ID: 950226075

View in Genome Browser
Species Human (GRCh38)
Location 3:11235584-11235606
Sequence CCACCCCCATGGTGTCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950226075_950226082 4 Left 950226075 3:11235584-11235606 CCCTACTGACACCATGGGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 147
Right 950226082 3:11235611-11235633 AGGGCTTGTCACCACCTGACAGG 0: 1
1: 0
2: 0
3: 16
4: 113
950226075_950226084 17 Left 950226075 3:11235584-11235606 CCCTACTGACACCATGGGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 147
Right 950226084 3:11235624-11235646 ACCTGACAGGATGCAAGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 100
950226075_950226086 29 Left 950226075 3:11235584-11235606 CCCTACTGACACCATGGGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 147
Right 950226086 3:11235636-11235658 GCAAGTCCCGGCTCCCTGCTAGG 0: 1
1: 0
2: 3
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950226075 Original CRISPR CCACCCCCATGGTGTCAGTA GGG (reversed) Intronic