ID: 950230242

View in Genome Browser
Species Human (GRCh38)
Location 3:11269921-11269943
Sequence CTTTGTGAGGTGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143515
Summary {0: 1, 1: 66, 2: 1591, 3: 30095, 4: 111762}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950230235_950230242 16 Left 950230235 3:11269882-11269904 CCTTGCTGGGCAAGGTGGCTCAC 0: 2
1: 53
2: 1118
3: 4031
4: 8802
Right 950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG 0: 1
1: 66
2: 1591
3: 30095
4: 111762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950230242 Original CRISPR CTTTGTGAGGTGAAGGTGGG AGG Intergenic
Too many off-targets to display for this crispr