ID: 950225126

View in Genome Browser
Species Human (GRCh38)
Location 3:11227232-11227254
Sequence TGGAACCGTAGTGGTTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950225120_950225126 11 Left 950225120 3:11227198-11227220 CCTGTAGTGCAGAGTTTTGAAGT 0: 1
1: 0
2: 3
3: 15
4: 123
Right 950225126 3:11227232-11227254 TGGAACCGTAGTGGTTGGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950225126 Original CRISPR TGGAACCGTAGTGGTTGGGA AGG Intronic