ID: 950229079

View in Genome Browser
Species Human (GRCh38)
Location 3:11260227-11260249
Sequence ATTCAAGACAGTATGTATCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950229074_950229079 18 Left 950229074 3:11260186-11260208 CCTGGATTACATCAAGTTTACTT 0: 1
1: 0
2: 1
3: 9
4: 154
Right 950229079 3:11260227-11260249 ATTCAAGACAGTATGTATCTGGG 0: 1
1: 0
2: 0
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950229079 Original CRISPR ATTCAAGACAGTATGTATCT GGG Exonic
904779733 1:32936833-32936855 CTTCAAGACAGTTTGTCCCTCGG + Exonic
908493041 1:64665513-64665535 ATTGAACTCAGTATATATCTGGG - Intronic
909097623 1:71307937-71307959 ATTCAAGATAGTAATTATCTTGG - Intergenic
909362806 1:74783960-74783982 ATTCAAGACAGTATCAGCCTGGG - Intergenic
909910897 1:81256507-81256529 TTTCAAGTCAGTGTGTAACTAGG + Intergenic
910347324 1:86255076-86255098 ATTGAAAACAGTATCTACCTAGG - Intergenic
910861979 1:91750680-91750702 CTTCAAGAGAGAATTTATCTGGG + Intronic
911537662 1:99119800-99119822 AGACATGACAGTATGTATGTTGG - Intergenic
912485513 1:110024398-110024420 ATGTAAGAAAGTATTTATCTTGG + Intergenic
914948717 1:152090639-152090661 TTTCAAGAAAGTATGTCTCTGGG + Intergenic
916839145 1:168582073-168582095 ATACAAGACAGCATGAATCTGGG - Exonic
917642147 1:176993320-176993342 ATTCAAGACAGTATAACTATTGG - Intronic
918211302 1:182353460-182353482 AATCAAGAAAGTATGTATTCAGG + Intergenic
918429344 1:184442762-184442784 ATTCAGCACAGAATGTATCCAGG - Intronic
918862020 1:189840886-189840908 ATTTAATACAGTATTTAGCTAGG - Intergenic
921234213 1:213108456-213108478 AATCAAGACAGTATGGTTCTAGG - Intronic
923754373 1:236777207-236777229 TTTAAAGGCAGCATGTATCTGGG - Intergenic
1063630796 10:7732038-7732060 ATTCAAGAGGGACTGTATCTAGG - Intronic
1063884206 10:10561528-10561550 AATTAAGACATTAAGTATCTTGG + Intergenic
1065846882 10:29751866-29751888 ATTCTAGACATTCTGTATTTAGG + Intergenic
1068313749 10:55314087-55314109 TTTCAAGACAGAATATATCTGGG - Intronic
1068743790 10:60505430-60505452 ATTAAAGACAAAATATATCTTGG - Intronic
1070317185 10:75325486-75325508 AATCAAGACAGTGTGGAGCTGGG - Intergenic
1077974188 11:7229609-7229631 TATCAAGATGGTATGTATCTTGG - Intergenic
1078810020 11:14750222-14750244 ATTCTATTCTGTATGTATCTAGG - Intronic
1079210908 11:18459983-18460005 AATCATGACAGTATGTAGCCGGG - Intronic
1080199711 11:29654657-29654679 ATTCAGGCCAGTGAGTATCTAGG + Intergenic
1080288304 11:30641455-30641477 ATTCAAGACAGTTTGTGGCGGGG - Intergenic
1080563607 11:33487449-33487471 ATTCAAGACCGTCTGGATGTTGG - Intergenic
1081433180 11:42998753-42998775 ATTCAAGAAAATATGTGTGTGGG + Intergenic
1081447093 11:43141082-43141104 ATTCCAGACAGTGTGTGTCAAGG - Intergenic
1081723486 11:45307192-45307214 ATTTAATACAGTGGGTATCTGGG + Intergenic
1087551300 11:99653501-99653523 TTTAAAGAAAGTGTGTATCTTGG + Intronic
1087603411 11:100344261-100344283 ATTCAGAAAAGTATTTATCTGGG + Intronic
1087779196 11:102285493-102285515 ATTAAAGGCAGTTTGTATTTTGG + Intergenic
1087995905 11:104808485-104808507 TTTAAAGAATGTATGTATCTTGG + Intergenic
1088673828 11:112170897-112170919 ATACTAGACTGTATATATCTTGG + Intronic
1090905766 11:131073342-131073364 ATACAAGACAGAATGAAACTGGG - Intergenic
1093645074 12:21576618-21576640 ATTAAAGAGATAATGTATCTAGG - Intronic
1095714802 12:45331946-45331968 ATTCAAGACAGTTTGAACCATGG - Intronic
1097788280 12:63785371-63785393 ATTGAAAACATTCTGTATCTTGG + Intronic
1098459499 12:70716613-70716635 ATACAAGACAGTAAGCACCTAGG + Intronic
1098502340 12:71207369-71207391 ATTCAAGACAGTTTGTAGAGGGG - Intronic
1099135258 12:78889995-78890017 ATTCAGTACAGTTTGCATCTGGG + Intronic
1100754778 12:97738881-97738903 ATTCAAGACTAGAGGTATCTGGG - Intergenic
1102769194 12:115458743-115458765 ATGCAAGTCAGTATATATGTTGG + Intergenic
1102912466 12:116727968-116727990 ACTCTAGACAGTATCTAACTTGG + Intronic
1103003517 12:117404292-117404314 ATACAAGACAGCATGTATTGAGG - Intronic
1104953387 12:132452421-132452443 ATTCAAGACAATATGTAAGAGGG - Intergenic
1108109517 13:47053698-47053720 ATTCAAACCAGTATATTTCTTGG - Intergenic
1110851900 13:80255788-80255810 AATCAAGACAGCATGTCTCCTGG - Intergenic
1111028050 13:82560105-82560127 ATTTAAGACAATATGTATTATGG - Intergenic
1111256310 13:85673837-85673859 ATTCAAGACAACATGGAACTGGG + Intergenic
1113075326 13:106462358-106462380 AATCAACACAGTGTGCATCTCGG - Intergenic
1114276303 14:21148563-21148585 AATCAAGACAGTGTGGTTCTGGG + Intergenic
1118047169 14:61982888-61982910 CCTCCAGACAGGATGTATCTTGG - Intergenic
1123663140 15:22583774-22583796 ATTAAAGACTGAATGTATCAAGG + Intergenic
1124316942 15:28678077-28678099 ATTAAAGACTGAATGTATCAAGG + Intergenic
1125071824 15:35563988-35564010 ATCAAAGACAGTATTTATTTTGG - Intergenic
1135229884 16:20696734-20696756 GTTCAAGGCACTATGTATCTGGG - Intronic
1135289434 16:21222584-21222606 AGTCAACACAGCATGTTTCTGGG + Intergenic
1138518636 16:57556217-57556239 CTTGAAGACAGTATGTAGTTAGG + Intronic
1138930262 16:61646206-61646228 ATTCAAGATAATATGTTCCTTGG + Intergenic
1139493512 16:67300014-67300036 ATGCCACACAGTATGTCTCTGGG - Intronic
1139845041 16:69914874-69914896 TTCCAAGACAGGATGTATCAAGG - Intronic
1142911284 17:3093867-3093889 ATTCAAAAGAGTATATAGCTTGG - Intergenic
1145734427 17:27217147-27217169 ATTCCAGACTGTATTCATCTTGG + Intergenic
1148247077 17:46039498-46039520 ATTCTAGACACCATGGATCTTGG - Intronic
1150519269 17:65849319-65849341 ATGCAAGACAGTGTGAATTTGGG - Intronic
1156376203 18:36517376-36517398 CTTCAAGACAGTGTGAATCTTGG - Intronic
1157823885 18:50794837-50794859 ATTCCAGACAGTAGGAATCGAGG + Intergenic
1159438521 18:68448012-68448034 TTTCATGACACTTTGTATCTGGG + Intergenic
1165489089 19:36113079-36113101 AATCAAGACATGATGTCTCTCGG + Intronic
1166632508 19:44419454-44419476 ATTTAAGACAGTCTGTTACTTGG + Intronic
926666516 2:15529760-15529782 ATTCAAGACAATGTGAAGCTAGG + Intronic
927453977 2:23233285-23233307 ATTAAGCACAGTATGTAACTTGG - Intergenic
927798234 2:26071323-26071345 ATTCAAGACAGTATCTGCCAAGG - Intronic
928448551 2:31355851-31355873 CTTGAAGACAGTATGTAATTGGG - Intronic
931079144 2:58750035-58750057 AGTCAAGAGAGGATGTATCATGG - Intergenic
934803903 2:97198596-97198618 ATTCAAAACAGAATCTTTCTCGG - Exonic
934804595 2:97207944-97207966 ATTCAAAACAGAATCTTTCTCGG - Exonic
936225649 2:110647801-110647823 ATTCAACACAGTATGTCTTCAGG + Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936558131 2:113513677-113513699 ATTCCAGACAGTGTGTGTCAAGG + Intergenic
937190172 2:120088091-120088113 AGTCTAGACACTATGTATATGGG + Intronic
939031661 2:137083642-137083664 ATTCAAAAGAGAATCTATCTGGG - Intronic
939299851 2:140321132-140321154 ATTCAAGACATTAGGTATAATGG - Intronic
940262498 2:151796263-151796285 ATTCAAGTCAGCATGTCACTGGG + Intronic
941234762 2:162957315-162957337 ATTCAAGGCAGTTTGCAACTTGG + Intergenic
942405037 2:175645130-175645152 AATCAAGACAGTGTGTGGCTGGG - Intergenic
942968283 2:181924388-181924410 ATTTAGTACAGTATGTATTTAGG - Intronic
945282473 2:208048687-208048709 ATTCAAGGAAGTTTTTATCTTGG + Intergenic
947221524 2:227797620-227797642 TTTCAACAGAGTATGTATCATGG + Intergenic
1169453317 20:5730761-5730783 GTCTAAGACAGCATGTATCTAGG + Intergenic
1170208624 20:13825694-13825716 ATTCTAGACAGAATGAATTTCGG + Intergenic
1171340644 20:24424832-24424854 ATTCATGACACTGAGTATCTAGG + Intergenic
1174455467 20:50645666-50645688 ATGCAAGACAGGAAGGATCTAGG - Intronic
1174931729 20:54823457-54823479 ATTCAGGCAAGTATGTATTTAGG - Intergenic
1175168588 20:57063650-57063672 AATAAAGTCAGGATGTATCTTGG + Intergenic
1175693765 20:61085685-61085707 ATTCAAGAGACTTTGAATCTTGG + Intergenic
1177005271 21:15664698-15664720 AGTAAAGCCAGTATGTTTCTTGG + Intergenic
1178472360 21:32904891-32904913 ATTCAATCAAGTATGAATCTGGG - Intergenic
1178727171 21:35064078-35064100 ATTCAGGACAGTGTGGATCATGG + Intronic
1180830211 22:18901546-18901568 AATCAAAACAGAATGTATTTTGG - Intergenic
1184639776 22:45864346-45864368 ATTCAATGCAGTAAGTTTCTTGG - Intergenic
1203280300 22_KI270734v1_random:126817-126839 AATCAAAACAGAATGTATTTTGG - Intergenic
949730829 3:7110875-7110897 ATTCAACACAGCATGTATGCAGG + Intronic
950229079 3:11260227-11260249 ATTCAAGACAGTATGTATCTGGG + Exonic
953486817 3:43307272-43307294 ATTTAAGGCAATATGTATCAAGG - Intronic
954294572 3:49667012-49667034 ATTCATGACAGTACCTACCTTGG + Intronic
956245918 3:67182839-67182861 ATGCAAGGAAGTATGTAACTGGG + Intergenic
957570336 3:81939379-81939401 ATAGAAGACAGAATGTATGTGGG - Intergenic
957913802 3:86659540-86659562 ATTCAAGAGAAGATATATCTGGG + Intergenic
957915189 3:86679607-86679629 TTTGAAGAAAGTATGTTTCTTGG + Intergenic
959813412 3:110646275-110646297 AGTCAAAAAAGTATGTATGTGGG - Intergenic
962323424 3:134410373-134410395 TTTCAAAACAGTAGGTATCATGG + Intergenic
963460600 3:145609463-145609485 CTTGTAGACAGTATATATCTGGG + Intergenic
963626288 3:147678234-147678256 ATTCAGGCCAATATGTATCTTGG - Intergenic
964193404 3:154033007-154033029 ATTAAAGATAGGATGTAGCTAGG - Intergenic
964836383 3:160942646-160942668 ATGAAAGACAGTATGAGTCTTGG + Intronic
965768168 3:172153427-172153449 ATTCAAGACAGTCTGGAGCAAGG - Intronic
970802230 4:19986730-19986752 ATTCAAGACTGAAGTTATCTGGG + Intergenic
973196034 4:47443053-47443075 ATTCAAGACACCAAGTATCAGGG + Intergenic
973235162 4:47894095-47894117 ATTCAAGACAGCACTTATTTGGG + Intronic
973967034 4:56173318-56173340 ATTCAAGAATGAATGTATCTGGG - Intronic
978401594 4:108336562-108336584 ATTCAGGACAGTAATTATCTTGG - Intergenic
980854864 4:138427260-138427282 ATTCTAGGCAGTAAGTATGTAGG - Intergenic
981803173 4:148681654-148681676 ATTGAATACACTCTGTATCTAGG - Intergenic
982170032 4:152653007-152653029 ATTTATCACAGAATGTATCTAGG - Intronic
982627685 4:157787912-157787934 ATTTAATACAATATGTACCTAGG + Intergenic
990392594 5:55341313-55341335 ATTTTAGAAAGTATGAATCTTGG + Intronic
992356760 5:75993725-75993747 AGGCAAGACAGTAGGTATTTTGG - Intergenic
992421195 5:76606809-76606831 ATTCAAGAAAGCATGTTTCAGGG - Intronic
992882043 5:81119967-81119989 GTCCAAGATTGTATGTATCTAGG + Intronic
996522695 5:124444860-124444882 ATTCATGAAGGTATGTATCCTGG - Intergenic
999472587 5:151868861-151868883 ATTCAAGACACAAAGCATCTGGG - Intronic
1000147033 5:158463381-158463403 AATCAAGACAGAATTTTTCTGGG + Intergenic
1000187959 5:158879187-158879209 GTTCAGTACAGTATGTAACTGGG + Intronic
1003192472 6:3886708-3886730 ATTTAAAACAGTATGCATGTAGG - Intergenic
1003544737 6:7050400-7050422 ATTCAAAACTGTGTATATCTGGG + Intergenic
1003814861 6:9827955-9827977 ATTCCTGACAGTAGGTATTTTGG - Intronic
1003904858 6:10689778-10689800 ATCCAAGACAGAATGAGTCTAGG + Intronic
1005635117 6:27745677-27745699 ATTCAAGACAGTCAGGAGCTGGG + Intergenic
1010617760 6:78033626-78033648 ATTCAAGACAGTGGGAATATTGG - Intergenic
1011618410 6:89219356-89219378 ATTCAACACCGTATGGCTCTAGG + Intronic
1012301493 6:97594111-97594133 AATCAAAACAATATGTTTCTGGG - Intergenic
1012749767 6:103143198-103143220 ATTCAAGACAGGTTGGTTCTGGG + Intergenic
1016728691 6:147404854-147404876 TTTGTAGACTGTATGTATCTAGG + Intergenic
1017621328 6:156301911-156301933 AATCAAGACAGTGTATTTCTTGG + Intergenic
1018033027 6:159858694-159858716 ATACAAGGCAATATGTAACTAGG - Intergenic
1019158948 6:170056916-170056938 CTTCAAGACAGTTTGGCTCTTGG - Intergenic
1019566632 7:1684302-1684324 CTTCTAGACAGTATATATTTGGG + Intergenic
1020495681 7:8850407-8850429 ATTAAAAACAGTACATATCTTGG + Intergenic
1020963204 7:14831939-14831961 ATTCAATAAAGAATATATCTCGG + Intronic
1026634028 7:72065559-72065581 ATTCATTACAGTATGTATTCTGG + Intronic
1028174725 7:87641690-87641712 TTTCAAAACAATATGTATTTTGG - Intronic
1028224615 7:88235366-88235388 CTTGTAGACAGTATGTACCTGGG + Intergenic
1028741165 7:94277486-94277508 AATCAAGTCAGTCTTTATCTAGG - Intergenic
1035067412 7:156117285-156117307 ATTCACTAAAGTATGTATCATGG - Intergenic
1041544189 8:59022852-59022874 CTTCAAGACAGCATTTGTCTAGG - Intronic
1041808159 8:61877229-61877251 ATTTAAGAGAATATGTATTTTGG + Intergenic
1042881225 8:73492475-73492497 TTTCAAGAGAGTACTTATCTAGG - Intronic
1045803754 8:106132453-106132475 ATTCAAAACGGTATTTTTCTTGG + Intergenic
1046270382 8:111888939-111888961 TCTCATGTCAGTATGTATCTTGG + Intergenic
1046444581 8:114300596-114300618 ATTGATGACAGTATTTATCAGGG + Intergenic
1046551650 8:115725184-115725206 AGGAAAGACAGTATGAATCTTGG + Intronic
1049894730 9:102589-102611 ATTCCAGACAGTGTGTGTCAAGG - Intergenic
1051810868 9:21048237-21048259 CTTCAACACAGTATGCTTCTAGG - Intergenic
1053735938 9:41102580-41102602 ATTCCAGACAGTGTGTGTCAAGG - Intergenic
1054692435 9:68328819-68328841 ATTCCAGACAGTGTGTGTCAAGG + Intronic
1055183565 9:73420954-73420976 ATCCAAGATATTATTTATCTTGG - Intergenic
1056021880 9:82446404-82446426 CATGAAGACAGGATGTATCTAGG + Intergenic
1058063735 9:100526304-100526326 ATGGAAGTCAGTAAGTATCTAGG - Intronic
1058946633 9:109863331-109863353 TTTCAAGAAAGTAAGTGTCTAGG + Intronic
1059110169 9:111550213-111550235 ATTCAAAAAACTGTGTATCTAGG - Intronic
1061779586 9:132987735-132987757 ATTCCTGGCAGTAAGTATCTGGG + Intronic
1186094383 X:6083706-6083728 ATCCAACAGAGTTTGTATCTTGG + Intronic
1186270023 X:7877092-7877114 ATTCAAGAAAGTGTGGATCCAGG + Intergenic
1187607608 X:20903703-20903725 CTTGAAGACAGCATGTATTTGGG + Intergenic
1187659829 X:21531334-21531356 GTTCAAGACAGTAGGTATAATGG - Intronic
1188585340 X:31767624-31767646 ATACAAAACAGAATGTTTCTTGG - Intronic
1193534757 X:82700023-82700045 ATTCAACAGTGTTTGTATCTAGG - Intergenic
1194431238 X:93809302-93809324 ATTCAAGACAGCTTATATTTTGG - Intergenic
1198040173 X:132842976-132842998 ATACAACACAGTATGCTTCTAGG + Intronic
1200297165 X:154932004-154932026 ATTCAGGAAAGTATTTATATTGG + Intronic