ID: 950231105

View in Genome Browser
Species Human (GRCh38)
Location 3:11276616-11276638
Sequence GATAAGAAGGAAAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950231105_950231109 21 Left 950231105 3:11276616-11276638 CCTGACCACTTTTCCTTCTTATC 0: 1
1: 0
2: 1
3: 35
4: 387
Right 950231109 3:11276660-11276682 GCTGACCTTGCCCCTCACTTAGG 0: 1
1: 0
2: 1
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950231105 Original CRISPR GATAAGAAGGAAAAGTGGTC AGG (reversed) Intronic
901350383 1:8590230-8590252 ACTAAGAAGGAAAAGGGGTGGGG + Intronic
901421124 1:9151841-9151863 GATAAGAAGGAAATGTGGGGAGG + Intergenic
902049550 1:13551966-13551988 ACTAAAAAGGAAAATTGGTCGGG + Intergenic
905165161 1:36077001-36077023 CATAAGAAAGAAAAGTCTTCAGG - Intergenic
905623992 1:39474861-39474883 GACCAGAAGGAAAAGGGATCTGG + Intronic
906220921 1:44078729-44078751 AACAAGAAGGAAAAGCGGCCGGG - Intergenic
906749168 1:48243167-48243189 AATAATAAAGAAAAGTGGTGGGG - Intronic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
908224505 1:62042370-62042392 GAAAGGAAGAGAAAGTGGTCAGG - Intronic
908488731 1:64621580-64621602 GATAAGAATCGAGAGTGGTCAGG + Intronic
908553461 1:65233165-65233187 CAAAAGAAGGGAAAGTGGCCAGG - Intergenic
908694318 1:66820906-66820928 AACAAGAAGGAAATGTGGCCAGG - Intronic
909157213 1:72092945-72092967 GATAAGAAGTTAAGGAGGTCAGG - Intronic
910126465 1:83848144-83848166 GATAAGAAGGACCAGAGGTAGGG - Intergenic
910446904 1:87307957-87307979 GACAAGGAGGAAAAGTGGAGGGG - Intergenic
910891257 1:92022783-92022805 AATAAGAAGGAAAACTGGGGTGG + Intergenic
910928135 1:92417127-92417149 GAGAAGAAGGAAAATAAGTCTGG + Intergenic
911964400 1:104348327-104348349 GAAGAGAAGGGAAAGTGGGCTGG + Intergenic
912903469 1:113678140-113678162 GAAAAGAATAAAAAGTGTTCTGG + Intronic
912982560 1:114389354-114389376 GCTAAGAAGTTAAAGTGGTCAGG - Intergenic
914515281 1:148369015-148369037 CATTAGAAGTAAAAGTGGGCTGG - Intergenic
915212558 1:154321366-154321388 GATAAAAACGAAAAGTGATAGGG - Intronic
915729152 1:158040806-158040828 GATAAGATGGAAAAGAAGTTGGG + Intronic
915794358 1:158712131-158712153 GATAAGAATGTAAACTGGTGTGG - Intergenic
916570785 1:166025484-166025506 GAAAAGAAGGAAAAGAGGGAGGG - Intergenic
916582697 1:166122929-166122951 TATATGAGGGAAACGTGGTCCGG + Intronic
917100107 1:171436714-171436736 GTTCAGAAGGAAAAGAGGTTGGG - Intergenic
918325058 1:183402209-183402231 GATTTGAAGGAAAGGAGGTCTGG - Intronic
918392683 1:184082758-184082780 GTTTAGAAGGAAAATTGATCTGG - Intergenic
918604624 1:186407778-186407800 GGTAAGAAAAAAATGTGGTCTGG - Intronic
918662462 1:187106426-187106448 AAGAGGAAGGAAAAGTGGACTGG - Intergenic
918882264 1:190139605-190139627 CATTAGAAGGAAAGGTGGGCAGG + Intronic
919325287 1:196099610-196099632 GAGAAGATGGAAAAGTGGGGGGG + Intergenic
919415760 1:197306962-197306984 TATAAGAGGGAAAAATGGTCAGG - Intronic
920077996 1:203350961-203350983 GAAATAAAGGAAAAGTGGTAGGG - Intronic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
921329357 1:214020013-214020035 AAAAAGTAGGAAAGGTGGTCAGG - Intronic
922968005 1:229708376-229708398 GATGAGAATGCAAAATGGTCCGG - Intergenic
923078315 1:230629941-230629963 GATGAGAAAGCATAGTGGTCAGG - Intergenic
924170611 1:241336099-241336121 GCTATGTAGAAAAAGTGGTCTGG - Intronic
924452319 1:244189552-244189574 GAGAAGGAGGAAGAGAGGTCAGG - Intergenic
1063313579 10:4980587-4980609 GATGAGCAAGAAAAGTGGTTTGG - Exonic
1063314374 10:4987133-4987155 GATGAGCAAGAAAAGTGGTTTGG + Intronic
1063784313 10:9363362-9363384 TAGAAGAAGAAAAAGTTGTCTGG - Intergenic
1064860026 10:19816527-19816549 GAAAAGAAGCAAAACTTGTCGGG + Exonic
1065145911 10:22767903-22767925 GAGAAAAAAGAAGAGTGGTCTGG + Intergenic
1066667060 10:37793546-37793568 GATATTAAGGCAAAGTGGTGTGG + Intronic
1066675154 10:37880013-37880035 AAAAAGAAGGTAAAGTGGCCGGG - Intergenic
1067573546 10:47389051-47389073 GATAAGCGGGAAATGTGGGCTGG - Intergenic
1067763039 10:49064104-49064126 GAAAAGAAGGTAAACTGGTTTGG - Intronic
1068368746 10:56086615-56086637 CAAAAGGAGGAAAAATGGTCAGG + Intergenic
1068566721 10:58583961-58583983 GCTATGAAGAAAAAGTGGCCAGG - Intronic
1069455330 10:68549500-68549522 GATAAAAAGGAAAATTAGTCTGG + Intergenic
1070871598 10:79758726-79758748 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071638519 10:87280889-87280911 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071656723 10:87457063-87457085 GAGAAAAAGGAAAGGTGGTAAGG - Intergenic
1072333500 10:94376340-94376362 TATAATAAGGAAAAATGGCCTGG + Intergenic
1073983594 10:109182871-109182893 AATAAGAAGGAAAGGTGATATGG - Intergenic
1075432644 10:122401454-122401476 GAAAAGAAGGAAAAGTGCAGGGG + Intronic
1077728398 11:4701305-4701327 TATAAGAAGAAAAAGAGATCTGG + Intergenic
1077913239 11:6592646-6592668 GTTAAGAAGAAAAATTGGCCGGG - Intronic
1078525724 11:12099761-12099783 TATAAGAAAGAAAAATGTTCTGG + Intronic
1079399610 11:20095676-20095698 AATAAGAAAGAGATGTGGTCTGG - Exonic
1081769590 11:45640847-45640869 TAAAAGAAGGAACAGTGGCCGGG + Intergenic
1081927543 11:46843317-46843339 TATAAGTAGGTAAAATGGTCAGG + Intronic
1083095519 11:60246945-60246967 TATAAGAAGGACTACTGGTCTGG - Intergenic
1084143978 11:67254003-67254025 GAGAAGAAAGAAAACTTGTCTGG + Intronic
1085686971 11:78632180-78632202 GATAACAAGGAAAGATGGGCTGG - Intergenic
1087707092 11:101505716-101505738 GATAAGAAGGGAAAGTGAGCCGG + Intronic
1088047599 11:105472714-105472736 AAAAAGAAAGAAAAGTGGTGGGG + Intergenic
1089261268 11:117225535-117225557 GACAAGAAGGAAATGGGGTTGGG - Intronic
1089592178 11:119549492-119549514 GAAAAGAAGGAAAGCTGTTCAGG + Intergenic
1090070927 11:123544384-123544406 GTTAGGAAGGAAAGGTGGTCAGG - Intronic
1090318286 11:125817252-125817274 GAAAAGAAGGAAAAGTAAACGGG - Intergenic
1090526747 11:127545855-127545877 GAGAAGAAGGTAATGTGGTGTGG + Intergenic
1091615160 12:2045362-2045384 GTTAAGAAGGTAAAGGGGTTAGG + Intronic
1091752776 12:3033010-3033032 GTTAGGAAGGAAAACTGCTCAGG + Intronic
1092244678 12:6856988-6857010 GATAAGAAAGGAAAGTAGTCAGG + Intronic
1092970170 12:13686313-13686335 GAAAAGAAGGAAATGGGGTTTGG - Intronic
1095144479 12:38709253-38709275 GATAAGACAGAAAAGGGCTCAGG - Intronic
1095546849 12:43382036-43382058 GATAGGAAAGAAAAATGGTGTGG + Intronic
1095570380 12:43677220-43677242 GAAAAGAAGAAAAAGAGGTTTGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096546446 12:52343427-52343449 GAGAATGAGGCAAAGTGGTCTGG + Intergenic
1097031716 12:56094568-56094590 GATAATAAGGAGAGGGGGTCAGG + Intronic
1098337880 12:69422334-69422356 GAAAAGAAGAAACAGTGGCCAGG + Intergenic
1098373559 12:69786333-69786355 GAAAAGAAGGCAAAGGGGTATGG - Intronic
1098992398 12:77078223-77078245 TATAAGAAAGAAATGTGATCAGG - Intergenic
1099020668 12:77400382-77400404 AATAAAAAGGAAAAATGGTCAGG - Intergenic
1100808445 12:98312467-98312489 GAAATGAAGGAAAAGTGTTAAGG + Intergenic
1102118559 12:110422551-110422573 GAAAAGAGGGAAAATTGGTTGGG - Intergenic
1103589417 12:121980642-121980664 AATGAGAAGGAAATGAGGTCAGG - Intronic
1104075707 12:125387890-125387912 CAAAAGAAGGAAAAGTCTTCGGG + Intronic
1104440929 12:128792405-128792427 GATAAGAAACAGATGTGGTCTGG - Intergenic
1104816573 12:131649596-131649618 GAAAAAAAGTAAAAGTGGTTGGG - Intergenic
1104886485 12:132112279-132112301 GTAAAGAAAGAAAAGTGGGCTGG + Intronic
1107417379 13:40213125-40213147 AAGAAGAAAGAAAAATGGTCTGG + Intergenic
1108403570 13:50076977-50076999 AATAAGAAGCAAAAGAGGTCTGG + Intergenic
1108919712 13:55659531-55659553 GAAAAGTAGGAAAAGGGGTTGGG + Intergenic
1109062017 13:57632175-57632197 GATAAGAAGGAAATCTCGTCTGG - Exonic
1109667310 13:65556250-65556272 AATTATAAAGAAAAGTGGTCTGG - Intergenic
1109708434 13:66130435-66130457 TAAAAGAAGGAAAAGTGGCCGGG - Intergenic
1110102458 13:71626577-71626599 GATAAGAAGGAAAAATGTCCTGG - Intronic
1110296420 13:73871656-73871678 GGTGTGAAGGAAAAGTGGTTGGG - Intronic
1112236892 13:97644900-97644922 GAAAAGAAGGTAATGTGGACTGG - Intergenic
1112880411 13:104100331-104100353 AATATGAAGGAGAAGTGCTCTGG - Intergenic
1113036313 13:106053200-106053222 TATAAGAGGGAAAAGTGGGCCGG - Intergenic
1115532453 14:34339844-34339866 GTTAAGAGGGAAAAGTAGGCCGG - Intronic
1116664086 14:47752593-47752615 AATATTAAGGAAAAGTGGTGAGG - Intergenic
1117587149 14:57221069-57221091 GATAATAAGGATAACTGGGCTGG + Intronic
1117795029 14:59384091-59384113 GACAGGAAGGAAAAAGGGTCAGG - Intergenic
1118103710 14:62634316-62634338 GATAAGAAGGAAATTAGGGCTGG + Intergenic
1118338454 14:64875189-64875211 GAGAAAAATGAAAGGTGGTCTGG + Intronic
1118442326 14:65822977-65822999 GATAAGAAGGATTAGGGATCAGG - Intergenic
1118454259 14:65930416-65930438 AATAAGAAGGAAAATTAGCCAGG - Intergenic
1118768434 14:68925682-68925704 GACAAGAAGGGCAAGTGGTCAGG + Intronic
1119656737 14:76422505-76422527 TATAAGAAGGAAATGTCGGCCGG - Intronic
1119933795 14:78572196-78572218 GATAAGAAAGAAGAGCAGTCAGG - Intronic
1202914726 14_GL000194v1_random:157463-157485 GATAAAAAGGGAAAGAGGACGGG - Intergenic
1124787689 15:32697363-32697385 GATAGGAGGGAAAAATGGTGGGG + Intergenic
1125205038 15:37144523-37144545 GAGTGGGAGGAAAAGTGGTCTGG - Intergenic
1125928237 15:43581168-43581190 GAAAGGAAGGAACAGGGGTCCGG - Intronic
1125941402 15:43681003-43681025 GAAAGGAAGGAACAGGGGTCCGG - Intergenic
1126306223 15:47261000-47261022 GATAAGAAGGTAAATTGTTTGGG - Intronic
1127089418 15:55451948-55451970 CAAAAGAAGGAAAATAGGTCTGG + Intronic
1127192971 15:56551883-56551905 GATAAGAATGTAAAATGGTGTGG + Intergenic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129667173 15:77585851-77585873 GTTAAGGAGAAAAAGAGGTCGGG + Intergenic
1135470052 16:22722085-22722107 AAAAAGAAGGAAAAGTGGACTGG + Intergenic
1136550224 16:30979108-30979130 CATAGGAAGGAAAGGAGGTCAGG - Intronic
1137553842 16:49457832-49457854 GAGCAGAAGGAAAGGTGGTTTGG + Intergenic
1137637008 16:49995714-49995736 AAGAAGAAGGCAAACTGGTCTGG + Intergenic
1138141170 16:54569768-54569790 GATATGAAAGAAAGGTGTTCTGG - Intergenic
1138742137 16:59323317-59323339 GCAATGAAGGAAAAGTGGTTTGG - Intergenic
1138759039 16:59520761-59520783 GAAAAGAAGGTAACGTGGACTGG + Intergenic
1139686158 16:68605284-68605306 GAGAAGAAGGAAAACAGGCCAGG - Intergenic
1140347175 16:74225216-74225238 GATAAGAAGGAAAAGAAGACAGG + Intergenic
1141258189 16:82423619-82423641 GATAAGAAAGAGAAGGCGTCAGG - Intergenic
1141489562 16:84362969-84362991 GAAAAGAAAGAAAAGTGAGCAGG - Intergenic
1141573605 16:84950095-84950117 GATAAAAAGAGAAAGTGGCCTGG + Intergenic
1141844602 16:86598830-86598852 GATAAGAAGGAAAGATGATTGGG - Intergenic
1142467064 17:142074-142096 GATAAGAAAGAGAAGTGGGCAGG + Intergenic
1143707078 17:8706003-8706025 GATCAGAAAGACAAGTGGGCCGG - Intergenic
1144177002 17:12717143-12717165 GATAAGAAGGTAAAGAGCTTGGG - Intronic
1146526220 17:33569200-33569222 GATAATAAGGCAAGGTGGTTGGG + Intronic
1148520643 17:48271841-48271863 GACAAGAAGTAGAAGTGGTATGG - Intronic
1149086296 17:52720809-52720831 GATAATCTGGAAAAGTGGTGGGG + Intergenic
1153682644 18:7515051-7515073 GAAAAAAAGGAAAAGGGGTGGGG - Intergenic
1153833207 18:8941194-8941216 GATTAAAATGAAAAGTGATCTGG - Intergenic
1154084749 18:11292877-11292899 GATTAGAAGGAAAGGAGGTCTGG - Intergenic
1155628193 18:27860700-27860722 GAGAAGAAGAAGAAGTTGTCTGG - Intergenic
1155859292 18:30876826-30876848 GACCAGAAGGAAAAGTGACCTGG + Intergenic
1156510608 18:37633583-37633605 GATATGGAGGAAAAGAGGACAGG + Intergenic
1156576741 18:38325874-38325896 AATATGAAGGAAAAGTATTCTGG - Intergenic
1157891031 18:51418216-51418238 GATGACAAGGAAAAGAGGGCGGG - Intergenic
1158169833 18:54585432-54585454 GGAAAGTAGGAAGAGTGGTCTGG - Intergenic
1158448173 18:57539402-57539424 GAAAGGAAGGAAAAGAGATCAGG + Intergenic
1159084266 18:63770358-63770380 GAAAAGAAGGAAGACTGGCCAGG - Intronic
1160937027 19:1601304-1601326 GCTAAGAAGGAAATGAGGGCCGG + Intronic
1162102988 19:8351813-8351835 TATAAGAAAGAAAAGGGGCCGGG + Intronic
1162131850 19:8530742-8530764 GAAAAGAAGAAAAAGGGGCCGGG + Intronic
1162274134 19:9639675-9639697 GAGAAGAAGGTAAAGTGGAGCGG + Intronic
1162813384 19:13178412-13178434 GAAAAGAAAGAAAAGTGCACTGG - Intergenic
1163719464 19:18891873-18891895 GATGAGAATGAGAAGTGGGCTGG - Intronic
1164462065 19:28457471-28457493 GGGAGGAAGGAAAAGGGGTCAGG - Intergenic
1164510742 19:28895040-28895062 GATAAGAAGGTAATTGGGTCGGG - Intergenic
1165701130 19:37938916-37938938 AAAAAGAAGCAAAAGTGGCCGGG - Intronic
1167250765 19:48397305-48397327 AATGAGAGGGAAAAGGGGTCAGG - Intronic
1167393674 19:49212984-49213006 GAAAAGAAGAAAAAGTGGCCGGG - Intergenic
1168665525 19:58202085-58202107 GACAAGGAGGAAAAGTGATGGGG + Intronic
1168693649 19:58392934-58392956 GAAATGAAGGGAAAATGGTCAGG - Intronic
926913675 2:17873887-17873909 TTTAAGAATGAAAAGTGGCCAGG - Intergenic
927146736 2:20171116-20171138 GAGCAGAAGGAAAAGAGGGCAGG - Intergenic
928396997 2:30950334-30950356 GAAAAGAAGGAAAATTGGGGAGG + Intronic
928842182 2:35622835-35622857 AATAAGAAGAGAAATTGGTCGGG + Intergenic
929694450 2:44102230-44102252 AATAAGAAGTACAAGTGGGCTGG + Intergenic
930840667 2:55841667-55841689 GATATGAAAGAAAGGTGGTTGGG + Intergenic
932280233 2:70485172-70485194 GAGAAGAAGGAAGAGCGGTAAGG - Intronic
933651954 2:84856741-84856763 GAAAAGGAGAAAAAATGGTCAGG - Intronic
934723457 2:96598611-96598633 GATTAGAAGGAAACGTTGGCCGG + Intronic
935030824 2:99320301-99320323 GATAAAAAGGAAAATAGGTCTGG - Intronic
936468040 2:112771292-112771314 GATAAAAAGAAAAATTGGTGAGG + Intergenic
939254931 2:139730596-139730618 TTTAAAGAGGAAAAGTGGTCTGG - Intergenic
939369872 2:141285380-141285402 TAAAAGAAGGAAAAGAGGCCAGG - Intronic
940631293 2:156242698-156242720 GATAAGGAGGAAGAGAGGCCAGG - Intergenic
940741487 2:157514715-157514737 AATAAGAAGTAAATGAGGTCAGG - Intergenic
940904970 2:159160922-159160944 GAGAGGAAGGAAAAGGGGTGGGG - Intronic
941483885 2:166054020-166054042 AAGAAGAAAGAAAAGGGGTCAGG + Intronic
941745577 2:169083298-169083320 GAGAGGAAGGAAAAGAGGTGTGG - Intronic
941771375 2:169349431-169349453 GAGGAGAAGGAAATGAGGTCAGG + Intronic
942311998 2:174664617-174664639 GACAAGAAGTCAAAGTGGTGTGG - Intronic
944099945 2:196013967-196013989 GAAACTAAGGAAAATTGGTCTGG - Intronic
945547681 2:211176854-211176876 GAAAAGAAGGAAAAGATGTAGGG + Intergenic
945868023 2:215198120-215198142 GATTTGAAGGAAAAGGGCTCAGG + Intergenic
946444835 2:219729261-219729283 GATAAGAACAAAATATGGTCAGG + Intergenic
946708513 2:222483049-222483071 GAAAAGAAGGAAAGTTGGGCGGG + Intronic
947095140 2:226558135-226558157 GATAAAAAGGAAATGAGGTGTGG - Intergenic
947117771 2:226790741-226790763 AATAAGAAAGAAAAGTGCTATGG - Intronic
947384834 2:229580683-229580705 CATAAGAAAGAAAAGTGTGCAGG + Intronic
1169706629 20:8513712-8513734 TAAAAGAAACAAAAGTGGTCAGG + Intronic
1169755945 20:9043380-9043402 TATAAAAGGGAAAAGTGGGCTGG + Intergenic
1170144929 20:13163070-13163092 GATAAAAATGAATAGAGGTCGGG + Intronic
1170554440 20:17504331-17504353 CATCAGAAGGAAGAGTGTTCAGG + Intronic
1170583146 20:17713907-17713929 ATTAAGAATAAAAAGTGGTCTGG + Intronic
1170698881 20:18685355-18685377 TATAAGGAGGAAAACAGGTCTGG - Intronic
1171148364 20:22805227-22805249 GTAAAGCAGAAAAAGTGGTCAGG + Intergenic
1172456926 20:35083822-35083844 GAAAAGAAAGAAAAATGCTCTGG + Intronic
1173049441 20:39545272-39545294 GATAGCAAGAAAAAGTGGTGGGG - Intergenic
1173584469 20:44171764-44171786 GATAACAGGGAAACCTGGTCTGG - Intronic
1174767978 20:53271687-53271709 GATAAGAGGGAAAAGTGTTGCGG + Intronic
1174782793 20:53405698-53405720 GATAAAAAGAAATAGTGGCCAGG + Intronic
1176634079 21:9172108-9172130 GATAAAAAGGGAAAGAGGACGGG - Intergenic
1176695771 21:9976438-9976460 GATTATAGGGAAAAGTGATCTGG - Intergenic
1177515956 21:22151712-22151734 GAAAAGAAGGAAATGTGGCCTGG - Intergenic
1177524791 21:22277096-22277118 GATTGGGATGAAAAGTGGTCTGG + Intergenic
1177953066 21:27562804-27562826 GATAAGAAGTAAAAGATGTTTGG - Intergenic
1178212356 21:30550725-30550747 GATCAGAAGAAAATGTGTTCTGG + Intronic
1181951468 22:26556921-26556943 TTTAAGAAGTAAAAGTGGCCAGG + Intronic
1182746730 22:32611689-32611711 GCTAAGAAGGAAGAATGTTCAGG + Intronic
1183122081 22:35737952-35737974 GGTAAGAAAGAAAAGAGGCCAGG + Intergenic
1183495357 22:38140210-38140232 GATAAGAACGTAAAGAGGCCGGG + Intronic
950037801 3:9899614-9899636 GATAAGAAGGAAGAGAGGAAGGG - Intergenic
950231105 3:11276616-11276638 GATAAGAAGGAAAAGTGGTCAGG - Intronic
950954326 3:17035411-17035433 GATAAGAGAGAAAACTGGTCAGG - Intronic
951025963 3:17830192-17830214 GACAAGAAGAAGAAATGGTCTGG - Intronic
952624552 3:35388640-35388662 AATAAAAAGGAAAAATGGTGGGG + Intergenic
953115717 3:39990269-39990291 GAGAAGAAGGAAGAGTAGTGTGG - Intronic
953228644 3:41044014-41044036 GGAAAGATGGAAAAGGGGTCTGG - Intergenic
953303073 3:41798641-41798663 GCTAAAAGGGAAAAGTGGGCCGG + Intronic
953622747 3:44547289-44547311 TTTGAGAAGGAAAAGTGGTGGGG + Intergenic
954787609 3:53105935-53105957 TATAAGAAGTAATAGTGGCCAGG + Intronic
954816077 3:53281734-53281756 GATAAGATGGAAAAGGTGGCTGG - Intergenic
955166418 3:56518664-56518686 GAAAAGAAAGAAAGGTGGTAGGG + Intergenic
955552677 3:60101055-60101077 GGTAAGAAGCAATGGTGGTCTGG - Intronic
955838387 3:63084197-63084219 GACAAGAAGCAACAGTAGTCAGG + Intergenic
956591058 3:70915070-70915092 GAAAAGAAGGAAAATAGGACTGG - Intergenic
956927303 3:74003183-74003205 GATAAAAAGAAAAAGTGGGCCGG - Intergenic
957196773 3:77078871-77078893 GATATGAAAGACAAGTGGCCAGG - Intronic
959031570 3:101305553-101305575 AATAACAGGGAAAAGTGGTGGGG + Intronic
959165010 3:102765607-102765629 GAAAAGTAGGAAAACTAGTCAGG + Intergenic
960011845 3:112842137-112842159 CATCAGAGGGAAAACTGGTCAGG + Intronic
960826410 3:121789843-121789865 GATAAGAAAAAAAACTGGTGGGG + Intronic
961004312 3:123394633-123394655 GATAACACTGAAAAGTGGTAAGG + Intronic
961112349 3:124295835-124295857 GACAAGAAGGAAAAGAAGACAGG - Intronic
961167178 3:124771450-124771472 AATAAGAAGGAATAGTGGGCTGG + Intronic
963155209 3:142088770-142088792 GATAAGAAAGATAGCTGGTCTGG - Intronic
964223495 3:154371072-154371094 TTTAATAAGGAAAAGTGGTGGGG - Intronic
964374545 3:156036088-156036110 GATAAGAAGGAAAACAAGGCTGG - Intergenic
964391984 3:156207243-156207265 GAGAAGAAGAAAATGTGGTTGGG + Intronic
965030824 3:163365352-163365374 GATCACAAGGAAAATTGGTAAGG + Intergenic
966088188 3:176096988-176097010 GATCAAAAGGAATAGTGCTCAGG - Intergenic
966446943 3:180011078-180011100 GAAAGGAAGGGAAAGTGGTGTGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967212333 3:187180066-187180088 GAAAAGTGGGAAAAGTGGTTGGG + Intronic
967260750 3:187639437-187639459 GATAAGAAGTAAAAGTAGATTGG - Intergenic
967658052 3:192074210-192074232 GAAAAGAAGGTAATGTGGACTGG + Intergenic
969623427 4:8290353-8290375 GATGAGAAGGACCAGTGGCCTGG + Intronic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
971307844 4:25499278-25499300 GAGAAGGAAGAATAGTGGTCAGG - Intergenic
971552717 4:27976554-27976576 GAAAAGAAGGTAATGTGGTGTGG - Intergenic
971663415 4:29450251-29450273 GAGAGAAATGAAAAGTGGTCTGG - Intergenic
972006591 4:34116748-34116770 TATTAGAAGGGAAAGTGGTGTGG + Intergenic
972968016 4:44536077-44536099 GTTAAGAAGGAAATGTGGGCCGG - Intergenic
974181315 4:58387202-58387224 GAGAGGAAGGAAGAGTAGTCTGG - Intergenic
974550276 4:63363215-63363237 AATAAAAAGGAAAAGTGATATGG - Intergenic
974922271 4:68256460-68256482 GATAAGACTGAGAAGTTGTCAGG - Intergenic
974986337 4:69030832-69030854 GAAAAAAAGGTAAAGTGTTCAGG + Intronic
974991678 4:69099277-69099299 AAGAAGCAGGTAAAGTGGTCAGG + Intronic
975021288 4:69493116-69493138 GAAAAGCAGGTAAAGTGTTCAGG - Intronic
975174786 4:71275749-71275771 TATAGGAAGGAAATGTGGTGTGG - Intronic
976099009 4:81540520-81540542 GATAAGAGTGAAAATTGGCCAGG + Intronic
976744882 4:88392483-88392505 GATGATAAGAAAAACTGGTCAGG - Intronic
977062677 4:92276049-92276071 GAAAAGTGGGAAAAGTGGTTGGG + Intergenic
977275944 4:94977561-94977583 TATAAGAAGCAAAAATGGCCAGG + Intronic
977597839 4:98903064-98903086 TATCAGAAAGAAAAGTAGTCTGG + Intronic
978513662 4:109548711-109548733 GAGAAGAAGGAAGAGAGATCAGG - Intergenic
979322058 4:119336306-119336328 GAAAAGTAGGAAAAATAGTCTGG + Intergenic
979324475 4:119362584-119362606 GGTGAGAATGAAAAGTGGTTTGG + Intergenic
979860353 4:125685934-125685956 GATAAGAAGGAACAATGGCAGGG + Intergenic
980368390 4:131836678-131836700 GATTATAGGGAAAAGTGATCTGG - Intergenic
982083908 4:151815736-151815758 GAAAAGAAGGTAATGTGGACTGG + Intergenic
982701297 4:158661622-158661644 TTTGAGAAGGAAAAGTGGTGGGG - Intergenic
984723516 4:182999050-182999072 GAAATGAAGGAAAAATGGTAAGG + Intergenic
984993167 4:185401586-185401608 CACAAGAAGGCAAAGAGGTCAGG + Intronic
986554984 5:9001669-9001691 GAAAAGAAGGTAATGTGGACTGG + Intergenic
987080793 5:14423626-14423648 GATCGGAAGGAAAAGTAGCCAGG + Intronic
988310520 5:29550686-29550708 GATAAGGAAGAGAAGTTGTCTGG - Intergenic
989171863 5:38479193-38479215 GAAAAGAAGGAAAACTGCTTTGG + Exonic
989607127 5:43255452-43255474 GATAAGAAAGAAAAGAGGGCCGG + Intronic
990015011 5:51049933-51049955 GTTAAGAAGAAAAAATGGTCTGG - Intergenic
990687511 5:58322745-58322767 GATAAGAAGGAAGAGAGGGAGGG + Intergenic
990791447 5:59484524-59484546 GAAAATAAGGAAATGAGGTCTGG - Intronic
991072662 5:62501975-62501997 GGCAAGATGTAAAAGTGGTCAGG + Intronic
992002638 5:72450745-72450767 GATGAGAAGGCCAAGTGTTCTGG - Intronic
992049541 5:72929951-72929973 TTTAATAAGGAAAAGTGGTGGGG - Intergenic
992094699 5:73352066-73352088 GAGAGGAAGGAATAGTGGGCAGG + Intergenic
995736808 5:115310459-115310481 GAGAAGCAGGAAAAGTGGTCAGG - Intergenic
996680385 5:126223811-126223833 TTTAATAAGGAAAAGTGGTGGGG - Intergenic
996866322 5:128127092-128127114 GATCATAAGGAATATTGGTCTGG + Intronic
997502256 5:134385362-134385384 GGTAAGAAGGAAAAGGGCTTAGG + Intronic
999571314 5:152923167-152923189 GAAGAGAAAGAAAATTGGTCTGG - Intergenic
1000073002 5:157758400-157758422 GATAATAAAGAAAAGGGGACCGG - Exonic
1000439781 5:161251079-161251101 GAAAAGAAGGTAAAGTGGAGTGG - Intergenic
1000591764 5:163166758-163166780 GAAATGAAGGAAAAGTGTTAAGG + Intergenic
1000931363 5:167255528-167255550 AACAAGAAGGAAAAGAGGGCAGG - Intergenic
1001823287 5:174725995-174726017 GAGAGGACGCAAAAGTGGTCAGG - Intronic
1002404073 5:179015326-179015348 TTTAAGAAGGAAAAGTGGGCTGG + Intergenic
1002499301 5:179637060-179637082 GAAAAGAAACACAAGTGGTCGGG + Intergenic
1002623085 5:180503898-180503920 GTTAAGAAGAAAAAGGGGCCAGG - Intronic
1002704164 5:181148987-181149009 GAGCAGAAGGAAAGGAGGTCTGG + Intergenic
1002899559 6:1399494-1399516 GGTAAGGAGGGAAAGAGGTCTGG + Intergenic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003461976 6:6337839-6337861 GATAAGAAAGAAATGTTGGCCGG + Intergenic
1003655404 6:8002587-8002609 GAGAAGAAAGAAAAGGGGTAGGG + Intronic
1003746706 6:9010037-9010059 GATTAGAAAGAAAGGGGGTCGGG - Intergenic
1004839357 6:19565177-19565199 GAGAAGAAGGAAAAGTTCTCTGG + Intergenic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1006781623 6:36636358-36636380 GAGAAGAAGGAAAAGAGATCTGG + Intergenic
1006874516 6:37283746-37283768 GATAAGAATGAAAGTTGGCCTGG + Intronic
1008035324 6:46739129-46739151 GATAAGAATGAAAGGAGGGCTGG + Intergenic
1008589914 6:52983728-52983750 GATAATGAAGAAATGTGGTCTGG - Intronic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1011004325 6:82626481-82626503 TAAAAGAAGCAAAAGTGGCCAGG - Intergenic
1011130961 6:84051560-84051582 TAAAAGAAGGAAAAGAGGCCAGG + Intronic
1011559257 6:88598447-88598469 GATTAGCATGAAAAGTGCTCAGG + Intergenic
1011933723 6:92747288-92747310 GAATAGAAGGAAAAATGCTCTGG - Intergenic
1012184934 6:96201461-96201483 AATAAGAAGGAAAAATGTTAAGG - Intronic
1013570226 6:111415794-111415816 GATAAGAAGGAATAGTAGTGTGG - Intronic
1013650176 6:112186984-112187006 AATAAGAAGGAAAGGTGGGTGGG + Intronic
1014280511 6:119437947-119437969 GATTAGAAAGCAAAGAGGTCTGG - Intergenic
1015004821 6:128266546-128266568 TAGAAGAAGGAATTGTGGTCTGG - Intronic
1015845590 6:137517147-137517169 GATAAAAAGGAAAATTGCTGTGG + Intergenic
1016257965 6:142131901-142131923 CATAAGAAGGAATAGTGCTTTGG - Intergenic
1016448451 6:144156357-144156379 GAAAAGAAGGAAATGAGGCCAGG - Intronic
1016883500 6:148935021-148935043 GGTAAAAAGTAAATGTGGTCTGG - Intronic
1017279796 6:152610710-152610732 GAAATGAAGGAAAAATGGTAAGG + Intronic
1018670067 6:166169747-166169769 GATAAAAGGGAAAAGTGGAGGGG + Intergenic
1018972724 6:168539767-168539789 GAAAAGAAGGGAGAGTGGACCGG - Intronic
1019080992 6:169429611-169429633 GATAAGAAAGAAAGGAGGCCAGG - Intergenic
1019849628 7:3541463-3541485 GAAGAGAAGGAAAAGAGGTTGGG - Intronic
1021733229 7:23617706-23617728 GATCAGAAGTGAAAGTGGCCTGG - Intronic
1022798583 7:33753262-33753284 GGTAAGAAAGAAACTTGGTCAGG - Intergenic
1023379103 7:39588213-39588235 TAGAAGAAGGAAAAATGGGCCGG + Intronic
1023994856 7:45153100-45153122 GCTAAGAAGGAAAAGTACTTTGG - Intergenic
1024035789 7:45506453-45506475 GACAAGAAGGGAAACTGGACAGG - Intergenic
1024195699 7:47056842-47056864 AAGAAGAAGGCAAACTGGTCTGG - Intergenic
1024891631 7:54210634-54210656 GAGAAGAGGGAAAAGTGGAGAGG + Intergenic
1027689855 7:81330965-81330987 TATTAGAAGGGAAAGTGGACTGG + Intergenic
1028573657 7:92320692-92320714 GATAAGAAGTGAAGGTGGTGAGG - Intronic
1029719773 7:102355517-102355539 GAAAAGAAGGGTCAGTGGTCAGG - Intergenic
1029752840 7:102553741-102553763 GAAAAGAAGGGTCAGTGGTCAGG + Intronic
1029770791 7:102652833-102652855 GAAAAGAAGGGTCAGTGGTCAGG + Intronic
1029975037 7:104825895-104825917 AATTAGAAACAAAAGTGGTCGGG - Intronic
1031525422 7:122818073-122818095 GAAAAGTAGGAAAAGGGGTTGGG - Intronic
1034643581 7:152624569-152624591 CAAAAGAAGGAAAAGAAGTCTGG + Intergenic
1034906192 7:154949150-154949172 GAAAACAAGGAAAAGTGATTTGG + Intronic
1036441321 8:8783489-8783511 AATAAAAAGGAAAAGGGGTTTGG - Exonic
1036662643 8:10717794-10717816 CATAAGAAAGGACAGTGGTCAGG + Intergenic
1037225921 8:16589804-16589826 GATAAGAAGGAAATGTTTTATGG - Intergenic
1038902957 8:31864632-31864654 AATAAGAATGAAAGATGGTCAGG + Intronic
1039000321 8:32972803-32972825 GATCCCAAGAAAAAGTGGTCAGG + Intergenic
1041310027 8:56507169-56507191 TAAAGTAAGGAAAAGTGGTCGGG - Intergenic
1041334849 8:56770383-56770405 ATTAAGAAGAAAAAGTGCTCTGG + Intergenic
1041620413 8:59961052-59961074 AATAAGAAGGAACAGGGGTCAGG - Intergenic
1043231816 8:77812299-77812321 GCAAAGAAGGAAAAGTGGTAAGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043595667 8:81881971-81881993 GATAGGAAGGAAAGTAGGTCAGG - Intergenic
1044292599 8:90490434-90490456 GAAATGAAGGAAAAATGGTAAGG - Intergenic
1044720602 8:95142156-95142178 GATACTAAAGAAAATTGGTCAGG + Intronic
1045109389 8:98925812-98925834 AATAAGATGGAAATGTGGTTTGG + Intronic
1047084881 8:121505487-121505509 TATATGAAGGAAGAGTGTTCTGG - Intergenic
1047434847 8:124827613-124827635 GAAAAGAAAAAAAAGTGGGCTGG + Intergenic
1048038898 8:130706301-130706323 TATAAGAAGGACATGTGGTTTGG - Intergenic
1048323223 8:133418066-133418088 CATAAGAAGGACACGTGGACTGG + Intergenic
1048395912 8:134013844-134013866 GAAAAGAAGGCAAATTGTTCTGG - Intergenic
1048692065 8:136977675-136977697 GATAAGAATTGAAAGTGGGCCGG + Intergenic
1049868756 8:144957388-144957410 GAAAAGAAGGTAATGTGGACTGG + Intergenic
1051737416 9:20215629-20215651 AGAAAAAAGGAAAAGTGGTCTGG - Intergenic
1052674004 9:31595707-31595729 GAAAATAAGATAAAGTGGTCAGG - Intergenic
1052747024 9:32451031-32451053 GACAAGAAGGAAGAGTAGCCTGG + Exonic
1053072298 9:35108360-35108382 GAAGAGAAGAAAAGGTGGTCAGG + Intronic
1053632753 9:39962393-39962415 GATTATAGGGAAAAGTGATCTGG - Intergenic
1053773005 9:41501140-41501162 GATTATAGGGAAAAGTGATCTGG + Intergenic
1054211135 9:62288304-62288326 GATTATAGGGAAAAGTGATCTGG + Intergenic
1054313845 9:63560547-63560569 GATTATAGGGAAAAGTGATCTGG - Intergenic
1055857409 9:80706819-80706841 GATCAGAAGTGAGAGTGGTCTGG - Intergenic
1056931472 9:90881381-90881403 GAAAAGAATAAAAAGTGGGCCGG + Intronic
1057190100 9:93082610-93082632 AATAAAAAGGAAAGGGGGTCAGG - Intronic
1058328516 9:103728191-103728213 GATAAAAAGGAAGAGTGGGAAGG - Intergenic
1059193999 9:112353539-112353561 GAAAAAAAGGAAAAGAGGCCAGG - Intergenic
1186378811 X:9034868-9034890 GATGAGAAAGAAAAGTAGTGAGG - Intronic
1186536577 X:10356105-10356127 GAAGTGAGGGAAAAGTGGTCAGG + Intergenic
1188217433 X:27496392-27496414 GGTAAGAAGGAAATGTGGCAGGG - Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1189403188 X:40691585-40691607 GATTAAAAGAAAAAGTGGACAGG - Intronic
1189470600 X:41311012-41311034 GATAAAAGGTGAAAGTGGTCAGG + Intergenic
1189518890 X:41744638-41744660 AATAAGAAGGAAATATGGGCCGG - Intronic
1190315914 X:49150868-49150890 AAAAAGAAGAAAAAGTGGCCGGG - Intergenic
1190364843 X:49682379-49682401 GATAGGAATGAAAAATGGTGTGG - Intergenic
1190919609 X:54839665-54839687 GATAAGAGGGAAGAGTGGAAAGG - Intergenic
1191645628 X:63478199-63478221 GCTAGGAAGCACAAGTGGTCGGG + Intergenic
1193106548 X:77681215-77681237 GAGCAGAAGGAAAAGCGGACTGG - Intronic
1193286383 X:79720093-79720115 GATAAGAGGGAAACGTCATCTGG - Intergenic
1193584828 X:83308028-83308050 GATAAAAAGGAGAAGTTGTCTGG + Intergenic
1193859717 X:86650360-86650382 GAGAAGAAGGAAAAGACTTCAGG - Intronic
1194081311 X:89468162-89468184 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1194308701 X:92277587-92277609 GAAAAGTGGGAAAAGTGGTTGGG + Intronic
1194561514 X:95427707-95427729 GAGAAGAAGGAAGAGTGGGGAGG + Intergenic
1194857922 X:98956805-98956827 GATAAAAAGGAAGAGTGGGGAGG - Intergenic
1194880276 X:99242237-99242259 GTTAAGCAGGAGAAGTGCTCTGG - Intergenic
1194939324 X:99990287-99990309 GAGAAGAAGGAATAATGGTGGGG + Intergenic
1194990668 X:100543596-100543618 GAAAAGAGGGAAAAGTAGGCCGG + Intergenic
1195122998 X:101775457-101775479 GAGGAGAAGGAAGAGTGGTGAGG - Intergenic
1195205569 X:102596641-102596663 CATAATAAGGAAAAGAGGTAAGG + Intergenic
1195822910 X:108966603-108966625 GATAAGAAGGAGAATTGAACAGG - Intergenic
1196907351 X:120450672-120450694 GGCAAGAAGGAAAATGGGTCTGG + Intronic
1198995277 X:142567123-142567145 GAGAAGAGGGAAAAGTGGGGAGG - Intergenic
1199308730 X:146297879-146297901 GAGAAGAAGGAAGAGTGGGGAGG - Intergenic
1199337823 X:146640967-146640989 GATAAAAGAGAAAATTGGTCTGG - Intergenic
1199989707 X:152979510-152979532 AGTAAGAAGGAAAGGTGGTGGGG - Intergenic
1200433983 Y:3124359-3124381 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1201185886 Y:11402533-11402555 GGGAAGCAGCAAAAGTGGTCGGG + Intergenic
1201382407 Y:13396206-13396228 GATAAGAATGAAACATGGGCTGG - Intronic
1201981553 Y:19915157-19915179 TTTGAGAAGGAAAAGTGGTGGGG + Intergenic