ID: 950226449

View in Genome Browser
Species Human (GRCh38)
Location 3:11238940-11238962
Sequence TATTCATAACCACCAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2532
Summary {0: 1, 1: 6, 2: 106, 3: 546, 4: 1873}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950226449_950226450 12 Left 950226449 3:11238940-11238962 CCACTTTTTGGTGGTTATGAATA 0: 1
1: 6
2: 106
3: 546
4: 1873
Right 950226450 3:11238975-11238997 TCTGCATACAAGTTTTTCTGTGG 0: 1
1: 1
2: 24
3: 127
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950226449 Original CRISPR TATTCATAACCACCAAAAAG TGG (reversed) Intronic
Too many off-targets to display for this crispr