ID: 950230913

View in Genome Browser
Species Human (GRCh38)
Location 3:11275061-11275083
Sequence CAGTGGAGATGGAGAGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1026
Summary {0: 1, 1: 6, 2: 21, 3: 149, 4: 849}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950230906_950230913 14 Left 950230906 3:11275024-11275046 CCAGGTGACAGGATGAAGATCTG 0: 1
1: 0
2: 0
3: 23
4: 382
Right 950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG 0: 1
1: 6
2: 21
3: 149
4: 849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950230913 Original CRISPR CAGTGGAGATGGAGAGGAGT GGG Intronic
900015739 1:147921-147943 CAGTGAAGATGTGGAGGAATTGG + Intergenic
900046002 1:506519-506541 CAGTGAAGATGTGGAGGAATTGG + Intergenic
900068204 1:748230-748252 CAGTGAAGATGTGGAGGAATTGG + Intergenic
901428328 1:9197680-9197702 GACTGGAGAGGGAGAGGAGGAGG - Intergenic
902571526 1:17350068-17350090 TAGTGGAGAAGGCTAGGAGTTGG - Intronic
902729078 1:18356986-18357008 GAATGGAGATGGAGTGGAGATGG + Intronic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903026143 1:20430962-20430984 GAGAGGAGGTGGAGAGGAGACGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903539773 1:24090344-24090366 AAGTGGAGACAGAGAGGAGGAGG + Intronic
903572694 1:24318112-24318134 CAGAGAAGAGAGAGAGGAGTGGG + Intergenic
904317045 1:29672312-29672334 CCCTGGAGATGGAGATGGGTAGG + Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904990550 1:34589309-34589331 CCTTGGAGATGGAGAGGTCTGGG - Intergenic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905456870 1:38094420-38094442 CAGAGAAGGTGGAGAGGAGATGG + Intergenic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907831426 1:58068054-58068076 AAGTGGAGATGCTGAGGAGAGGG + Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
908098166 1:60762448-60762470 CAGTGCAGTGGGAGAGGAATGGG + Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908982621 1:69977048-69977070 CAATGGAGATGCAGAGTATTGGG - Intronic
909132490 1:71755260-71755282 CAGTGGAGGTGAAGAGGACTCGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909579490 1:77218390-77218412 CAGTGGAACTGGAGAGGTGAGGG + Intronic
909756055 1:79227442-79227464 TAGCGGTGATGGAGAGGAGGTGG - Intergenic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
909914235 1:81298052-81298074 CAGAGAAGATGGAGAGGACTGGG + Intergenic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910313584 1:85856679-85856701 CAGTGGAGGTGGGGAAGAGTAGG - Intronic
910520083 1:88110891-88110913 CAGTGGAAATGGACAGGAAGTGG - Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
911251905 1:95585895-95585917 AAATGAAGATGGAGAGGAGGGGG - Intergenic
911294212 1:96094124-96094146 CAGTGGAAAGGGAGAGGTATTGG + Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
912185243 1:107267563-107267585 CAGTGGAATTTGAGAGGATTAGG - Intronic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912717052 1:111990096-111990118 CAGTGGAGGAAGAGAGGAGGAGG + Intergenic
912945512 1:114081011-114081033 AAGTGGAGGTGGAGGTGAGTGGG + Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
914943344 1:152042225-152042247 AGGTGGAGAAGGAGAAGAGTGGG + Intronic
915369595 1:155337481-155337503 TAGTGGAGAGGGAGAGGAAAGGG - Exonic
915482402 1:156195868-156195890 GAGTAGAGGTGGAGAGGAGGAGG + Intronic
915491377 1:156251795-156251817 CAGAGCAGATGCAGAGGAGGGGG + Intronic
915564628 1:156706653-156706675 CAGTGGAGATGGCAGGGAGACGG + Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915594588 1:156888812-156888834 CAGTGGAGGTGCTGAGGAGTGGG - Intergenic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915892332 1:159783540-159783562 CAGTGGAGACATAGAAGAGTGGG + Intergenic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916006372 1:160664901-160664923 CAGAGGAAGTGGAGAGGGGTTGG - Intergenic
916240247 1:162632175-162632197 AAGTGGAGATGGATATGGGTGGG + Intronic
916489065 1:165285615-165285637 CAGTGGAGATGGTGAACAGCTGG - Intronic
917042580 1:170822442-170822464 CACTAGAGATGGAGGGGAGATGG - Intergenic
917073179 1:171175012-171175034 GAGGGGAGATGGGGAGGAGAGGG + Intergenic
917136006 1:171788728-171788750 CACTGGAGACGGAGAGGTGAGGG - Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917481429 1:175415317-175415339 CAGCGCTGATGGAGAGGAGCTGG - Intronic
918305580 1:183243157-183243179 CAGTGTAGATGAAGAGGGGCTGG + Exonic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918691290 1:187483359-187483381 CAGTGGAGATGGAGGGGTTTGGG - Intergenic
919158879 1:193803050-193803072 GAATTGAGATGGAGAGGAGTTGG + Intergenic
919586987 1:199451296-199451318 CAGGGGAGTAGAAGAGGAGTGGG - Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
920010371 1:202862591-202862613 AAGTGGGGATGAAGAGGAGATGG - Intergenic
920106298 1:203555901-203555923 CAGGAGAGACGGAGAGGAGGGGG + Intergenic
920323445 1:205142419-205142441 CAGTGGAAATGGAATGGATTAGG + Intergenic
920362515 1:205429150-205429172 CATTGGAGATGGAGGTGGGTTGG - Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
922009741 1:221571015-221571037 CACTAAAGATGGAGAGGATTTGG - Intergenic
922103568 1:222493617-222493639 CAGTGAAGATGTGGAGGAATTGG + Intergenic
922263882 1:223966132-223966154 CAGTGAAGATGTGGAGGAATTGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923271258 1:232357172-232357194 CAGTGGAGGTGGTGAGGCGTGGG + Intergenic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923891204 1:238216741-238216763 CAGTGGGGAAGGAGTAGAGTAGG + Intergenic
924345729 1:243071128-243071150 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1062916383 10:1243784-1243806 CAGTGGACATGGGCAGGAGGCGG - Intronic
1063330018 10:5148232-5148254 CATAGGAGATAGAGAGGAGGAGG + Intergenic
1063371708 10:5526584-5526606 CACTAGAGATGGTGAGGGGTTGG + Exonic
1063972474 10:11390853-11390875 CAATGGAGATAGAGAGTAGAAGG + Intergenic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1065204553 10:23344346-23344368 GAGTGGAGAGGGGGAGGAGGAGG + Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065886825 10:30085671-30085693 CAGTGGAGATGGGGAGTGATAGG + Intronic
1066730611 10:38433687-38433709 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068714866 10:60177005-60177027 CAGTGGAGATGGTGAAATGTAGG - Intronic
1068795828 10:61078970-61078992 ATGTGGAGATGGAAATGAGTTGG + Intergenic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1069706263 10:70460575-70460597 CAGAAGAGATGGGGAGGAGCAGG - Intergenic
1069882461 10:71602282-71602304 CAGGGAAGATGGAGAGGGCTCGG + Intronic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070109193 10:73466077-73466099 AAGTGAAGATGGAGAACAGTAGG - Intronic
1070277567 10:75022063-75022085 CAGTGAAGAAGAAGAGGAGGAGG + Exonic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070774808 10:79103397-79103419 CAAAGGAGCTGGCGAGGAGTGGG + Intronic
1071841484 10:89476507-89476529 CACTGGAGATAGTGGGGAGTGGG - Intronic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073054666 10:100691613-100691635 CACTGGAGCTGGACAGGTGTTGG + Intergenic
1073113142 10:101074510-101074532 CAGCGGGGATGGAAAGGAGAGGG + Intergenic
1074237470 10:111600293-111600315 AAGTGAAGATAGAGAGGAGATGG + Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1074614998 10:115058935-115058957 CAGAGCAGAAAGAGAGGAGTGGG - Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075317440 10:121464387-121464409 CAGATGACATGCAGAGGAGTTGG - Intergenic
1075719146 10:124574865-124574887 GAGTGGAGAAGGACAGCAGTGGG - Intronic
1075820381 10:125302958-125302980 TAGTGGAGATGAAGAAGAGGGGG - Intergenic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1075969219 10:126638536-126638558 GAGAGAAGATGTAGAGGAGTGGG - Intronic
1075993651 10:126859368-126859390 TAGTGGAGATGAAGAGGAAGAGG - Intergenic
1076619778 10:131779781-131779803 TCGTGGAGATGGAGAGGCCTTGG - Intergenic
1076899720 10:133332190-133332212 CATTGGAAATGGAGAGGTGTGGG + Intronic
1076972330 11:142991-143013 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287764 11:1775384-1775406 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287774 11:1775417-1775439 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287780 11:1775439-1775461 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287807 11:1775517-1775539 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287835 11:1775606-1775628 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287845 11:1775639-1775661 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287851 11:1775661-1775683 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287866 11:1775706-1775728 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287932 11:1775885-1775907 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287946 11:1775929-1775951 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287973 11:1776007-1776029 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287988 11:1776052-1776074 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288006 11:1776107-1776129 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288021 11:1776152-1776174 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288032 11:1776186-1776208 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288047 11:1776231-1776253 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288062 11:1776276-1776298 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077699952 11:4432040-4432062 CAGTGGAGGTGCAGAGGACCAGG + Intergenic
1077865514 11:6218318-6218340 CAGTGGTGATGGTGGTGAGTGGG - Intronic
1078360519 11:10664290-10664312 GAGTGGAGATGAACAGGAGGCGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1079892872 11:26079938-26079960 GAGAGGAGAGGGAGAGGAGAGGG + Intergenic
1080056939 11:27916280-27916302 TAATGGAGATGGAAAGGAGGGGG + Intergenic
1080514431 11:33006899-33006921 AAGTGGAGATGTAGTGGAGTTGG + Intergenic
1080557368 11:33429919-33429941 CAGAAGAGATGGTGAGGGGTAGG - Intergenic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1082139451 11:48590998-48591020 CAATGGAGAAAGAGAGGACTGGG + Intergenic
1082263100 11:50092397-50092419 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1082568339 11:54708114-54708136 CAATGGAGAAAGAGAGGAATAGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083725017 11:64623386-64623408 CCTTGGAGCTGGAGAGGAGAGGG - Intronic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084770902 11:71342283-71342305 CAGTGGAGAACGTGAGAAGTGGG + Intergenic
1084951703 11:72670007-72670029 TGGTGGAGCAGGAGAGGAGTGGG - Intronic
1085065899 11:73495437-73495459 CAGTGGTGATGGAGTGGTGATGG - Intronic
1085138918 11:74121884-74121906 CAGTGGAATTGGACAGGAGGTGG - Intronic
1085281153 11:75331670-75331692 CAGTGGAGGGGGATAGGGGTGGG - Intronic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085544387 11:77303428-77303450 AAGTGGTGATGGAGGAGAGTTGG - Intergenic
1085610434 11:77943381-77943403 CAGTGGAAATGGAGAAGGGATGG + Intronic
1086069530 11:82785528-82785550 CACTGGAGACTGAGAAGAGTGGG + Intergenic
1086074866 11:82839777-82839799 TAGTGGAGTGGGAGAGGAGTTGG - Intronic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086107007 11:83157347-83157369 CCGGGGAGAGGAAGAGGAGTCGG + Exonic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1087876270 11:103361686-103361708 CAGAGCAGATGAAGAGCAGTGGG + Intronic
1087982013 11:104627036-104627058 CAGAGCAGATAGAGTGGAGTTGG - Intergenic
1088549854 11:111001666-111001688 CAGTAGAGCTGGAGAAGAGAAGG + Intergenic
1088629212 11:111758041-111758063 TAGTGAAGATGGAAAGGATTTGG - Intronic
1088919659 11:114251737-114251759 CAGTGGAGAGGAGGAGGAGGAGG + Intergenic
1089061857 11:115632256-115632278 CCTTGGAGAAGGAGAGGAATGGG + Intergenic
1089196433 11:116696351-116696373 CAGTGGAGAGGGCGGGGAGGTGG - Intergenic
1089566939 11:119376575-119376597 CAGTGAAGATGGCCAGGAGGAGG - Intronic
1090954107 11:131499403-131499425 CAGCGGAGATGACGGGGAGTGGG - Intronic
1090965349 11:131593199-131593221 CACTGGGGAAGGAGAGGTGTAGG - Intronic
1091082203 11:132681518-132681540 AAGGGGAGCTGGAGAGGAGATGG - Intronic
1091340352 11:134807405-134807427 CACTGGAGATAGAGAGGAGGAGG + Intergenic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091777194 12:3192268-3192290 CAGTGGAGAGGCACATGAGTGGG + Intronic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092527273 12:9316910-9316932 AAGTGGAGGGGGAGAGGTGTCGG + Intergenic
1092575374 12:9776783-9776805 CATTAGAGATGGCCAGGAGTTGG - Intergenic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1094042665 12:26133884-26133906 CAGTGGAGCTGGTGCTGAGTTGG + Intronic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083781 12:26566249-26566271 GAGAGGAGAGGGAGAGGAGAAGG + Intronic
1094083796 12:26566320-26566342 GAGAGGAGAGGGAGAGGAGAAGG + Intronic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094141044 12:27182426-27182448 CACTGGAGGTTGAGGGGAGTGGG - Intergenic
1094513036 12:31107601-31107623 AAGTGGAGGGGGAGAGGTGTCGG + Intergenic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1094556648 12:31506982-31507004 CTCTGGAGAGGGAAAGGAGTTGG - Intronic
1095187786 12:39221880-39221902 GAGTGGAGAGGGAAAGGAGAAGG - Intergenic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095713388 12:45314936-45314958 CAGTGAAGGTGGAAATGAGTGGG + Intronic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096427965 12:51520346-51520368 CAATGGTGATGGAGAGGAAGAGG + Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096807409 12:54149018-54149040 CACTGGGGAAGGAGAGGTGTGGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097573816 12:61365586-61365608 CAGTGGAGCAGGAGTGGAATGGG - Intergenic
1097623168 12:61966139-61966161 CAGTGAAGATGAGGAGAAGTTGG - Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098483693 12:70996318-70996340 CAGTTGAAATGGGGAAGAGTGGG - Intergenic
1098804780 12:75009849-75009871 AAGTTCAGATGGAGAAGAGTTGG + Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099080200 12:78169153-78169175 CAGTGGAGATGGAGATGGAGTGG + Intronic
1099156376 12:79181528-79181550 CGGTTGATATGGAGAAGAGTGGG - Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100270929 12:93023765-93023787 CAGTGGTGAAGGAGAAGAGAAGG - Intergenic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100569749 12:95836956-95836978 GGGAGGAGATGGAGAGGAGAGGG + Intergenic
1100914051 12:99398061-99398083 CACTGGATATGGTAAGGAGTTGG + Intronic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1101037030 12:100716623-100716645 CTGAGGAGAGGGAAAGGAGTGGG - Intergenic
1101218493 12:102610110-102610132 AAGTGCACATGGAGAGGTGTGGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101373489 12:104151464-104151486 CAGGGGAGGTGGGGTGGAGTGGG - Intergenic
1101682598 12:106984253-106984275 CAGTGGAGAGAGAGAGGGTTTGG - Intronic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1101730443 12:107422601-107422623 CAGTGGAGGTGATGAGAAGTTGG + Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1102807093 12:115791608-115791630 CAGAAGAGATGGAGAGGCCTAGG + Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103235026 12:119364963-119364985 CAGTGGACATGGAAGGCAGTTGG + Intronic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1103919619 12:124392698-124392720 CAGTGGACATGTAGTGGAGGAGG + Intronic
1103948730 12:124540690-124540712 GGGTGGAGATGGAGGGGGGTGGG + Intronic
1103948822 12:124540938-124540960 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103948899 12:124541173-124541195 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103949013 12:124541519-124541541 GAGTGGAGATGGAGAGGGAAGGG + Intronic
1103949091 12:124541748-124541770 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103949120 12:124541815-124541837 GAGTGGAGATGGAGGGGGATGGG + Intronic
1104125569 12:125842447-125842469 CAGTGGGGATGGCGATGTGTTGG + Intergenic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105605447 13:21922957-21922979 CAGTGGAGATGGACAAGTGTCGG + Intergenic
1105968399 13:25405192-25405214 CAGTGCAGAAGGAGAAGAGGAGG + Intronic
1106929190 13:34645491-34645513 CGGAGCAGTTGGAGAGGAGTAGG + Intergenic
1107014680 13:35698480-35698502 CAGTGGAGGTGAATTGGAGTGGG - Intergenic
1107501703 13:40985175-40985197 CAGGGGAGAGGAAGAGGAGCAGG - Intronic
1108299786 13:49061732-49061754 GAGAGGAGAGGGAGAGGAGAGGG - Intronic
1108299789 13:49061743-49061765 GAGAGGAGAGGGAGAGGAGAGGG - Intronic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1108690073 13:52851540-52851562 AGGTGGCGCTGGAGAGGAGTAGG + Intergenic
1108723138 13:53152229-53152251 GAGTGGGGATGGAAAGGAGGGGG + Intergenic
1109107629 13:58275771-58275793 AGGTGGAGGGGGAGAGGAGTTGG - Intergenic
1109299369 13:60574992-60575014 AAGAGGAGAGGGAGAGGTGTTGG + Intergenic
1109450829 13:62512480-62512502 GAGTGGACCTGGAGAGGAGAGGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111723782 13:91978875-91978897 CAGTAGAAATGAAGAGGACTTGG + Intronic
1111973905 13:94945866-94945888 CAGTGGAGGCGGAGGGGGGTTGG - Intergenic
1112577580 13:100650023-100650045 CAGTCTTGATGGAGAGGAGATGG - Intronic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114476606 14:22999449-22999471 CAGTAAAGATGGTGAGGAGGAGG - Intronic
1114763524 14:25344709-25344731 CACTGGAGATGATGAGGTGTTGG + Intergenic
1114908639 14:27164001-27164023 GAGAGGAGCTGGAGAGGAGATGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115258360 14:31426851-31426873 CAGTGGAGAGGGGGAGGATCAGG + Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116619268 14:47177661-47177683 CAGTGGGGAGGGATAGCAGTAGG + Intronic
1117182677 14:53208170-53208192 CTGTGTAGATACAGAGGAGTGGG - Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117201917 14:53399053-53399075 CAGTGGAGATGGGGTGGGGTGGG + Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118608623 14:67522252-67522274 CAGTAGAGTGGGAGAGGAGCGGG - Intronic
1118882949 14:69843972-69843994 CAGTGGAGCTGGGGAAGAGAAGG + Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1120545769 14:85809406-85809428 AAGTGGAGATGTAGAGAGGTAGG + Intergenic
1121113470 14:91328176-91328198 GAATGGAGATGGCCAGGAGTGGG + Intronic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122457055 14:101862296-101862318 CAGTGGTGATGGGAATGAGTGGG + Intronic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122629156 14:103099438-103099460 TGGTGGAGAGGGAGAGGAGTGGG + Intergenic
1123007703 14:105332392-105332414 CAGTGGGGAGTGAGAGGAGCAGG + Intronic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124429411 15:29593459-29593481 CAGCTGAGATGGAGTGGACTGGG - Intergenic
1124964475 15:34423120-34423142 GAGGGGAGAGGGAGAGGAGAGGG - Intronic
1124981094 15:34569346-34569368 GAGGGGAGAGGGAGAGGAGAGGG - Intronic
1125215561 15:37269543-37269565 CAGGGGAGATGGAGCTGAGCAGG - Intergenic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128511874 15:68318514-68318536 CAGTGGAGAGGGAGTGGGATTGG + Intronic
1128526741 15:68417399-68417421 CAGAAGAGACAGAGAGGAGTGGG - Intronic
1128843888 15:70872405-70872427 TAGGGGAGAGGGAGAGGAGGAGG + Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129954737 15:79625512-79625534 CAGAGGAGATGGTGAGGATGGGG + Intergenic
1130088096 15:80795395-80795417 CAGTGGGGAAGGAGAAGTGTGGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131352977 15:91718373-91718395 CAGGGGACATGGAGAAGAATGGG + Intergenic
1131709135 15:95033821-95033843 CAGTAGAGAGGAAGAGGAGGAGG - Intergenic
1132202226 15:99962888-99962910 CAGTGAAGATAGGGAGAAGTGGG + Intergenic
1132224895 15:100132787-100132809 CAGGAGAGATGGGGAGGTGTTGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133395829 16:5446751-5446773 CGGTGGGGATGGACAGGAGGAGG - Intergenic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1134235076 16:12459134-12459156 AAGTGGAGAGGGGGAGGAGGGGG - Intronic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134365981 16:13579560-13579582 CAGGGGAGCTGGAGAGGGGACGG + Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135244426 16:20842976-20842998 CAGTGAAGATGTAGATAAGTTGG - Intronic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1135556028 16:23437319-23437341 GAGTGGGGATGGAGAGGTGGTGG - Intronic
1135609019 16:23848595-23848617 CAGTGGAGAGGGAGAGGGAGTGG - Intronic
1135698601 16:24611679-24611701 CAGTGGAGATGGACAGGGAGAGG + Intergenic
1135722906 16:24832354-24832376 CAGTGGAGAAAGAGAGGGATGGG + Intergenic
1136160249 16:28415170-28415192 CAGTGGAGAGGGCGGGGAGGGGG - Intergenic
1136202839 16:28700120-28700142 CAGTGGAGAGGGCGGGGAGGGGG + Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136554836 16:31001573-31001595 CAGTGATGATGAAGAGGAGGTGG - Exonic
1137408855 16:48211053-48211075 CACTGGAGCTGGAGAGGAACGGG - Exonic
1137658444 16:50181812-50181834 CAGAGGTGATGGAGATGAGGTGG + Intronic
1138537697 16:57668489-57668511 GACTGGAGAAGGTGAGGAGTTGG + Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1138768870 16:59637840-59637862 GAAAGGAGATGGAGAGGATTTGG + Intergenic
1138929374 16:61633660-61633682 CAGAGAAGATGGAGAGGAACTGG - Intergenic
1138981715 16:62277223-62277245 GAGTGGAGATGGGGAAGAATTGG - Intergenic
1139278305 16:65748462-65748484 CAGTGAAGCTGGAGAGGAAAGGG - Intergenic
1139471957 16:67183223-67183245 AAGGGGAGATGGAGGGGACTGGG - Intronic
1139766715 16:69236745-69236767 CAGTGGAAACTGAGGGGAGTAGG + Intronic
1140298867 16:73736940-73736962 CAGAGGATATGGAGAAGTGTGGG + Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140930040 16:79618948-79618970 CAGAGGAGACAGAGAGGAGGCGG - Intergenic
1141074776 16:80994697-80994719 CAGTGGTGATGGACAGTGGTAGG + Intronic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142254429 16:89006954-89006976 GGGAGGAGATGGAGGGGAGTGGG - Intergenic
1142254457 16:89007032-89007054 GGGAGGAGATGGAGGGGAGTGGG - Intergenic
1142254495 16:89007145-89007167 GGGAGGAGATGGAGGGGAGTGGG - Intergenic
1142447920 16:90154531-90154553 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1142459569 17:80792-80814 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1142733868 17:1882148-1882170 CAGTGGTGGCGGAGAGGAGCTGG - Intronic
1143058404 17:4179819-4179841 CAATGGAGAAGGAGAGGAAGAGG - Exonic
1143296638 17:5876269-5876291 CACTGGGGATGGGGAGGAGGGGG + Intronic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1143564814 17:7715091-7715113 CAGGGGAGATGGGGATGGGTGGG + Intergenic
1144036011 17:11366653-11366675 CAGGACAGATGGAGAAGAGTGGG + Intronic
1144058734 17:11562775-11562797 CAGTGGAGGTGGGGAGGAACGGG - Exonic
1144211202 17:13017291-13017313 TAGCAGAGGTGGAGAGGAGTGGG + Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1144744718 17:17606371-17606393 CCCTAGAGATGGAGTGGAGTAGG - Intergenic
1144901534 17:18597610-18597632 GAATTGAGATGGAGAAGAGTTGG - Intergenic
1146257641 17:31400812-31400834 CAGTGGCGATGGACAGGTCTGGG + Intronic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146713231 17:35061078-35061100 CAGGGGAGAGGGAGATGAGATGG + Intronic
1146733501 17:35216162-35216184 CAGTGGGGAAGGAGAGGCTTGGG - Intergenic
1146733577 17:35216904-35216926 TAGTGGAGATGGAGAAGGGCAGG + Intergenic
1146778882 17:35648830-35648852 GAGTTGAGATGGAGAAGGGTTGG + Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1146949314 17:36894697-36894719 CAGTGGTGATGGAGAGTGTTGGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147545954 17:41402027-41402049 CAGGGGACATGGTGGGGAGTGGG + Intergenic
1147918183 17:43900830-43900852 CGGTGGGGATGGGGAGGAGGCGG + Intronic
1147978485 17:44261042-44261064 CACTGGGGAGGGAAAGGAGTGGG + Intronic
1148065761 17:44868571-44868593 TGGTGGAGATGGAGAGGCTTGGG - Intronic
1148105069 17:45114626-45114648 CAGTGGAGCTGGAGGGCCGTGGG - Intronic
1148554004 17:48566993-48567015 CACTGGAGATTGTGAGGAGGTGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149106703 17:52976033-52976055 CAGTGAAGATGTGGAGCAGTAGG - Intergenic
1149109135 17:53005848-53005870 CAGTGGAGTTGGAAGGGAGAAGG + Intergenic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149317321 17:55450836-55450858 CAAAGGAGATGGAAAGAAGTGGG - Intergenic
1149872222 17:60192982-60193004 AAGAGAAGATGAAGAGGAGTTGG - Intronic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1152283912 17:79401540-79401562 CAGTGCAGAGGGAGAGGGGAGGG + Intronic
1152295324 17:79463928-79463950 CAGTGGCGATGGTGGGGAGGTGG - Intronic
1152703652 17:81832322-81832344 CAGGGGAGAGGGTGAGGAGGTGG - Intronic
1152816278 17:82410018-82410040 CAGGAGAGATGGGGAGCAGTGGG - Intronic
1152885209 17:82845438-82845460 CAGACGAGATGGAGAGGAAGGGG - Intronic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155078041 18:22380270-22380292 CAGTGGTGATGGAGCGGGGTGGG + Intergenic
1155292833 18:24358475-24358497 AAGCTGAGATGGAGATGAGTGGG - Intronic
1155325305 18:24658504-24658526 TGGGGGAGATGGAGAGGAGGAGG + Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155593835 18:27459307-27459329 CAGTGAAGAGGGAGAGGATCAGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1156866070 18:41890184-41890206 CTGTGGAAATGGACTGGAGTGGG - Intergenic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157242631 18:46025390-46025412 CAGTGGAGCTGGAAGAGAGTGGG - Intronic
1157680130 18:49598559-49598581 AAGAGGAGAAGGAGAGGAGAAGG - Exonic
1158049710 18:53201937-53201959 CAGTAGAGATGGATTGGAATGGG + Intronic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1158524078 18:58196927-58196949 AAGAGGAGATGGTGAGGAGGAGG + Intronic
1158561355 18:58516472-58516494 TTGTGGAGAGGGAGAGGGGTGGG - Intronic
1159108176 18:64027124-64027146 TAGTGGAGATGGAGGGGCGGGGG + Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159374002 18:67567226-67567248 CAGTGGTGATGGATAGGAAGAGG - Intergenic
1159577149 18:70193304-70193326 CAGAGGAGATGGCCAGGACTGGG - Exonic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159744195 18:72210995-72211017 CAGTGAAGATGCAGAACAGTTGG + Intergenic
1159843829 18:73434233-73434255 CAGTGGTGGTGGGGAGGGGTGGG - Intergenic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1160389564 18:78519721-78519743 CTGTGGAGCTGGGGAGGTGTGGG - Intergenic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160649285 19:213301-213323 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1160809493 19:1007300-1007322 CAGGGGAGAGGCAGAGGAGGTGG + Intronic
1161090952 19:2359986-2360008 CGATGGAGATGGGGAGGGGTTGG - Intergenic
1161364524 19:3870503-3870525 AAGAGGAGAGGGAGAGGAGCAGG + Intergenic
1161625556 19:5324538-5324560 CAATGGAGGAGGAGAGGAGAAGG + Intronic
1162054116 19:8052663-8052685 GAGTGCAGGTGGAGAGGAGGAGG + Intronic
1162080458 19:8214874-8214896 CAGAGGAGATGAAGGGCAGTGGG + Intronic
1163005823 19:14396125-14396147 CAGAGGAGAAGGGGAGGACTTGG + Intronic
1163028933 19:14530934-14530956 AGGTGGAGGTGGAGAGGAATGGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1164895930 19:31877691-31877713 CTGAGGACATGGAAAGGAGTAGG + Intergenic
1165121289 19:33560513-33560535 CTGTGGGGAAGGACAGGAGTGGG - Intergenic
1165851037 19:38850443-38850465 CAGTGGAGACGCAGAAGAATGGG - Intronic
1166173363 19:41048054-41048076 CAGTGAAGCTGGGGAGGAGGTGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166549352 19:43654873-43654895 CAGTGGAGCAGGGGAGGAGTGGG + Intronic
1166893543 19:46009050-46009072 CATTACAGATGGAGATGAGTAGG + Intronic
1167435220 19:49475073-49475095 GAGGGAAGATGGAGAGGAGGGGG + Intronic
1167435231 19:49475109-49475131 GAGGGGAGATGGACAGGAGGGGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167837496 19:52086143-52086165 CAGGGGACATGGAGACGTGTAGG + Intronic
1167842357 19:52132380-52132402 CAGGGGACATGGAGACGTGTAGG + Intronic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
1168633007 19:57971962-57971984 CAGTGGAGATGGGTAGGTGGTGG + Intronic
925420420 2:3705865-3705887 CACTGCAGAGGGAGGGGAGTTGG + Intronic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
925981498 2:9180943-9180965 CAGAGATGATGGGGAGGAGTGGG - Intergenic
926047109 2:9717880-9717902 CAGAGGAGCTGGGGAGGGGTGGG - Intergenic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
927043954 2:19258176-19258198 CGGTGGGGAAGGTGAGGAGTGGG + Intergenic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
927818220 2:26239566-26239588 CAGTGAAGGTGGAGTGGAATAGG + Intronic
927897407 2:26792725-26792747 GAGTGGGGAAGGGGAGGAGTAGG - Intronic
927964582 2:27261416-27261438 GAGTGAAGATGGACTGGAGTTGG + Intronic
928219614 2:29392692-29392714 CAATCGGGATGGGGAGGAGTAGG + Intronic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929403880 2:41617605-41617627 CAGTGGAGACTCAGTGGAGTTGG - Intergenic
929573573 2:43038784-43038806 GATTGGAGCTGGAGTGGAGTGGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930164838 2:48194808-48194830 CAGTGGGGATGGGGAAGAGCAGG - Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930985664 2:57584768-57584790 TAGTGGGGATGGCGAGGAGGTGG - Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931764387 2:65442012-65442034 CAGTGGAGATGGTGATGGGAAGG + Intergenic
931777650 2:65554163-65554185 CAGTTGAGGTGGAGAGTGGTAGG + Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932253962 2:70267774-70267796 CCGTGGAGAGGGAGAGGGGGAGG + Intronic
932360771 2:71103826-71103848 GAGGGGAGCTGGAGAGGAGATGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932715104 2:74094989-74095011 GAGTGCAGATGGAGAAGAGAGGG + Intronic
932807709 2:74797041-74797063 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
932883607 2:75527416-75527438 CAGTGGAGAGGGGGAGGGGGAGG - Intronic
933811182 2:86033661-86033683 CTGGGGAGTTGGGGAGGAGTCGG - Exonic
934087901 2:88525509-88525531 CAGGGAAGATGGGGAGGAGTGGG + Intronic
934129429 2:88933270-88933292 CAGTGCAGATGCAGATGAATTGG + Intergenic
936532683 2:113287758-113287780 AAGTGGTGATGGGGATGAGTGGG + Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937954916 2:127416767-127416789 GGGTGGAGGTGGAGAGGAGGTGG - Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938746979 2:134288824-134288846 TAGGGGAGAGGGAGAAGAGTGGG - Intronic
939167141 2:138652145-138652167 TAGTGGAGAGGGAGAGGTGTGGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
941885324 2:170521785-170521807 CAGTGGACCTGGACAGCAGTTGG - Intronic
942033071 2:171982420-171982442 CAGCAGAGATGGAGAGGACAGGG - Intronic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
944457179 2:199907849-199907871 CAGTTGAGAGGGAGAGGAGTGGG - Intergenic
944637596 2:201689825-201689847 CAAGTGAGATGGAGAGGAGGCGG + Intronic
944877058 2:203972939-203972961 GAGTGGAGTTGGAGAAGAGTGGG - Intergenic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
945915928 2:215703844-215703866 CAGATGAGATAGAGAGGATTTGG - Intergenic
946043521 2:216802810-216802832 GAGTGGGGAAGGAGAGGAGGAGG + Intergenic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
946530393 2:220564186-220564208 AAGTGGAGACGGAGACGAGAAGG - Intergenic
946708802 2:222485769-222485791 CAGGAGAGCTGGTGAGGAGTTGG - Intronic
946751639 2:222897907-222897929 CCGTGGAGAGGGAGAGGGGGAGG + Intronic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
946920315 2:224573942-224573964 TAGTGGAAATGGAAAGGAATTGG + Intronic
948238992 2:236412980-236413002 CCGTGGAGATGGGGAGATGTGGG + Intronic
948272831 2:236687439-236687461 CAGTGGGGATTAAGAGGAGGTGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
949043286 2:241859074-241859096 CAGAGGAGATGGGGAGGAGGTGG + Intergenic
1168857432 20:1018584-1018606 CAGTGGGGCTGGAAAAGAGTGGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1170008582 20:11695645-11695667 CAGTGGACAGGGAGAGGTGGTGG - Intergenic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171321603 20:24249019-24249041 CAGTGGAGGTGGGGATGGGTGGG + Intergenic
1171498620 20:25575919-25575941 AAATGGAGAAGGAGAGGAGCAGG - Intronic
1172292147 20:33784164-33784186 GAGGGGGGAGGGAGAGGAGTAGG - Intronic
1172624659 20:36340282-36340304 AAGTGGAGATGGTGAGGAAGGGG + Intronic
1172723457 20:37016924-37016946 CAGGGGAGGGGGAGAGGAGGGGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172958284 20:38778031-38778053 CAGAGGACATGGAGTGGGGTGGG + Intergenic
1173046792 20:39520461-39520483 CAGTGGACATACAGAGTAGTGGG + Intergenic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1173754420 20:45502901-45502923 CAGGGAAGAAGGAGAGGAGAGGG + Intergenic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1175094559 20:56531158-56531180 CAGGGGAGATGATTAGGAGTTGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175216355 20:57393367-57393389 CCGTGGAGATGAAGTGGAGAGGG + Intronic
1175337288 20:58204942-58204964 CAGGGGAGATGGAGCCGAGGGGG - Intergenic
1176128001 20:63484501-63484523 CAGTGGGGAAGGCGAGGGGTGGG - Intergenic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1177358982 21:20045115-20045137 GAGAGAAGATGGAGGGGAGTGGG - Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1177867860 21:26534533-26534555 GACTGGAGATGGAGAGGAAAGGG + Intronic
1178809863 21:35871808-35871830 CAGTGCAGATGGACAAGAGTCGG - Intronic
1178859358 21:36276047-36276069 TGGTGGAGCTGGAGCGGAGTCGG + Intronic
1179714525 21:43280399-43280421 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1179714546 21:43280449-43280471 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179973202 21:44847685-44847707 CAGGACAGATGGAGGGGAGTGGG - Intergenic
1179992810 21:44957453-44957475 TGGTGGAGATGAAGAGGAGGAGG - Intronic
1180874429 22:19168653-19168675 CAGTGCAGAGGGACAGGCGTGGG - Intergenic
1181130163 22:20726542-20726564 CTGTGGAGGTGGAGCAGAGTTGG + Intronic
1181323160 22:22024175-22024197 CATTGGACATGGAGAGGGCTTGG + Intergenic
1181887800 22:26035454-26035476 CAGTGGTGATGCAGAAGAGAAGG + Intergenic
1181985381 22:26796837-26796859 CAGTGGAGATGGGGAGGCTGAGG + Intergenic
1182053018 22:27327714-27327736 CAGTGGAGCTGGAGTAGGGTGGG + Intergenic
1182578840 22:31291634-31291656 AGGAGGAGATGGAGAGGAGGAGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182917395 22:34047714-34047736 CAGTGGTGATTGAGATGAGACGG - Intergenic
1183745482 22:39689245-39689267 CAGGGGAGAGGAAGAGGATTTGG - Exonic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184274317 22:43401483-43401505 GAATGCAGATGGAGAGGGGTGGG + Intergenic
1184693848 22:46129233-46129255 CAGTGGAGAGGGGAAGGAGATGG + Intergenic
1184968740 22:48000085-48000107 GAGTGGAGATGGGGAGAGGTTGG - Intergenic
949173120 3:1026706-1026728 CAGTAGTTATGGCGAGGAGTTGG + Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950119772 3:10474097-10474119 CAGTGGTGTTGGAGAGGTGTGGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950649053 3:14395951-14395973 CAGGGGAGATGGGGAGGGGAGGG + Intergenic
950792939 3:15487795-15487817 AAGTGGAGGTGCAGAGGAGATGG - Intronic
950890443 3:16399820-16399842 CCGTGGAGAGGGAGAGGACAAGG - Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951688283 3:25369047-25369069 CAGTGGTGGGAGAGAGGAGTAGG + Intronic
952696208 3:36267626-36267648 AAAGGGAGATGGAGTGGAGTAGG - Intergenic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953005963 3:38979680-38979702 CAGTGGAGATAGAGAGACTTTGG - Intergenic
953237811 3:41121402-41121424 AAGTGGAAATGGAGAGGGGTTGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953924931 3:46978014-46978036 CAGTGGAGGTGGAGAGGGGGCGG - Intronic
953977420 3:47392550-47392572 GAGTGGAGAGGGGGTGGAGTTGG + Intronic
953993010 3:47498384-47498406 CAGTGGAGATGCGGAGGATGAGG - Exonic
954157010 3:48691094-48691116 GAGTGCAGATGATGAGGAGTGGG - Intronic
954258063 3:49419876-49419898 CAGTGGAGAGGAGGAGGAGGAGG + Intronic
954444577 3:50539856-50539878 CAGTGGAGATGGGTAGGTGTGGG - Intergenic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956192107 3:66617915-66617937 CATTGGAGATGGAAAAGCGTAGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956878644 3:73488863-73488885 CAGCAGAGATGGGGAGGAGGGGG - Intronic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
958471447 3:94525685-94525707 CAGTGAAGATACACAGGAGTAGG + Intergenic
958831136 3:99090955-99090977 GAGAGGGGATGAAGAGGAGTTGG + Intergenic
959721329 3:109492951-109492973 CAGTGGAGAAGTAGATGAGATGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960078302 3:113513710-113513732 TAGTAGAGATGGAGAAGAGCGGG - Intronic
960245502 3:115395682-115395704 AAATGCAGATGGAGATGAGTAGG - Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960615281 3:119590852-119590874 CAGTGGTGAGGGGGAGGAGGGGG - Intergenic
960692855 3:120365246-120365268 CAGTGGAAAGGCAGAAGAGTTGG - Intergenic
960702198 3:120450323-120450345 CAGAGGAGACTGAGAGTAGTTGG - Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961107629 3:124255723-124255745 CAGTGCAGATGGAGCAGGGTGGG + Intronic
961658778 3:128457424-128457446 CAGTGCAGAGGGAGAGGAAGAGG + Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962338650 3:134562305-134562327 CTGTGGAGAGAGAGAGGAGCAGG + Exonic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963888198 3:150603838-150603860 CTGCGGAGATGGGGATGAGTAGG + Intronic
965464680 3:169013337-169013359 CAGTGCAGATAGAGAGAAGCAGG - Intergenic
965682122 3:171262297-171262319 CAGAGGAGGTGGAGTGGGGTGGG - Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966431051 3:179832134-179832156 CAGTGGAGAACGAGAGAATTAGG + Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967229121 3:187320895-187320917 CAGTGGACCTGGAGAGGAAAAGG - Intergenic
967347172 3:188470465-188470487 GAGTTGAGATGGAGAAGATTTGG - Intronic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967621950 3:191643985-191644007 AAATGGAGCTAGAGAGGAGTAGG + Intergenic
967992791 3:195144199-195144221 CACTCGAGATGGAGTGGAGTGGG - Intronic
968062403 3:195735605-195735627 AAGTGGATATGTAGAGGAGAAGG - Intronic
968132377 3:196199037-196199059 CAGTGGAGACCAAGAGGAGGAGG - Intronic
968195379 3:196702174-196702196 CAGGGGAGATGGTGAGGATGGGG + Intronic
968368561 3:198206831-198206853 CAGTGAAGATGTGGAGGAATTGG - Intergenic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968815481 4:2819561-2819583 CAGTGGAGTTGGATGGGAGCAGG - Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969331039 4:6473469-6473491 CAGTGGGGATTCAGAGGTGTGGG + Intronic
970967176 4:21942201-21942223 CAGTGGATGTGGAAAGGAATGGG - Intronic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971791330 4:31173622-31173644 GAGTGGAGAGTGAGAGGAGGGGG - Intergenic
972988128 4:44790811-44790833 CAGGGGAGATGAAGAGGGGTTGG - Intergenic
973336167 4:48958912-48958934 CAGTGGAAATGGAGAAGAAGAGG + Intergenic
973636251 4:52863680-52863702 CAGCAGAGAAGGAGAGGGGTGGG - Intronic
973730473 4:53817580-53817602 CAGTGAACAAGCAGAGGAGTGGG - Intronic
973794011 4:54405576-54405598 CAATGGAGGTGGAAAGGCGTAGG - Intergenic
973952151 4:56026780-56026802 CACTGGAGATGGGAATGAGTGGG + Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974178169 4:58351356-58351378 CAATAGAGATGGGGAGGAGGAGG + Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976386233 4:84461901-84461923 CAGTGAAGTTAGAGAGGAATTGG - Intergenic
977460721 4:97321516-97321538 CACTGGAAACAGAGAGGAGTGGG - Intronic
977822210 4:101486269-101486291 CAGGGGCTATGGAGAGGAGAGGG - Intronic
979108914 4:116725115-116725137 AAGTGGAGATGGCGAAAAGTAGG - Intergenic
979256985 4:118616554-118616576 CAGTGAAGATGTGGAGGAATTGG - Intergenic
979297374 4:119049070-119049092 CAGTGGAGGTTGAGAAGACTTGG + Intronic
979331365 4:119423992-119424014 CAGTGAAGATGTGGAGGAATTGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980419103 4:132536888-132536910 GAGAGGAGAAGGAGAGGAGGAGG - Intergenic
981341017 4:143621321-143621343 GAGTGGAGCTGGAGAGGCATTGG + Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982509834 4:156267704-156267726 CAATGGAGTTTGAGAGGATTAGG - Intergenic
983143067 4:164177130-164177152 CAGTGAAGCTAGACAGGAGTAGG + Intronic
983250281 4:165336627-165336649 GAGTGGAGGTTTAGAGGAGTGGG + Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984596644 4:181676516-181676538 GAGAGGAGAGGGAGAGGAGGGGG - Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
984762693 4:183376656-183376678 CAGTGGGGAGGGGGAGGAGCGGG - Intergenic
986184794 5:5425158-5425180 CAGTGGAGATGTTGAAAAGTGGG - Intronic
986229147 5:5845538-5845560 CTGTGGTGATGCAGAGGCGTGGG - Intergenic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
987652829 5:20766265-20766287 AAGAGGAGATGAAGAGAAGTTGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988742729 5:34095219-34095241 AAGAGGAGATGAAGAGAAGTTGG - Intronic
989125539 5:38049108-38049130 CAGGGGAGTGGGAGAGGAGTGGG + Intergenic
989258014 5:39387119-39387141 CAAATGAGATGGAGAGGAGCAGG - Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
990041560 5:51383374-51383396 CAATGGCGATGGAGCTGAGTTGG + Exonic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990501256 5:56398638-56398660 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
990831663 5:59965815-59965837 TAGTGGAGATGGAGACCATTCGG - Intronic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
992295525 5:75323079-75323101 CAGAGGAGATGCAGAGGACAAGG + Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
994021054 5:95026477-95026499 CAATGGAGATAGAGAGTAGAAGG - Intronic
994607112 5:101982009-101982031 CGGTAGAGATGGAGATGAGCAGG + Intergenic
994821198 5:104652938-104652960 CAGTGGTGATGGACTGGGGTGGG - Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996211598 5:120817901-120817923 CAGCTGAGGTGTAGAGGAGTAGG - Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
997709394 5:135990952-135990974 CAGCGGAAGTGGAGAGCAGTGGG + Intergenic
997871406 5:137508563-137508585 CACTGGAGATTTAGAAGAGTGGG + Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998392126 5:141794038-141794060 CAGAGGAGATTGGGAGGAGCAGG - Intergenic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
998641230 5:144013611-144013633 CTGAGGAGATGAAGGGGAGTAGG + Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999773570 5:154793509-154793531 CAGGGCAGAAGAAGAGGAGTTGG + Intronic
999823945 5:155256340-155256362 CAGTTAAGATGAAGAGGGGTTGG + Intergenic
1000200917 5:159010208-159010230 CAGATGAGATGGAGATGAGTAGG + Intronic
1000452892 5:161412395-161412417 CAGTGGAGATGGTAAGGAATCGG - Intronic
1000970445 5:167708594-167708616 CAGAAGGGATGGAGAGGACTTGG + Intronic
1001237454 5:170042264-170042286 GAATGGAGATGGAGAGGAAGTGG - Intronic
1001665046 5:173425666-173425688 GTGTGGAGATGAAGAGGTGTGGG + Intergenic
1001673122 5:173490927-173490949 CAGTGGAGCAGGTGGGGAGTGGG + Intergenic
1001680375 5:173552728-173552750 GAGTGGAGATGGAGAACAGCTGG - Intergenic
1001727760 5:173921423-173921445 CAGAGGAAATGGTGAGGAGGAGG + Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001824355 5:174733478-174733500 CAGTGGAGACGGAGTGGGGGTGG - Intergenic
1002295373 5:178227834-178227856 CCATGGAGATGGAGAGGTGGAGG + Intronic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002727782 5:181312058-181312080 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003146847 6:3516751-3516773 CAGGGGAGATGATGGGGAGTGGG - Intergenic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1003742223 6:8953807-8953829 AAGTTCAGATGGAGTGGAGTGGG - Intergenic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1004240316 6:13915493-13915515 TAGTGGAAATGAAAAGGAGTAGG + Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004579348 6:16933641-16933663 CAGCGGTGATGGGGAGGATTTGG + Intergenic
1004955363 6:20722920-20722942 AAGTGGAGGTGGAGAGGGGATGG - Intronic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005954354 6:30653347-30653369 TACTGGAGATTGAGAGCAGTTGG - Exonic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006925287 6:37650570-37650592 CCCAGGAGATGGAGAGGATTTGG - Intronic
1006948066 6:37798672-37798694 CAGGACAGATGGAAAGGAGTGGG - Intergenic
1007576252 6:42926887-42926909 CAGTGGAGATTGAGAAGCCTGGG - Intergenic
1007995756 6:46306115-46306137 CAGGGGATATGGTGAGGAGTAGG + Intronic
1008237487 6:49067821-49067843 CAGTGAAGATGTAGAGGAAAGGG + Intergenic
1008245769 6:49171034-49171056 AAGAGGGGATGGAGAGGAGGTGG + Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1010024249 6:71197298-71197320 CAGAGGAGACGGAAAGGAGAGGG + Intergenic
1010259506 6:73798971-73798993 GAGAGGAGAAGGAGAGGAGAGGG - Intronic
1010735306 6:79437198-79437220 CCGTGGAGGAGGAGAGGAGCAGG + Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011555473 6:88567976-88567998 CAGGGGCTAGGGAGAGGAGTGGG - Intergenic
1012117089 6:95314674-95314696 CAGGGGAGTGGGAGAGGAATTGG + Intergenic
1014023428 6:116616892-116616914 CAGGGGAGAAGGAGAGGAAGAGG - Exonic
1014137321 6:117905433-117905455 CAGAGGAGATGTAGAGCATTTGG + Intergenic
1014340326 6:120197530-120197552 GAGTGGAGATGGAAAGCACTAGG + Intergenic
1015179304 6:130344929-130344951 TAGAGGAGATGGAGGGGGGTGGG - Intronic
1015906633 6:138123647-138123669 CAGAGAAGATGGAGAGGGATGGG - Intergenic
1015910524 6:138164159-138164181 CAGTGGAAATGGACTGGAGTGGG - Intronic
1016292107 6:142537694-142537716 CAGTTGAGAGGGAGAGGTGGGGG - Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016869683 6:148804343-148804365 CAGGGGATATGGAGCTGAGTGGG - Intronic
1016899172 6:149084021-149084043 GAGTGGGGAAGGGGAGGAGTGGG + Intergenic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1018347566 6:162917745-162917767 CAGAGGAGATGTGCAGGAGTGGG - Intronic
1018669029 6:166164517-166164539 AAGTGGAGATGGAGAAGACAAGG - Intronic
1019106632 6:169673077-169673099 TGATGGAGATGGAGAGGAGATGG + Intronic
1019517423 7:1446184-1446206 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019517480 7:1446328-1446350 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019517519 7:1446434-1446456 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020605075 7:10326963-10326985 CAGAGCTGATGGAGAGGATTTGG + Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022786801 7:33646127-33646149 CAGTGATGATGGAAAGGAGAAGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1022977919 7:35575554-35575576 CAGTGGAAATTGTGAGGATTTGG + Intergenic
1023083653 7:36548534-36548556 GAGTGGAGTTGGTGAGGAGAGGG + Intronic
1023398966 7:39777850-39777872 CAGTGAAGATGTGGAGGAGTTGG - Intergenic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024071910 7:45793627-45793649 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG + Intergenic
1024133606 7:46383705-46383727 GAGAGGAGAGAGAGAGGAGTTGG + Intergenic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024651475 7:51406840-51406862 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1025133680 7:56392650-56392672 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1025185282 7:56852871-56852893 CAGTGAAGATGTGGAGGAATTGG + Intergenic
1025187767 7:56874401-56874423 CAGAGGACCTGGAGAGGAGGTGG + Intergenic
1025684155 7:63702525-63702547 CAGAGGACCTGGAGAGGAGGTGG - Intergenic
1025686649 7:63724088-63724110 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1025842668 7:65165654-65165676 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1025880377 7:65530314-65530336 CAGTGGAAATGGAGAAGGGATGG + Intergenic
1025893060 7:65672290-65672312 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1026539356 7:71266831-71266853 CACTGGAGATGGGCAGGAGATGG + Intronic
1026880590 7:73904620-73904642 CAGTGGGGATGGAGAGGGCCGGG + Intergenic
1028106931 7:86889401-86889423 CACTGGAGCTGGGGGGGAGTTGG - Intronic
1028449482 7:90965152-90965174 AAGTGGGGATGGGGATGAGTGGG - Intronic
1028768606 7:94589341-94589363 CAATGGAGATGGGGAGGAATGGG - Intronic
1029173360 7:98646292-98646314 CAGTGGAGATGGAAATGGGGAGG - Intergenic
1029580233 7:101432353-101432375 CTGAGGACATGAAGAGGAGTGGG + Intronic
1030109853 7:106017901-106017923 CAGTGGAGATGGAGTACAGGAGG - Exonic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030162017 7:106518621-106518643 AAGGGGAGAAGGAGAGGAGAGGG - Intergenic
1030477017 7:110048912-110048934 CAATGGAGATTTAGATGAGTGGG + Intergenic
1030972820 7:116081477-116081499 CAGTGGTCATAGAGAAGAGTAGG - Intronic
1031350979 7:120730799-120730821 ATATGGAGATGGAGAGGAATTGG - Intronic
1032049294 7:128637334-128637356 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1032078162 7:128845888-128845910 AAGAGGAGAGGGAGAGGAGAGGG + Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032805249 7:135347853-135347875 CAGAGGGGATGGAGAGGATATGG - Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1036561784 8:9904880-9904902 GAGTGGAGATGGAGGTGAGTAGG - Intergenic
1036757639 8:11481783-11481805 CAATGGAGATGGGGAAAAGTGGG + Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037765651 8:21770765-21770787 AAGTGGTGATGAAGAGGACTGGG - Intronic
1037886569 8:22599169-22599191 CAGAGGAGAGGGAGGGGAGAGGG - Intronic
1038151082 8:24942589-24942611 CATTGGAGATGGACAGGGGCGGG - Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1040440092 8:47432380-47432402 CAGTTGAGATGAAGGGGAGATGG + Intronic
1041487187 8:58392189-58392211 CAGAGAAGATGGGGAGGAGTAGG - Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041878226 8:62715084-62715106 CAGAGGAGAGAGAGAGAAGTAGG + Intronic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042775517 8:72426531-72426553 CAGTGGAGGTGGAGAAGTGAAGG - Intergenic
1043149109 8:76691135-76691157 TTGTGGAGATGGTGAAGAGTTGG + Intronic
1043398192 8:79858493-79858515 CAGTGGATTTGGGGAGGAGAAGG - Intergenic
1043420275 8:80090439-80090461 CAGTGGGGATGGGGAGGGGCGGG + Intronic
1043767509 8:84155401-84155423 AACAGGAAATGGAGAGGAGTTGG - Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044833889 8:96277311-96277333 TAGTGGAGATGGTGGGGAGTTGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044963879 8:97556905-97556927 CGGTGTAGAGGGAGAGGAGTGGG + Intergenic
1045064685 8:98435012-98435034 CAGTCCAGGTGGAGAGCAGTGGG - Intronic
1045107068 8:98902957-98902979 CAGTGGTGATTGAGAGGCTTGGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045773017 8:105767119-105767141 CAGTGGAGATGGAGGGGTTAGGG + Intronic
1045938503 8:107711025-107711047 CAGAGCAGTTGGAGAAGAGTTGG - Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1046713837 8:117545622-117545644 TGGGGGAGAGGGAGAGGAGTCGG + Intergenic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047438889 8:124858802-124858824 CAGAGGTGATGGAGAGGAAGTGG - Intergenic
1047551567 8:125878487-125878509 TAGTGGAGAGGGAGAGGGGAGGG + Intergenic
1047634485 8:126744996-126745018 CAGTGAAGATGAAGAAAAGTAGG + Intergenic
1047651211 8:126924460-126924482 GAGGGGAGTTGGTGAGGAGTGGG - Intergenic
1047847487 8:128823843-128823865 AAATGGAGTGGGAGAGGAGTAGG - Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1047984905 8:130222510-130222532 CAGTGGAGAAGGATAGGATTTGG - Intronic
1048008759 8:130440120-130440142 CAATGGAGGTAGAGAGAAGTGGG - Intronic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048262183 8:132954562-132954584 CAGTGGTGCTGCAGAGGACTTGG + Intronic
1048299246 8:133239260-133239282 GAGTGGACATGGAGAGGACGGGG - Intronic
1048496879 8:134942751-134942773 CAGTGGTGATGGAGATGACATGG + Intergenic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049690093 8:143954496-143954518 CAGTGGAGATGCTGGCGAGTGGG - Intronic
1049829996 8:144694285-144694307 CAGTGTAGGTGGCGGGGAGTGGG + Intergenic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050085068 9:1956562-1956584 AAGAGGAGATGGAGAGAGGTTGG + Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051344655 9:16141132-16141154 CAGTGTAGATGGGGAGGCCTTGG - Intergenic
1051804064 9:20971758-20971780 CAGGGGATAGGGAGAGGGGTGGG - Intronic
1051907985 9:22118334-22118356 CTGTTGAGAGGGAGTGGAGTGGG - Intergenic
1052750471 9:32484622-32484644 CAGTAGAGATGGATTGGAGAAGG - Intronic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053611312 9:39715863-39715885 CAGTGGACACAGACAGGAGTTGG + Intergenic
1053869353 9:42473911-42473933 CAGTGGACACAGACAGGAGTTGG + Intergenic
1054086942 9:60755297-60755319 CAGTGGACACAGACAGGAGTTGG - Intergenic
1054242208 9:62626529-62626551 CAGTGGACACAGACAGGAGTTGG - Intergenic
1054556332 9:66661045-66661067 CAGTGGACACAGACAGGAGTTGG - Intergenic
1054888936 9:70230970-70230992 CAGTCTAAATGGAGAAGAGTTGG - Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055346934 9:75349760-75349782 CAGTGGAGGTGGCGAGGGGTGGG + Intergenic
1056139128 9:83657480-83657502 CAGTGGAGGTGGTAAGAAGTTGG - Intergenic
1056470820 9:86903264-86903286 AAGCGCGGATGGAGAGGAGTAGG - Intergenic
1056491579 9:87112998-87113020 CAATGGAGGTAGAGAAGAGTGGG + Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056617901 9:88184198-88184220 CCCTGGATAAGGAGAGGAGTGGG + Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057919327 9:99083760-99083782 CAGTGGATGTGGTGAGAAGTGGG + Intergenic
1058732292 9:107861922-107861944 AAGAGCAGATGGAGAGAAGTGGG + Intergenic
1059171654 9:112130468-112130490 CAGAGGAGAGGGAAAGGAGAGGG + Intronic
1059208077 9:112485529-112485551 CTCTAGAGATGGAGAGGGGTTGG + Intronic
1059295962 9:113271027-113271049 CAGTGGAGATGAAAAGGTATGGG + Intronic
1059760078 9:117329442-117329464 GAGAGGAGAGGGAGAGGAGAGGG + Intronic
1060041363 9:120304352-120304374 CCGTGGAGATGGAGAGGGAGAGG - Intergenic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060213933 9:121726983-121727005 GATGGGAGGTGGAGAGGAGTAGG + Intronic
1060228800 9:121812388-121812410 CAGGGTAGCTGGAGAGGACTTGG + Intergenic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061279077 9:129586730-129586752 CAGTGGAGTTGGGTAGGAGTGGG + Intergenic
1061390618 9:130315344-130315366 GAGGGGAGAGGGAGGGGAGTGGG - Intronic
1062016938 9:134295780-134295802 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016946 9:134295807-134295829 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016954 9:134295834-134295856 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062019020 9:134307479-134307501 CAGTGGAGAGGGGTCGGAGTGGG + Intergenic
1062059192 9:134485894-134485916 CTGTGGCGAGGGACAGGAGTGGG - Intergenic
1062323275 9:136000948-136000970 CGGTGGGGAGGGAAAGGAGTGGG + Intergenic
1062478341 9:136740517-136740539 CAGTGGGGATGAGGAGGCGTGGG - Intronic
1062752902 9:138269536-138269558 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1203575418 Un_KI270745v1:4310-4332 CAGTGAAGATGTGGAGGAATTGG - Intergenic
1185566770 X:1100552-1100574 AAGAGGAGATGGAGGAGAGTGGG + Intergenic
1185831098 X:3303767-3303789 CAGGAGACACGGAGAGGAGTAGG + Intergenic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186658721 X:11645736-11645758 AAGAGGAGAAGGAGAGGAGTAGG + Intronic
1187410905 X:19049792-19049814 TAGTGGAGTTGGGGAGGAGAGGG - Intronic
1187491869 X:19759725-19759747 CAGTGGAGAAGAGGAGGGGTGGG + Intronic
1188046723 X:25433798-25433820 CAGTGTAGAAGGATAAGAGTAGG - Intergenic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1188821560 X:34781449-34781471 GAGTGGTGTGGGAGAGGAGTTGG + Intergenic
1189250152 X:39594461-39594483 CAGTGGTGTTGATGAGGAGTGGG + Intergenic
1189648600 X:43163325-43163347 CAGGGGACAAGGATAGGAGTTGG + Intergenic
1189663834 X:43331995-43332017 CAGTGGAGATTCAGTGGTGTGGG + Intergenic
1190073829 X:47300948-47300970 AAGAGGAGAAGGAGAGGAGGAGG + Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1191053189 X:56216143-56216165 AAGTGAAGATGAAGAGAAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192410158 X:70926917-70926939 GAGTGGGGATGGAGTTGAGTGGG + Exonic
1192891832 X:75398891-75398913 CAGTGAAGATGAACAGGATTGGG - Intronic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193951572 X:87807302-87807324 TAATGGAGATGGAGAGTAATAGG - Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195722938 X:107884301-107884323 ACTTGGAGTTGGAGAGGAGTAGG + Intronic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1196135621 X:112206624-112206646 GAGTGTAGATGGAGAAGAGAAGG - Intergenic
1196830750 X:119773653-119773675 GATTCGGGATGGAGAGGAGTAGG + Intergenic
1196871317 X:120116003-120116025 GAGAGGGAATGGAGAGGAGTGGG + Intergenic
1197550243 X:127884034-127884056 CATTGGAGACGCAGAAGAGTGGG + Intergenic
1197718952 X:129731676-129731698 GAGTGGAGATGGCAAGGAGAGGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198131302 X:133697920-133697942 CAGAGGGGAAGGAGAGGAGGGGG + Intronic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198221093 X:134603207-134603229 GACTGGGGATGGGGAGGAGTGGG + Intronic
1198249976 X:134870459-134870481 ATGAGGAGAGGGAGAGGAGTTGG + Intergenic
1198618584 X:138482863-138482885 CAGAGTAGAGGGAGAGGAGGAGG - Intergenic
1198676857 X:139140424-139140446 GCCTGGAGATGGAGAGGTGTGGG - Intronic
1199252473 X:145679161-145679183 CACTGGATATGGAGATGAGAAGG - Intergenic
1199650774 X:149944769-149944791 AAGAGGAGAAGGAGAGGAGGGGG + Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199991635 X:152990605-152990627 CATTCGAGATGAAGAAGAGTGGG - Exonic
1200020238 X:153197855-153197877 CAGAGGAGAGGGAGAGGCATGGG - Intergenic