTTGTAGTACTCAGTAACTGG - Intergenic
1125985961 15:44052339-44052361 TCTTTTGAGCACTTACTGTCTGG + Intronic
1128181320 15:65607565-65607587 TCTGTAGAGAACTCAGTGAGAGG + Intronic
1128442306 15:67722727-67722749 ACTTTGGAACACTCAGACACAGG - Intronic
1128651305 15:69415542-69415564 TGTTTTGAGCATTCAATGACTGG + Intronic
1130303299 15:82696619-82696641 TCTTTGCAGCATTCACTGTCAGG + Intronic
1131003494 15:88956880-88956902 TCTTTGGAGACCTGAGTGCCAGG + Intergenic
1135061669 16:19276217-19276239 TTTTTGGGTCACTCAGTGAATGG + Intergenic
1135895743 16:26400662-26400684 ACTTTGCAGCACTAAGTGAAAGG + Intergenic
1136871318 16:33810471-33810493 TCATTCCATCACTCAGTGACAGG + Intergenic
1140394564 16:74615578-74615600 TTTCTGGAAGACTCAGTGACAGG - Intergenic
1142262404 16:89049112-89049134 TCTGTGTAGGACTCACTGACTGG + Intergenic
1203100854 16_KI270728v1_random:1305587-1305609 TCATTCCATCACTCAGTGACAGG - Intergenic
1146546056 17:33739622-33739644 TCTCAGGAGCTCTCAGTGAGAGG - Intronic
1150121098 17:62603418-62603440 TTTTTGTATCACTTAGTGACAGG - Intronic
1152092650 17:78255646-78255668 TGTTGTGAGCATTCAGTGACTGG + Intergenic
1153052905 18:917020-917042 TCTTTGGAACACTCGGGCACTGG - Intergenic
1156461070 18:37321639-37321661 GCTTTGGAGCTCTGGGTGACTGG - Intronic
1159616388 18:70584652-70584674 TCAAAGGTGCACTCAGTGACTGG - Intergenic
1164262206 19:23577670-23577692 TCATTGGAGCAAACAGTGATTGG + Intronic
928444533 2:31321185-31321207 TGTTTGGAGAATTCAGAGACGGG - Intergenic
934924612 2:98373455-98373477 TCTTGGGGGCACTCAGCGAGGGG - Intronic
938582486 2:132659612-132659634 CCCTTGCAGCAGTCAGTGACAGG + Intronic
940340403 2:152574894-152574916 TTTTTGGAGGTCTCAGAGACTGG - Intronic
944795521 2:203180624-203180646 TCTGTGGATTACTTAGTGACAGG + Intronic
947529469 2:230899568-230899590 CCTTTGGATCACTCAGTGACAGG + Intergenic
947623956 2:231607822-231607844 TCTTGGGTTCACTCAATGACTGG + Intergenic
948368149 2:237472000-237472022 TGTGTGGAGCTCTCAGTGCCGGG - Intergenic
948577280 2:238963007-238963029 TCATTGGAACACCCAGTGCCAGG - Intergenic
1173143031 20:40501359-40501381 TATTTGGAGAACTCAGGGACTGG - Intergenic
1175356626 20:58374095-58374117 TCTGGGGAGGACTCAGTGAACGG - Intergenic
1177396066 21:20537957-20537979 TCTCTGAAGCTCTCAGTGAAGGG + Intergenic
950224907 3:11225504-11225526 TCTTTGGAGCACTCAGTGACGGG + Intronic
953917903 3:46932382-46932404 TCTTTAGAACACTCAATGGCTGG + Intronic
954785694 3:53090671-53090693 GGTTTGGGGCACTGAGTGACAGG + Exonic
955400614 3:58588515-58588537 TCTTTGGAGGCCTCATTGATTGG + Intronic
955617202 3:60821938-60821960 TCTTCGGAGTCCTCAGTGGCAGG + Exonic
956749759 3:72336399-72336421 ACTTAGGAGCCCTCGGTGACTGG + Intergenic
956959314 3:74379692-74379714 TCTTTGGAGCAAGGAGTGAAGGG - Intronic
961662402 3:128476543-128476565 TTTTTGGAGCACACAGTGCCAGG - Intergenic
964542620 3:157796415-157796437 TATTTAGAGCACAGAGTGACAGG - Intergenic
965022838 3:163256732-163256754 TCTTTTGAACAAACAGTGACAGG + Intergenic
967865094 3:194183561-194183583 TCTTTGGCCCACTGAGGGACTGG - Intergenic
971185450 4:24371497-24371519 TCTTTGGAGAAGACAGTGGCTGG - Intergenic
974535610 4:63170004-63170026 TCTTTGGAGCACTCAATTGTGGG + Intergenic
974709868 4:65576594-65576616 TATTTGGATAATTCAGTGACTGG - Intronic
978857208 4:113406719-113406741 TCCTTTGAGCAATCACTGACAGG + Intergenic
986518133 5:8584464-8584486 CCCTTGGTGCACTCAGAGACAGG - Intergenic
987761655 5:22171385-22171407 ACTATGGAGCAGTCAGTCACTGG - Intronic
988350334 5:30096753-30096775 TCTTTGGAGAAATTACTGACAGG + Intergenic
988422486 5:31023632-31023654 ACTTTGGAGCATTCAGTTAGAGG + Intergenic
989492540 5:42074365-42074387 TCTCTGGAGCAATCAGAGAGGGG + Intergenic
991896443 5:71404825-71404847 ACTATGGAGCAGTCAGTCACTGG - Intergenic
996185503 5:120468970-120468992 CCTTAGAATCACTCAGTGACTGG + Intronic
1000148423 5:158475899-158475921 TCCTTGAAGCACTTTGTGACAGG - Intergenic
1001215075 5:169848499-169848521 TCTCTAGAGCAGTCAGTAACAGG - Intronic
1001551370 5:172604400-172604422 TCTTTGGTACCCTCATTGACGGG - Intergenic
1003020235 6:2503143-2503165 TCTTCGGAGCACCCTGTGACTGG - Intergenic
1003860604 6:10319073-10319095 CCTATGGAGAGCTCAGTGACTGG - Intergenic
1018238262 6:161747264-161747286 TCTTTGGAGATTTCTGTGACAGG + Intronic
1018305045 6:162446000-162446022 TATTTGGAGCACTTTGTCACTGG - Intronic
1018768195 6:166950668-166950690 TCATTGGAGCACCCAGAGCCAGG - Intronic
1021692541 7:23244555-23244577 TCTATGTAGGACTCAGAGACAGG - Intronic
1024568622 7:50705833-50705855 AGTTTGGAGCACACAGTGTCTGG + Intronic
1026489191 7:70848197-70848219 TCTCTGGACCACTCAGTCCCAGG + Intergenic
1027056559 7:75053464-75053486 TCTTGGGAGCATTCAGCCACAGG + Intronic
1028381732 7:90207933-90207955 TCTTTGGAGTAATAAGTGATGGG - Intronic
1028722565 7:94050337-94050359 TATTGGGAGGACTCAGTGAGAGG - Intergenic
1031337023 7:120548100-120548122 TCTCTGGAGCATTTAGTTACTGG - Intronic
1031984965 7:128158219-128158241 AATTTGGAGCACTCAGTGTTGGG - Intergenic
1033298248 7:140160918-140160940 TCTTTGGAGCCCATGGTGACTGG - Intronic
1034942176 7:155237661-155237683 TGTTTGGAGCCCTCAGTGGCCGG - Intergenic
1035395612 7:158533035-158533057 GCTTGGGAGCACAAAGTGACAGG - Intronic
1039442343 8:37603688-37603710 TTTTTGGGGGAGTCAGTGACAGG + Intergenic
1039480178 8:37867391-37867413 TCTTTGTAGGACACATTGACAGG - Intronic
1041799604 8:61784891-61784913 TGTTTTGAGCACTAAGTGTCAGG - Intergenic
1047511122 8:125516499-125516521 TATTTGGGTCACTCAGTGAGAGG + Intergenic
1047790242 8:128195948-128195970 TCTTTTGGGCACTCAGTGCTGGG + Intergenic
1048811403 8:138290077-138290099 TCTATTGAGCACTCACTGAGAGG - Intronic
1049487907 8:142876033-142876055 TCTGTGGAGGACTCAGGGAAAGG - Intronic
1049731707 8:144181546-144181568 TCTTTGGGGCACTCCTTCACAGG + Intronic
1052894340 9:33733387-33733409 TCTTTGGAAGTCTCAGTGAGGGG - Intergenic
1052941197 9:34133090-34133112 TCTGTGGACCACTCAGTTATGGG + Intergenic
1057572020 9:96211682-96211704 TCCATGGAGTACTCAATGACTGG + Intergenic
1057807699 9:98232288-98232310 CCTTTGGAGCAGTCAGTGCCTGG - Intronic
1185892644 X:3835056-3835078 TCTGTGGGGCACTCAGAGACGGG - Intronic
1185897752 X:3873476-3873498 TCTGTGGGGCACTCAGAGACGGG - Intergenic
1185902871 X:3911907-3911929 TCTGTGGGGCACTCAGAGACGGG - Intergenic
1187343496 X:18442198-18442220 TCTTTAGAGCTCTGAGTGAGTGG + Exonic
1187468007 X:19543353-19543375 TTTTAGGAGCCCTTAGTGACTGG + Intronic
1188976872 X:36686240-36686262 GCTATGGAGCAGTAAGTGACTGG + Intergenic
1189672657 X:43427365-43427387 ACTATGGAGCACTCAGTGAGAGG + Intergenic
1195965828 X:110429322-110429344 TTTTTGGCAAACTCAGTGACTGG - Intronic
1198202193 X:134433167-134433189 TCTTTGGAGCATTTAATAACTGG + Intergenic
1199372599 X:147068832-147068854 ACTTTGGAGCACTGTGAGACTGG - Intergenic