ID: 950228828

View in Genome Browser
Species Human (GRCh38)
Location 3:11258402-11258424
Sequence TGAGGCCATGAGAGTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950228828_950228830 4 Left 950228828 3:11258402-11258424 CCAAGATGACTCTCATGGCCTCA 0: 1
1: 0
2: 0
3: 21
4: 167
Right 950228830 3:11258429-11258451 TCACTTCCTCACATCCTGTCAGG 0: 1
1: 0
2: 1
3: 39
4: 429
950228828_950228833 14 Left 950228828 3:11258402-11258424 CCAAGATGACTCTCATGGCCTCA 0: 1
1: 0
2: 0
3: 21
4: 167
Right 950228833 3:11258439-11258461 ACATCCTGTCAGGGAGAAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 257
950228828_950228831 5 Left 950228828 3:11258402-11258424 CCAAGATGACTCTCATGGCCTCA 0: 1
1: 0
2: 0
3: 21
4: 167
Right 950228831 3:11258430-11258452 CACTTCCTCACATCCTGTCAGGG 0: 1
1: 0
2: 2
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950228828 Original CRISPR TGAGGCCATGAGAGTCATCT TGG (reversed) Intronic
902114421 1:14109198-14109220 TGAGGTCATGAGAGTCAGCCAGG + Intergenic
905645734 1:39624040-39624062 TGAGGCCAGGGCAGTGATCTGGG + Intergenic
907589055 1:55648204-55648226 TGAGAGAATGAGACTCATCTAGG - Intergenic
909941933 1:81621276-81621298 GGAGACCATGGGAGCCATCTCGG - Intronic
910698116 1:90043440-90043462 TGAGAGCTTGAGAATCATCTTGG + Intergenic
911121636 1:94302566-94302588 AGGGGCCATGAGAGTCTTCTGGG - Intergenic
911591881 1:99758004-99758026 TGAAGCCCTCAAAGTCATCTTGG - Intronic
913221190 1:116661953-116661975 TGCGGCTAGAAGAGTCATCTTGG + Intronic
914341616 1:146764904-146764926 TGGGGCCACCAGAGTCATCTCGG - Intergenic
915057794 1:153151505-153151527 CTAGGCCATTAGAGTCATGTTGG + Intergenic
916254792 1:162775874-162775896 TGTGGTCATGAGAGTAACCTGGG + Intronic
916926390 1:169525280-169525302 TGAGGCCAGGAGTTTGATCTTGG + Intronic
920242147 1:204560887-204560909 TGAGGCCATGGCAGTAATCTGGG + Intergenic
920906862 1:210178784-210178806 AGAGGCCATTGCAGTCATCTAGG + Intergenic
921660011 1:217790213-217790235 TGAGCCCATGAAAGACAACTCGG + Intronic
922190823 1:223316891-223316913 TGAGGCAAGGAGAGGCACCTAGG + Intronic
923946554 1:238894461-238894483 TGTGGTCATGAGGGGCATCTGGG + Intergenic
1068910044 10:62369462-62369484 AGTGGTCATGAGAGTCACCTGGG + Intergenic
1070342466 10:75510530-75510552 TGAGGGTATGAGAGGCTTCTTGG + Intronic
1071285299 10:84139302-84139324 TGTGGGCATGGGAGTCGTCTCGG - Intergenic
1072044624 10:91642576-91642598 GGAGGGCATGAAAGCCATCTGGG - Intergenic
1073340827 10:102743418-102743440 TGAGACCAAGAGAGGCATCCTGG + Exonic
1075307403 10:121380302-121380324 TGGGAACATGAGAATCATCTGGG + Intergenic
1075797556 10:125131483-125131505 TGAAGCCATGAGGTTCATTTAGG + Intronic
1076604074 10:131678104-131678126 TGAGGGCATGTGAGTAACCTGGG + Intergenic
1078927229 11:15885885-15885907 TGAGTGCATGGGAATCATCTGGG - Intergenic
1079790686 11:24735223-24735245 TGAGAAAATGAGAGTCATGTTGG + Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1082843505 11:57709076-57709098 TGAGACAATGAAAGGCATCTGGG + Intronic
1086010334 11:82095350-82095372 TGAGGCCAGCAGTGCCATCTAGG + Intergenic
1087643263 11:100778207-100778229 TGTAGCCATGAGATTCTTCTTGG + Intronic
1088046570 11:105458794-105458816 GGAGGGCATGAGAGAGATCTGGG + Intergenic
1097250498 12:57630053-57630075 AGAGGGCATGGGAGGCATCTGGG - Intronic
1097927318 12:65143524-65143546 TGAGTGCATCAGAATCATCTTGG + Intergenic
1100085291 12:90902911-90902933 TAAGGCCATGTGGGTCACCTGGG + Intergenic
1100349729 12:93768814-93768836 GGAGGCCATGGGAGGCTTCTGGG - Intronic
1102625899 12:114235297-114235319 TGAGGCCAGGAGAATCAACAGGG - Intergenic
1103174106 12:118846946-118846968 TGATGACAGGAGAGTGATCTTGG + Intergenic
1104305287 12:127604916-127604938 TGTGGCCATGAGGGCCTTCTGGG + Intergenic
1105891566 13:24685912-24685934 TGAAGCCAGGAAGGTCATCTGGG + Intronic
1106440949 13:29769590-29769612 AGTGGGCATGAGACTCATCTAGG - Intronic
1107031972 13:35862436-35862458 TGAGGCCATTGTAGTCATCCTGG - Intronic
1107800186 13:44099185-44099207 TGAGGGCAAGGGAGTCATCAAGG - Intergenic
1113017866 13:105848600-105848622 TGAGGCAATGAAAGTCAGCTGGG + Intergenic
1113465163 13:110507586-110507608 GGAGGCCATCAGAGTTTTCTTGG + Intronic
1115662072 14:35506405-35506427 TTATGGCATGAGAATCATCTAGG + Intergenic
1118866436 14:69707896-69707918 TGAGGCAATGGGAGTGATTTTGG + Intronic
1121526950 14:94625726-94625748 TGAGGTCAGGAGAGAAATCTGGG + Intergenic
1121533059 14:94672024-94672046 AGAGGCCAGGAGAGGGATCTGGG + Intergenic
1122156713 14:99754392-99754414 TGAAGCTATGGGAGTCCTCTGGG + Intronic
1124554010 15:30708982-30709004 TGAGTCCCTCTGAGTCATCTGGG + Intronic
1124677235 15:31696689-31696711 TGAGTCCCTCTGAGTCATCTGGG - Intronic
1124866862 15:33500735-33500757 TGTAGCCATGAGAGTCCCCTAGG - Intronic
1124879795 15:33631425-33631447 TGAGGGCTTCAGTGTCATCTAGG - Intronic
1132179380 15:99740901-99740923 TAAGGCAATGAAAGTCACCTGGG - Intergenic
1133094939 16:3437686-3437708 GGAGGCCAGGAGAGTCTGCTTGG - Intronic
1134683690 16:16144128-16144150 TGGGGCCATGTGACTCATTTTGG - Intergenic
1134856456 16:17523979-17524001 TGGGGCCATGAGACTCATTCTGG - Intergenic
1135179548 16:20260869-20260891 TGAGGCCATGAGAGTCGTTATGG - Intergenic
1137764143 16:50964614-50964636 AGATAACATGAGAGTCATCTAGG - Intergenic
1139992662 16:70952538-70952560 TGGGGCCACCAGAGTCATCTCGG + Exonic
1140204646 16:72923685-72923707 TGAGGTCATGACAGAGATCTGGG - Intronic
1143186225 17:5012136-5012158 TCAGGAAATGAGAGTCAGCTAGG - Intronic
1143965349 17:10752963-10752985 TGAGGGCGTGTGAGTCAGCTTGG + Intergenic
1144738038 17:17565791-17565813 AGAGGCCATGAGAATTTTCTAGG + Intronic
1144785032 17:17826792-17826814 TGAGGCCATGAGGGAAATCCTGG + Intronic
1144787706 17:17840959-17840981 TGAGACCACGAGCGTCATCTAGG - Intergenic
1145256996 17:21330938-21330960 TGAGGCCACGTGACTCATCCTGG + Intergenic
1145755247 17:27385458-27385480 TGAGGCTAAGATAATCATCTTGG + Intergenic
1147697563 17:42367444-42367466 GGAGGCAAAGAGAGACATCTGGG - Intronic
1155474103 18:26220865-26220887 TGAGGCCAGGAGAGATATCTGGG + Intergenic
1156507479 18:37607509-37607531 TAAGGCCATTAAACTCATCTTGG + Intergenic
1158536760 18:58315281-58315303 TCAGGCTCTGGGAGTCATCTGGG - Intronic
1165067550 19:33237824-33237846 TGAGGCCAGGAGGAACATCTGGG - Intergenic
1165278184 19:34772859-34772881 TGAGGCCGTGAGAGTCGGCGAGG + Exonic
1165818352 19:38657694-38657716 TGAGGTTAGGAGAGGCATCTTGG + Intronic
1166855499 19:45780994-45781016 GGAGGCCAGGAGAGTCATTAGGG + Intronic
1167408655 19:49331766-49331788 TGAGGCCATGTGACTGGTCTTGG - Intergenic
927084100 2:19657246-19657268 TGAGCCCATGAGAGGCACCCTGG + Intergenic
930085304 2:47492957-47492979 TGAAGCCCTGGCAGTCATCTTGG - Intronic
931198906 2:60078102-60078124 TGAAGCCATGAGATTCAGCACGG + Intergenic
937761833 2:125613831-125613853 CGATGCCATGAGAGTAATGTTGG - Intergenic
942296776 2:174525168-174525190 TGCAGCAATAAGAGTCATCTTGG - Intergenic
946606563 2:221411602-221411624 TGAGCCCATTAAGGTCATCTTGG - Intergenic
946883075 2:224195515-224195537 TGAGGGCAGGTGAGTCAGCTTGG - Intergenic
947813222 2:233018108-233018130 TGAGGCCAGGAGAGTCTTAATGG - Intergenic
948697732 2:239741757-239741779 TAAGGCCATGGGGCTCATCTGGG - Intergenic
1169550510 20:6697133-6697155 TGAGGCAAAGAGTATCATCTGGG + Intergenic
1169689748 20:8317111-8317133 GGAGGCCATGACAGTAATGTAGG + Intronic
1174179011 20:48663210-48663232 TGAGGCCCAGAGAGGCATATGGG + Intronic
1175472825 20:59244619-59244641 TGAGGCCATCAGAGTTAGGTTGG + Intronic
1177491768 21:21834991-21835013 TAACGCAATGAGAGTCATTTAGG - Intergenic
1177692585 21:24530947-24530969 TGAGACAATGAGAGTAATCTGGG - Intergenic
1178382235 21:32120450-32120472 TGAGGCCTTGAGATTCAGATGGG - Intergenic
1178627785 21:34232724-34232746 TGAGGCCATGCAAGGCATTTCGG - Intergenic
1179478362 21:41662272-41662294 GGAAGCCAAGAGAGTCCTCTGGG - Intergenic
1183922086 22:41177581-41177603 GGGGGCCATGGGAGTCATCGGGG - Exonic
1184275733 22:43408642-43408664 AGAGGACATGAAAGTCATCATGG - Intergenic
1184449648 22:44575398-44575420 GGAGGCCCTGTGAGTCATCCAGG + Intergenic
1184991881 22:48175914-48175936 TGAGGTCATGTGACTCATTTTGG + Intergenic
1185070106 22:48651459-48651481 TGAGGCCTTGCGAGCCACCTGGG + Intronic
1185252626 22:49813034-49813056 TCAGGCCTGGTGAGTCATCTGGG - Intronic
949713359 3:6898096-6898118 TTAGGCCATGCGAGACATCCAGG + Intronic
950228828 3:11258402-11258424 TGAGGCCATGAGAGTCATCTTGG - Intronic
950388702 3:12679408-12679430 CGAGGCCAGGAGGGTCATATAGG + Intergenic
950469245 3:13174451-13174473 GGAGGCCATGGGGGTCAGCTGGG - Intergenic
950718847 3:14868279-14868301 TGTGGCCATGAGACTCAGGTGGG - Intronic
952325388 3:32315865-32315887 AGAGGGAATGAGAGGCATCTGGG - Intronic
953532608 3:43752193-43752215 TTAAGGCCTGAGAGTCATCTTGG + Intergenic
954532349 3:51332157-51332179 TAAGGTCATGAGAGTCACCTGGG - Intronic
956082813 3:65577788-65577810 TGATGCCATGGGAGGCTTCTGGG + Intronic
956853702 3:73255581-73255603 TCAGACCATTAGAGTCACCTGGG - Intergenic
957471287 3:80660292-80660314 TTAGGACATGTGAATCATCTTGG + Intergenic
958879057 3:99648857-99648879 CCAAGCCATGAGAGTCACCTAGG + Intronic
962843451 3:139255276-139255298 TGAGGCCCTGCGAGCCATGTGGG - Intronic
963586922 3:147203953-147203975 TGAGGCCATGAGATTGCACTGGG - Intergenic
964216151 3:154285538-154285560 TTAGGGAATGAGAGACATCTAGG + Intronic
967097137 3:186186416-186186438 GCAGCCCATCAGAGTCATCTGGG + Intronic
968702830 4:2064847-2064869 GGACGCCATGGGAGTCACCTGGG - Exonic
969348887 4:6586673-6586695 TGAGGCCAAGAGCTTCAACTTGG + Intronic
971728521 4:30345904-30345926 GGAGGTCAGGAGAGCCATCTTGG + Intergenic
971841640 4:31860195-31860217 TTAGGCCATAAGAGTCATCATGG - Intergenic
972950837 4:44320119-44320141 TGAGGGCAGTAGAGCCATCTTGG - Intronic
975203913 4:71623081-71623103 TGAGGACATGAGATTCATGAAGG - Intergenic
975296467 4:72740195-72740217 TGAGGACATGAGAATCATTGGGG - Intergenic
979120207 4:116889414-116889436 TGAGGTCATGAGGGTCATAATGG - Intergenic
979270816 4:118759393-118759415 TGAAGCCATGACAGTTATCTAGG - Intronic
981722230 4:147813242-147813264 AGAGGCCATGAGTGACAACTCGG - Intronic
984842815 4:184083558-184083580 TGAGGCCATAAGAGTGCTCTGGG + Intergenic
985102300 4:186470641-186470663 TGAGGTCAAGAGATTCATCTTGG - Intronic
986854178 5:11849727-11849749 AAAGGCCATGAGAATCATCCGGG - Intronic
989455759 5:41642095-41642117 TGAGGCCCTGAGAGTCAGAAAGG + Intergenic
990257097 5:53982069-53982091 TGAGGCTTTCAGAGTCATCCAGG - Intronic
990591870 5:57274091-57274113 AAAGGCCATTACAGTCATCTTGG - Intergenic
991194700 5:63919442-63919464 TGATGCCATGATAGACATATAGG - Intergenic
991711981 5:69416995-69417017 TGAGGCCATCTGAATCATGTAGG - Intronic
993126691 5:83844324-83844346 TGAGGCAATGAGAGTGAGATCGG - Intergenic
993910514 5:93677592-93677614 TGAGGTCATGAGATACATCAGGG + Intronic
994052991 5:95383031-95383053 AAAAGGCATGAGAGTCATCTAGG + Intergenic
994428670 5:99627862-99627884 TGAGTCCAGAAGTGTCATCTGGG + Intergenic
995286691 5:110397017-110397039 TCAGGTCATGAGAGTATTCTTGG + Intronic
997200553 5:132007565-132007587 TGAGGCCCTGAGACTCAGCGAGG - Intronic
998283052 5:140830385-140830407 AAAGGCCATGAGATCCATCTTGG - Exonic
998382654 5:141736671-141736693 GGAAGCCATGAGAGTGATTTGGG - Intergenic
998672704 5:144371712-144371734 TGAGGGCTTGAAATTCATCTTGG + Intronic
999241198 5:150128430-150128452 AAAGGCCATGTGAGGCATCTTGG - Intronic
1002320259 5:178371350-178371372 TGAGGATTTGAGAGTCAACTGGG - Intronic
1006669902 6:35723676-35723698 TGTGCCCATGAGAGCCATATTGG + Intronic
1006934554 6:37708266-37708288 TGAGGCCCTGAGGGTCTTCGGGG + Intergenic
1007739017 6:43999969-43999991 TGTGGGCATGAGAGGTATCTGGG + Intergenic
1008602894 6:53112860-53112882 AGAAGCCTTGACAGTCATCTGGG - Intergenic
1009538476 6:64922810-64922832 AGAGACTATGACAGTCATCTGGG + Intronic
1012480684 6:99663709-99663731 TGAGGCCTTGAGAGTCTTTTTGG + Intergenic
1012962628 6:105638576-105638598 AGAGACCATGAAAGTCATCCTGG + Intergenic
1013345169 6:109253116-109253138 TGAGGCCAGCTGAGTGATCTTGG - Intergenic
1014461088 6:121696496-121696518 TTAGCCCATGAGACTCATGTTGG - Intergenic
1014854945 6:126388664-126388686 GGAGGCCATTATAGTCATTTGGG + Intergenic
1015459737 6:133475892-133475914 AGAGGCCATGCGATACATCTGGG - Intronic
1015820608 6:137256557-137256579 TGAGGCCATGGTAGTCATCATGG - Intergenic
1018224310 6:161613197-161613219 TGAAGCCCTCAGAGTCATCCAGG - Intronic
1018490544 6:164288139-164288161 AGAGGCCATCACAGTGATCTAGG - Intergenic
1021216018 7:17915994-17916016 TGTGGTTTTGAGAGTCATCTTGG - Intronic
1026291027 7:69006262-69006284 TGAGACCATGAGGGATATCTGGG - Intergenic
1027946244 7:84749135-84749157 TGAGGCCAAGAGAGTTAACCTGG - Intergenic
1030975724 7:116120508-116120530 AGTGTGCATGAGAGTCATCTGGG - Intronic
1031931732 7:127692574-127692596 TGAGGGCAAGAGAGTGCTCTGGG - Intronic
1032193078 7:129775448-129775470 AGAGGCTACGAGAGGCATCTTGG - Intergenic
1032950391 7:136902529-136902551 TGAGTTCATAAGAGTCATCTAGG - Intronic
1037191395 8:16130101-16130123 TGAGGCTGTGAGAGTCAGCTGGG + Intronic
1039747744 8:40445373-40445395 ATAGCCCATGAGAGTCCTCTTGG - Intergenic
1042175996 8:66037346-66037368 TGAGGGCATGAGAGGCTTCGTGG + Intronic
1045438555 8:102188128-102188150 TTTGGCCATGTGAGTCAGCTGGG - Intergenic
1048390709 8:133961302-133961324 TGAGTCCCTGAGATCCATCTGGG - Intergenic
1049837238 8:144744574-144744596 TGAGGTCATGAGGGTCGTCATGG + Intronic
1060794020 9:126502826-126502848 GGAGGCCATGACAGTCAGCACGG + Intronic
1061451154 9:130667583-130667605 TGAGGTCAAGAGAGGCCTCTGGG - Intronic
1186839474 X:13470618-13470640 TTAGGCCCTCTGAGTCATCTTGG - Intergenic
1190605562 X:52139080-52139102 TGTGGCTGTGAGGGTCATCTGGG - Intergenic
1195624993 X:106998800-106998822 CCATGCCATGAGAGTTATCTTGG - Intronic
1196684839 X:118502114-118502136 TGTGCACATGAGAATCATCTGGG - Intronic
1197043607 X:121970083-121970105 TGGGGCCATGTGAGCCATCCTGG - Intergenic
1198035653 X:132798896-132798918 TGAGGCCATCACAGTCAGCTAGG - Intronic
1198575319 X:138004299-138004321 AGAGGCCATGAGAGTCAAAAAGG + Intergenic
1198642063 X:138767188-138767210 TGAGGCCAAGAAACTCAACTTGG - Intronic
1198967745 X:142244985-142245007 TGGGGTCATGAGGGTCAACTTGG - Intergenic
1199010605 X:142754112-142754134 TGAGGCCATGAGAGCCAGCCTGG + Intergenic
1199190244 X:144962305-144962327 TGAGGACATACCAGTCATCTCGG + Intergenic
1200259598 X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG + Intergenic
1201565084 Y:15357327-15357349 TAAGGGGATTAGAGTCATCTAGG - Intergenic