ID: 950234527

View in Genome Browser
Species Human (GRCh38)
Location 3:11307258-11307280
Sequence GGACATCCAGGCTCTCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 2, 2: 0, 3: 16, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950234516_950234527 18 Left 950234516 3:11307217-11307239 CCCAGCTGTCTCCTTCTGTATTG 0: 1
1: 0
2: 1
3: 20
4: 244
Right 950234527 3:11307258-11307280 GGACATCCAGGCTCTCACCTGGG 0: 1
1: 2
2: 0
3: 16
4: 159
950234521_950234527 7 Left 950234521 3:11307228-11307250 CCTTCTGTATTGGCAGGAAGGTC 0: 1
1: 0
2: 0
3: 13
4: 167
Right 950234527 3:11307258-11307280 GGACATCCAGGCTCTCACCTGGG 0: 1
1: 2
2: 0
3: 16
4: 159
950234517_950234527 17 Left 950234517 3:11307218-11307240 CCAGCTGTCTCCTTCTGTATTGG 0: 1
1: 0
2: 0
3: 31
4: 198
Right 950234527 3:11307258-11307280 GGACATCCAGGCTCTCACCTGGG 0: 1
1: 2
2: 0
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950234527 Original CRISPR GGACATCCAGGCTCTCACCT GGG Intronic
901916916 1:12507089-12507111 GAACAGCCAGGCACTCACCATGG - Exonic
902148549 1:14423778-14423800 GGACATCAAAACTCTCTCCTGGG + Intergenic
903276341 1:22224261-22224283 GGACAGCCAGGCTGGCATCTGGG + Intergenic
905347232 1:37319357-37319379 GCACACCCAGGCCCTCACCCAGG - Intergenic
906328782 1:44867132-44867154 AGAAAGCCAGGTTCTCACCTAGG - Intronic
911023138 1:93408631-93408653 GGACATGCAGGCTGAAACCTAGG - Intergenic
911170580 1:94767200-94767222 TGGAATCCAGGCTCTCTCCTGGG - Intergenic
913057841 1:115178802-115178824 GGACAGCCTGAATCTCACCTGGG - Intergenic
918778197 1:188665468-188665490 GTCCATCCAGGCTGTAACCTCGG + Intergenic
920264941 1:204714840-204714862 GGGCATCCAGGCTCTTTCCCAGG - Intergenic
921611606 1:217218539-217218561 GGACATTCAGGGTCTCCCCTGGG + Intergenic
923146245 1:231200391-231200413 GAAGACCTAGGCTCTCACCTTGG + Intronic
1063241117 10:4170205-4170227 GCACTTCCAGATTCTCACCTGGG + Intergenic
1063614508 10:7590231-7590253 TGACATCCAGGCTTCCGCCTTGG - Intronic
1066509984 10:36084488-36084510 GAATATCCAGGCTCTGGCCTTGG - Intergenic
1066654890 10:37688025-37688047 GGAAGTCCAGGCTCCCCCCTCGG - Intergenic
1067222127 10:44351956-44351978 GGAACCCCATGCTCTCACCTGGG - Intergenic
1069900042 10:71701899-71701921 GGACATCCTGGCTCTGGCCCAGG - Intronic
1070744052 10:78922102-78922124 GGTCATTCAGCCTCTCTCCTGGG + Intergenic
1073039080 10:100587200-100587222 GAACATCCAGGCTCTCTACTTGG - Intergenic
1073563141 10:104514017-104514039 GGACAGTGAGGCACTCACCTCGG + Intergenic
1074916822 10:117964786-117964808 GAACATCCAGGGTCTAAACTTGG + Intergenic
1077297019 11:1831183-1831205 GGACTTCCAGCCACTCACCCGGG + Intronic
1077302368 11:1853308-1853330 GGACATCCAAGTTCTCCCATTGG - Intronic
1080305568 11:30831174-30831196 GTCCTTCCAGGCTCTCACCATGG - Intronic
1083683398 11:64361606-64361628 GGAGATGCAGGCCCTCACCCCGG + Intronic
1084353216 11:68618529-68618551 GGACAGCCACGCTCTGACCGCGG + Intergenic
1084512360 11:69614181-69614203 GGAGAGCCAGGCTCCCAGCTAGG - Intergenic
1084544728 11:69809227-69809249 GCCCATGCTGGCTCTCACCTGGG + Intergenic
1088142237 11:106631486-106631508 GAACAGACAGGCTCTCACCTTGG + Intergenic
1089320641 11:117624601-117624623 TGACTTCCAGGCTCTCATCTGGG - Intronic
1091024062 11:132126478-132126500 GGAAATCAAAGCTCTCACCATGG + Intronic
1091538339 12:1435077-1435099 AGACATCAACCCTCTCACCTTGG - Intronic
1096801463 12:54113206-54113228 GGAAAGGCAGGCTCTCTCCTGGG + Intergenic
1097357569 12:58619238-58619260 GGAGATCCAGGCTCAAACCCAGG + Intronic
1097462180 12:59875163-59875185 GGACATTCATGTTTTCACCTGGG + Intergenic
1098299181 12:69036695-69036717 GGAGGCCCAGGCTGTCACCTCGG - Intergenic
1101451175 12:104780482-104780504 GGGCATTATGGCTCTCACCTGGG + Intergenic
1101606685 12:106252150-106252172 GGGCATCCAGGCTCATGCCTTGG - Intronic
1101953268 12:109192685-109192707 TGTCATCCAGGCTATCACCCAGG + Intronic
1102395877 12:112585391-112585413 GGCCATCCAGGTTTTCAACTGGG - Intronic
1102534634 12:113571609-113571631 GGACATGCAGGTTGTCACATAGG + Intergenic
1103583673 12:121935447-121935469 AGACATCCAGGATCCCACCCAGG + Intronic
1104598278 12:130134566-130134588 GGACCTGGTGGCTCTCACCTGGG - Intergenic
1105840891 13:24252829-24252851 TGGCATCCAGGCTCACTCCTGGG + Intronic
1106765038 13:32905159-32905181 CTACATCCAGCCTCTCAACTAGG + Intergenic
1110220075 13:73062512-73062534 GGACTTCCAGGCTCTGAGCTTGG - Exonic
1113651050 13:112034504-112034526 GGAATCCCAGGCTCTTACCTAGG + Intergenic
1115649167 14:35390773-35390795 GGCCTTCCAGGCTTGCACCTGGG + Intergenic
1118495588 14:66305300-66305322 AAACATCCAGGCTCTCATCCTGG + Intergenic
1122377776 14:101277737-101277759 GGAAATCCAGGCTCTCCACGTGG - Intergenic
1126400640 15:48266089-48266111 GGACATACAGGCTATCATATTGG + Intronic
1126407182 15:48332733-48332755 TCACATCTAGGCTCTCACCTTGG - Intronic
1129185850 15:73906000-73906022 GGAAACCCAGGCTCTCAGCAAGG + Intergenic
1129686592 15:77689523-77689545 GGCCATCCAGGCCCTCCCATGGG + Intronic
1131341800 15:91609356-91609378 GGAGATCCAGGTACTCAGCTTGG - Intergenic
1133889735 16:9867813-9867835 GAACATCCAGGCTCAGGCCTCGG + Intronic
1134258426 16:12630671-12630693 GGAGATCCAGGCTCTGCCCTGGG - Intergenic
1134258495 16:12630993-12631015 GGAGATCCAGGCTCTGTCCTGGG - Intergenic
1134534667 16:15016274-15016296 GGACATCCAGGCTCTCACTTTGG + Intronic
1136222165 16:28835754-28835776 GGACAGCTGGGCTCTTACCTGGG - Exonic
1136367063 16:29813754-29813776 GGGCATCCAGGATCTCCCCGAGG + Exonic
1138190117 16:55007782-55007804 GGTCATCCAGGCCCTCACGCAGG + Intergenic
1139861379 16:70024503-70024525 GGACATCCAGGCTCTCACTTTGG - Intergenic
1140743378 16:77961234-77961256 GGAGTTCCAGGCTGTCACCAAGG + Intronic
1141023924 16:80525631-80525653 AGCCATCCTGGCTCACACCTAGG + Intergenic
1142213679 16:88820796-88820818 CGCCATCCAGGCTTTAACCTCGG + Intronic
1143500051 17:7333602-7333624 GGAAAGCCAAGCTCTCACCATGG + Intergenic
1144765473 17:17730261-17730283 GGCCTTCCATGCTCTGACCTCGG - Intronic
1148649791 17:49241876-49241898 GGACACCCAGGTTATCACTTGGG - Intergenic
1150128733 17:62654793-62654815 AGACATCCAGGTCATCACCTGGG - Intronic
1150235404 17:63589004-63589026 TGACCACCAGGCTCTCATCTGGG + Exonic
1151986645 17:77548154-77548176 TAACCTCCAGGCACTCACCTGGG - Intergenic
1152309358 17:79540238-79540260 TGACATCCTGGCTCTCAGATCGG - Intergenic
1152754209 17:82080352-82080374 GACCAGCCTGGCTCTCACCTGGG + Exonic
1152986105 18:322778-322800 GGCCATACAGGCTGTCTCCTCGG - Intronic
1153952180 18:10067119-10067141 GGACATCCAGGCTCTGAAGGGGG - Intergenic
1159704696 18:71673457-71673479 GGACAGTAAGGCTCTCACTTAGG - Intergenic
1160373942 18:78396685-78396707 TGCCCTCCAGCCTCTCACCTTGG - Intergenic
1161203390 19:3028437-3028459 GGAGATCCAGCCTCTCACTTTGG - Intronic
1161926624 19:7305498-7305520 GGACATCCAGGGTCTGAGATTGG - Intergenic
1162526148 19:11207902-11207924 GGACCTCCATTCTGTCACCTAGG - Intronic
1165477544 19:36039926-36039948 GGACCTCCCAGCGCTCACCTTGG + Exonic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1166626053 19:44356856-44356878 TATCATCCAGGCTCTCAGCTTGG - Intronic
927841028 2:26444285-26444307 GGAGAACCAGTCTCTAACCTCGG + Exonic
928134496 2:28678099-28678121 GGACAGCAAGGTTCTCAACTGGG + Intergenic
929390957 2:41467743-41467765 GGACATCCAGACTATGACCCAGG - Intergenic
929856144 2:45640016-45640038 GGAGAACCAGGCTCTCCTCTTGG + Intergenic
931926570 2:67079745-67079767 GGACTGCCTGGCTCTCACATGGG + Intergenic
932171985 2:69565714-69565736 GTACACCCAAGCTCTCACCATGG - Intronic
932718353 2:74120118-74120140 GGACCTCCAGGTTCTTCCCTGGG + Intergenic
933528597 2:83476508-83476530 GGACATCCAGGCACTCCATTAGG + Intergenic
933987614 2:87604775-87604797 GGAAACCCAGGCTGTAACCTGGG + Intergenic
934119420 2:88825532-88825554 GGACATCCAGGTTCCCGCCGTGG - Intergenic
936162888 2:110098055-110098077 GGACATCCAGGTTCCCGCCGTGG - Intronic
936306226 2:111346033-111346055 GGAAACCCAGGCTGTAACCTGGG - Intergenic
937084448 2:119161440-119161462 TGAGACCCAGGCTTTCACCTTGG + Intergenic
942750963 2:179286964-179286986 GGCCATCCAGTTTCTCTCCTAGG + Intergenic
945343960 2:208690478-208690500 AGATATCCAGGTTCTCACATTGG - Intronic
945869776 2:215214459-215214481 GGAGTTTCAGGCTCTCAACTGGG + Intergenic
946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG + Exonic
946528056 2:220541377-220541399 AGACATCCAGCCTTTCACCAGGG - Intergenic
947869204 2:233423590-233423612 AGACATCCCGGCTCTCAGCTTGG + Intronic
948019742 2:234720698-234720720 TAACATCCAGGCACTCACATGGG + Intergenic
948365809 2:237453785-237453807 GGCCAACCAGGCTCTCCCTTGGG - Intergenic
1171351452 20:24506205-24506227 GGACAGACAGACTCTTACCTGGG - Intronic
1171954278 20:31448104-31448126 GGAGAGACAGGGTCTCACCTAGG + Intronic
1172727394 20:37056145-37056167 GAACAGCCAGGATCTCACATAGG - Exonic
1180937667 22:19636862-19636884 GCACATCCAGGCTCTACCCCGGG + Intergenic
1181498662 22:23302758-23302780 GGAGGTCCAGGCTCCCAGCTGGG - Intronic
1183431957 22:37771372-37771394 GCAGCACCAGGCTCTCACCTCGG - Intronic
1183508316 22:38221287-38221309 GGACAGCCAGGCTCGCCCATGGG - Exonic
1184783430 22:46660233-46660255 GAACATCCAGGCTGTGACCCAGG + Intronic
949563181 3:5221371-5221393 TGACATCCAGGATCAGACCTAGG + Intergenic
950234527 3:11307258-11307280 GGACATCCAGGCTCTCACCTGGG + Intronic
950271988 3:11624101-11624123 GGTCATCCAGGAACTCACTTTGG - Intronic
953547652 3:43875431-43875453 GGCCACCCAGGCTTTCTCCTTGG + Intergenic
956694908 3:71910101-71910123 CGACATTCAGGCTCTGACCTAGG + Intergenic
957690274 3:83557004-83557026 GGGTATCCAGGTTCTCACATTGG - Intergenic
958929127 3:100190516-100190538 GGACAGCCAGACTCTCTCCTTGG - Intronic
962447432 3:135479616-135479638 GGACACCCAGGCTCCCACAATGG + Intergenic
964469798 3:157040665-157040687 GGACAGCCACCCACTCACCTTGG + Intronic
968003228 3:195221947-195221969 GGACATGCTGGCTCTGACTTTGG - Intronic
968657934 4:1786673-1786695 CGCCAGCCAGGCCCTCACCTTGG + Intergenic
970011379 4:11463385-11463407 AGACATCCCGGGTCTCACCATGG - Intergenic
971914479 4:32850646-32850668 GTACTTCCAGGCTCCCACCAGGG + Intergenic
973229375 4:47824408-47824430 GGACCTGCAAGATCTCACCTGGG - Intronic
974385425 4:61198858-61198880 GGACATCCATGAACTCCCCTGGG - Intergenic
979318506 4:119296608-119296630 GGACATCCATGTTCTATCCTTGG - Intergenic
979368935 4:119859928-119859950 GGAGATCCAGTCTTCCACCTGGG - Intergenic
982203864 4:152982497-152982519 GAACATCCCAGCTCTCACCAAGG - Intergenic
990948672 5:61275464-61275486 GGACTACCAGGGTCTCAGCTTGG + Intergenic
994585946 5:101709664-101709686 GAACATCCAGGTTCTCACATTGG - Intergenic
999729068 5:154462143-154462165 GGAAGTCCTGGCTCTCACCAAGG + Intergenic
1006185551 6:32179759-32179781 ACACCTCCAGTCTCTCACCTGGG - Exonic
1006443992 6:34068752-34068774 GGTCCCCCAGGCTGTCACCTTGG + Intronic
1009950699 6:70392238-70392260 GGTCATCCAGGCTCAGCCCTGGG + Intergenic
1013615036 6:111834906-111834928 AGACACCCAGACTCTCAACTTGG + Intronic
1014098510 6:117484262-117484284 GGTCATCCAGGCTGTTAACTGGG + Intronic
1017848840 6:158284839-158284861 GGAAACCGAGGCTCACACCTCGG - Intronic
1018169241 6:161131338-161131360 GGACATCCAGGTTCCCACCCAGG - Exonic
1018268939 6:162055487-162055509 GGAGGTCCAGGCTGCCACCTGGG - Intronic
1019156725 6:170044231-170044253 GGAGATCCAGGCTCTCTCACAGG - Intergenic
1020026638 7:4904357-4904379 GGACATCCAGGGTCTGGGCTTGG + Intergenic
1020118063 7:5487452-5487474 GGACCTCCAGGCTCTGTGCTGGG - Intronic
1021554888 7:21909254-21909276 TCACATCCAAGCTGTCACCTAGG - Intronic
1022217935 7:28282865-28282887 GGACAACCAGGCCCTCTTCTGGG + Intergenic
1023870803 7:44262142-44262164 GGGCATCCACACACTCACCTGGG - Intronic
1024557270 7:50614418-50614440 GGACCCCCAGCCTGTCACCTGGG - Intronic
1026658174 7:72275580-72275602 GGTAATCCAGGCTCTCAGCCTGG - Intronic
1027050092 7:75016413-75016435 GGACTTCCAGGCTCTCAGGAGGG + Intronic
1029382943 7:100225255-100225277 GGACTTCCAGGCTCTCAGGAGGG - Intronic
1029626493 7:101723170-101723192 GGACATCGGGGCTCCCATCTAGG - Intergenic
1031580553 7:123469240-123469262 GCACATCCAGCCTCTCATCTTGG + Exonic
1037758647 8:21727544-21727566 GGTCATCCAGCCTGTCTCCTGGG - Intronic
1038391028 8:27201162-27201184 GGAGCTCCAGGCTTTCTCCTGGG - Intergenic
1038453871 8:27658739-27658761 GGCCTGCCAGCCTCTCACCTGGG - Exonic
1040944963 8:52874447-52874469 GGAAGTCCAGGCTCTCCTCTTGG + Intergenic
1042425157 8:68639300-68639322 GGACAACAAGGCTTTCACTTGGG + Intronic
1044018472 8:87074772-87074794 AAATATCCAGGTTCTCACCTTGG - Intronic
1048750637 8:137669945-137669967 GGAAATCCAGGCTCTGAACATGG - Intergenic
1051250475 9:15153735-15153757 GGGCTTCCAAGCTGTCACCTGGG - Intergenic
1051796345 9:20875578-20875600 AGACACCTAGGCTGTCACCTAGG - Intronic
1056695965 9:88853053-88853075 GGACATAAAGGCTCCCACCCAGG - Intergenic
1057318153 9:93985061-93985083 AAACATCCAGGCTCTCAGGTAGG + Intergenic
1059905940 9:118986224-118986246 GAAGATCCAGCCTCTAACCTTGG - Intergenic
1060723580 9:125993708-125993730 GGAAGTCCTGGCTCTCACTTGGG - Intergenic
1061404156 9:130384488-130384510 GGACAGCCAGGCCCTCTCCCTGG + Intronic
1061726231 9:132583341-132583363 GGACATGCACTCGCTCACCTGGG + Intronic
1061995476 9:134180806-134180828 GGAGCTCCAGGCTCTGACCTGGG - Intergenic
1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG + Intergenic
1062500008 9:136848244-136848266 TGCCCTCCAGGCTCCCACCTGGG - Exonic
1185577521 X:1185698-1185720 GAACACCCAGGTTTTCACCTAGG + Intergenic
1186847762 X:13547864-13547886 TGACATCCAGGATATCACCCTGG + Intergenic
1191099759 X:56712563-56712585 AAATATCCAGGCTCTCACATTGG - Intergenic
1193712617 X:84896438-84896460 GAACATCCAGGTACTCACATTGG - Intergenic
1200154312 X:153967255-153967277 GGAAATGCTGGCTCTCAGCTGGG + Intronic