ID: 950238430

View in Genome Browser
Species Human (GRCh38)
Location 3:11344942-11344964
Sequence AAATATACAAAGATAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1045
Summary {0: 1, 1: 1, 2: 3, 3: 80, 4: 960}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950238430 Original CRISPR AAATATACAAAGATAGAACA AGG (reversed) Intronic
900695589 1:4007758-4007780 AAAGATACAGAGACAGAAAAAGG + Intergenic
900807419 1:4776548-4776570 AAAAATAAAAAGATAAAATAGGG + Intronic
900926772 1:5710851-5710873 AAAGATAGAAAGATAGAGAAAGG + Intergenic
900997924 1:6132605-6132627 ACAGAGACAAAGATAAAACAGGG - Intronic
901105095 1:6749128-6749150 AAAAATAAAAAGAGAGAAAAGGG - Intergenic
901354528 1:8633051-8633073 AAATATACAAACAAGGCACATGG + Intronic
901469763 1:9448292-9448314 AAACAAACAAAAAAAGAACAAGG + Intergenic
901497810 1:9631992-9632014 AAAAAAAGAAAGATAGAAGAAGG - Intergenic
902853390 1:19180177-19180199 AAATAAATAAATAAAGAACATGG - Intronic
903747732 1:25599682-25599704 AAAAAAAGAAAGATAGAAAAAGG + Intergenic
904125960 1:28238772-28238794 CAATCTACAAAATTAGAACAAGG - Intronic
905165598 1:36081128-36081150 TAATACAAAATGATAGAACATGG + Intergenic
905287938 1:36896591-36896613 AAAAATAGAAACAAAGAACAAGG + Intronic
906530201 1:46519599-46519621 AAAAAAAGAAAGAGAGAACATGG - Intergenic
906823494 1:48953947-48953969 AAACATAAAAAGACAGACCAAGG + Intronic
907179597 1:52557938-52557960 AAATGTAAAAAGAAAGAAAAGGG + Intergenic
907729912 1:57056094-57056116 AAATTCACAAAGCTAGAAAATGG + Intronic
908657136 1:66400467-66400489 AAATGCACAAAGATAGAGAATGG + Intergenic
908771443 1:67600582-67600604 AAAAAAAAAAAGATAGAAAAAGG - Intergenic
908855727 1:68425500-68425522 AAATATATAAATATATAAAAAGG - Intergenic
910019060 1:82563431-82563453 AAATAAAAAAAAATAGAAAATGG - Intergenic
910224096 1:84918652-84918674 AAAAAAACAAAGATAATACAAGG - Intergenic
910659006 1:89650736-89650758 AAATCTTCAAACTTAGAACATGG + Intronic
910752303 1:90645926-90645948 AAATACAAAAAGATAGAAAGAGG - Intergenic
910835721 1:91507253-91507275 AAATGTACATAGTTAAAACAAGG - Intronic
911308154 1:96257491-96257513 ATATATACAAAAATATAACTAGG - Intergenic
912056422 1:105604767-105604789 ACATACACAAACATAGTACATGG - Intergenic
912855121 1:113161176-113161198 AAATAAACAAAGCTAGAAGCTGG - Intergenic
913072099 1:115308688-115308710 AAAAATAAAAAGAGAGAAAAAGG + Intronic
913347185 1:117820459-117820481 AACTATCCAAGGATATAACAAGG - Intergenic
913408796 1:118527267-118527289 AATTATAGAAAAATAGCACATGG + Intergenic
913691860 1:121287222-121287244 CAATAAACAAAAATAGAAAATGG - Intronic
914145687 1:144992732-144992754 CAATAAACAAAAATAGAAAATGG + Intronic
914261983 1:146006706-146006728 AAGAATACAAAGATAAAAAAGGG - Intergenic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
916331009 1:163617145-163617167 ATAAATACAAAGCAAGAACATGG + Intergenic
917040975 1:170806015-170806037 AAATCAAAAAAGATGGAACAAGG + Intergenic
917776619 1:178343502-178343524 TAATATACATAGATATATCATGG - Intronic
917800682 1:178566855-178566877 AAATAGACACACATAGAACAAGG - Intergenic
917867929 1:179215408-179215430 AAATATACAAAGGTATCTCAAGG - Intronic
917911923 1:179657133-179657155 AAATTTACAAGGAAAGAAAAAGG - Intronic
918166313 1:181951803-181951825 AAATATACATAGACAGAAAGAGG + Intergenic
918259343 1:182781540-182781562 AAACACAAAAGGATAGAACATGG - Intergenic
918273672 1:182929018-182929040 AAGTATACTAACATAAAACAAGG + Intronic
918519709 1:185402824-185402846 AAAAATTAAAAAATAGAACAAGG + Intergenic
918553395 1:185770461-185770483 AAAAATACAAAGATGGCATATGG + Intronic
918556288 1:185803255-185803277 AAATATAGTAAGATAAAAAAGGG + Intronic
918907678 1:190519555-190519577 ACATATATAAACATAGAAAAAGG - Intergenic
919263013 1:195222148-195222170 AAATAAATAAAAATAGAATATGG + Intergenic
920479193 1:206305730-206305752 CAATAAACAAAAATAGAAAATGG - Intronic
920622948 1:207566377-207566399 TAATACACAAATATTGAACATGG + Intronic
921634307 1:217474889-217474911 AAAAATACTAAGAAAGAAAATGG + Intronic
921693519 1:218180784-218180806 AATTCAACAAAGACAGAACAGGG + Intergenic
921777843 1:219123495-219123517 AACTATACAAATGTAGAAGATGG + Intergenic
921786943 1:219242605-219242627 CAATACACAATGATGGAACAGGG - Intergenic
921860461 1:220037521-220037543 AAAAATAGAAAGATGGAAAATGG + Intronic
921954833 1:220971189-220971211 AAATATAAAAAGATAGTATGAGG + Intergenic
922037327 1:221861969-221861991 AAACATACAAGGATAGAGGAAGG + Intergenic
922486322 1:225975922-225975944 AAATAAATAAAAAAAGAACAGGG + Intergenic
923235377 1:232028102-232028124 AAGCATACAAACATAGAATAAGG + Intronic
923293466 1:232569822-232569844 AAATAAACAAAGATAAATTACGG + Intergenic
923601188 1:235404423-235404445 AAAAAAAAAAAGATAGAAAATGG + Intronic
923796658 1:237163489-237163511 AAATAAACAAAAATAAAACCAGG - Intronic
924315744 1:242794382-242794404 AAACATATAAAGATACAAAATGG - Intergenic
924501981 1:244646271-244646293 GATTAAACAAAGATACAACAGGG - Intergenic
1063245573 10:4214402-4214424 AAAGAAACAAAGAGAGAAAAAGG - Intergenic
1063892006 10:10640202-10640224 ACAGATGCAAAGATAGGACAGGG - Intergenic
1064653081 10:17529106-17529128 AAATAAAAAAAGACAAAACATGG + Intergenic
1064939602 10:20718738-20718760 AAAAAGACCAAAATAGAACATGG + Intergenic
1065303593 10:24347654-24347676 AAATATACTAGGATAAAAAAGGG + Intronic
1065371850 10:24994859-24994881 AAATATACAAAAAAATAACCAGG + Intronic
1065551899 10:26876449-26876471 AAAGAAAGAAAGATAGAAAAAGG - Intergenic
1065621005 10:27581051-27581073 AAATATTTAAAGATACAACGAGG + Intergenic
1066341913 10:34542786-34542808 AATTTTAAAAAGATGGAACAAGG + Intronic
1066676159 10:37889663-37889685 ATGTATACAAAGATATATCACGG - Intergenic
1067858206 10:49816243-49816265 ACATATACAAAAATAAAATAGGG - Intergenic
1068070897 10:52193713-52193735 ACATATACAAAGAAAGCAAAAGG + Intronic
1068159349 10:53243707-53243729 AAAAATACAAACATAAAGCAAGG + Intergenic
1068424820 10:56846458-56846480 AAATGGACTAAGATAGACCATGG + Intergenic
1068586030 10:58799694-58799716 AAAAATAGAAATATAGACCAAGG - Intronic
1069966372 10:72120947-72120969 AAAAATAGAAACAAAGAACAAGG + Intronic
1070092148 10:73298015-73298037 ACAGATATAAAGAAAGAACATGG - Intronic
1070492558 10:76991446-76991468 AAATGTAGTAAGAAAGAACAAGG - Intronic
1071651469 10:87396852-87396874 AAATATACAAAAATTAACCAGGG - Intergenic
1072177559 10:92943544-92943566 AATAATACAAAAATAAAACAGGG - Intronic
1072197057 10:93125303-93125325 AAATACATTAAGAAAGAACAGGG - Intergenic
1072509017 10:96099608-96099630 TAATATACATAGAAAGAACACGG - Intergenic
1073362245 10:102909259-102909281 AAATAAAATAAGAAAGAACAAGG - Intergenic
1073478432 10:103769945-103769967 AAATCTACAAAAACAGAATATGG - Intronic
1073674421 10:105629445-105629467 AAATAGACATACATAGAATAGGG + Intergenic
1074552613 10:114458912-114458934 AGATATACTAAGATAGAATGAGG + Intronic
1076476205 10:130753869-130753891 AGATATAGAAAGATAGATGAAGG - Intergenic
1077772190 11:5232221-5232243 AAATATAAAAATATAAAAAATGG + Intergenic
1077781558 11:5335539-5335561 AAATATGAAAAGAATGAACAAGG - Intronic
1077796594 11:5498879-5498901 AAATTTATAAAGATAGGATAAGG - Intronic
1078591549 11:12645072-12645094 AAAAATAGGAACATAGAACAAGG + Intergenic
1078734112 11:14003961-14003983 AAATATGCAGAGATAGATAAGGG - Intronic
1078744976 11:14103890-14103912 AAGTATACAATTTTAGAACAAGG - Intronic
1079765200 11:24383595-24383617 AAAAATACAAAAATTTAACAGGG - Intergenic
1080079716 11:28201825-28201847 AATTTGACAAAGATGGAACAAGG + Intronic
1080425821 11:32153355-32153377 AAAAATACAAAGAGAGATAAGGG + Intergenic
1080452320 11:32388670-32388692 AAATATTCCATGATAGAAAATGG + Exonic
1080822767 11:35823252-35823274 AAAGAGCCAAACATAGAACAGGG - Intergenic
1080925158 11:36748546-36748568 CAAAATGCAAAGAGAGAACAAGG - Intergenic
1081038813 11:38184237-38184259 TAAGAAACAAAGACAGAACAGGG - Intergenic
1081138319 11:39467765-39467787 ATATATACATATATAGAATAAGG - Intergenic
1081169833 11:39852999-39853021 AAATCTACAATGATATAAAAAGG - Intergenic
1081371987 11:42315567-42315589 AAAACTGCAAAGATAGAAAATGG + Intergenic
1082064835 11:47891625-47891647 AAATTTACAAAGGTAGAAACTGG - Intergenic
1082735221 11:56847563-56847585 GAATACACAAAGATTGATCATGG + Intergenic
1082899694 11:58233589-58233611 AAATATACAATTAAAGAAAATGG + Intergenic
1082915955 11:58437653-58437675 AAATTTAAAAGGATAGAATAAGG + Intergenic
1083016861 11:59462997-59463019 AAATAAACAAAGAAATAACATGG + Intergenic
1083480725 11:62944306-62944328 AAATCTATAGAGATAGAAAATGG + Intronic
1083974174 11:66103826-66103848 AAATATACAAAAATAGAGAAAGG + Intronic
1085160608 11:74340472-74340494 AAATATGCAAAAATGGAATATGG + Intronic
1086001968 11:81994648-81994670 AAATGTACAAGCATAGTACAAGG - Intergenic
1086130594 11:83397689-83397711 AAAAATACAAAAATACAGCAGGG - Intergenic
1086166419 11:83784693-83784715 AGATCTACATTGATAGAACAGGG + Intronic
1086207215 11:84273999-84274021 AAATTTACATAGATAATACAAGG + Intronic
1086490101 11:87350405-87350427 ATATGTACACAGATAGGACAGGG - Intergenic
1086492590 11:87370415-87370437 AAAAATACAAGGTTAGACCACGG + Intergenic
1086526126 11:87728065-87728087 AAAGTTACAAAGATAAAAAATGG + Intergenic
1086544678 11:87953952-87953974 AAATCTACAAAATTTGAACATGG + Intergenic
1087134158 11:94697720-94697742 GAATATAGAAATATAGAATATGG + Intergenic
1087472342 11:98592037-98592059 AAATATAGAAACATAAAACATGG + Intergenic
1087522547 11:99259796-99259818 AAATAAACAAAATTATAACATGG - Intronic
1087646099 11:100810204-100810226 AAAAATATAAAGATAGTAAAGGG + Intronic
1087757575 11:102071514-102071536 AGATAAACAAAAATAGAAAAAGG - Intronic
1087866951 11:103241231-103241253 AACTATAGTAAGATAGTACAAGG - Intronic
1087994825 11:104792525-104792547 AAAAAAACAAGAATAGAACATGG - Intergenic
1088231188 11:107675224-107675246 AAATACATCAAGATGGAACAAGG + Intergenic
1088268860 11:108013274-108013296 AAATATACAAAGATAGAAAAGGG - Intronic
1088502347 11:110495078-110495100 AAAGATACACAGATATAAGAAGG - Intergenic
1088502435 11:110496104-110496126 ACATTTACAAAGATAGAGCTGGG + Intergenic
1089236389 11:117029955-117029977 GAATATACATAGAGAGAAGAGGG + Intronic
1090451039 11:126806657-126806679 AAATAAATAAATATACAACATGG - Intronic
1090549097 11:127799515-127799537 AAATATAGACAGATAGAAGATGG - Intergenic
1090552338 11:127836434-127836456 AAATATACAAATATGGAAGGTGG + Intergenic
1090810796 11:130240338-130240360 ACATTTAAAAATATAGAACACGG - Intronic
1091496709 12:979278-979300 AAACATACAAAGATTTAGCATGG + Intronic
1091936525 12:4439286-4439308 GGACATACAAAGTTAGAACAGGG - Intronic
1092612237 12:10184821-10184843 AAAAATACTAAGAAAGAACTTGG - Intronic
1092954871 12:13540741-13540763 AAATAAACAAAAAAAGAACTTGG + Exonic
1093547815 12:20368986-20369008 AGATATTCAAAGAGAGAAAAGGG + Intergenic
1093751605 12:22806461-22806483 AAAGATACAAAGAAGGAAAATGG + Intergenic
1093926345 12:24912212-24912234 AAATATAAAAAATTAGAAGAGGG + Intronic
1093992274 12:25603707-25603729 AAATATACACAAATAGCATAGGG + Intronic
1094088171 12:26617227-26617249 AAACATACAAAGAATGAAAAAGG + Intronic
1094231231 12:28105839-28105861 AAATTTACAAAGAGAGGAAAGGG - Intergenic
1094276493 12:28682217-28682239 AAAGCTACAAAAATAAAACAAGG - Intergenic
1094578767 12:31713443-31713465 AAATACAGAAATATAAAACAGGG + Intronic
1095287829 12:40436909-40436931 AAATATATAAGGATTGCACAAGG - Intronic
1095418860 12:42004425-42004447 AAATAAAAAAAGAAAGAAAAGGG + Intergenic
1095492237 12:42746764-42746786 AAATCAACAATAATAGAACAGGG - Intergenic
1096307571 12:50491629-50491651 AAAAAAAAAAAGATAGAAAAGGG - Intergenic
1096326289 12:50665134-50665156 ATATATAGAAATATAGAGCAGGG - Intronic
1096603078 12:52744234-52744256 AAAGAAACAAAGAGAGAAAAAGG + Intergenic
1096757359 12:53811139-53811161 AAAGATACAAAGATGGACAAAGG + Intergenic
1096778339 12:53977306-53977328 AATTATACAAAGACAGAAAGAGG - Exonic
1096826493 12:54282366-54282388 AAAAAAACATAGATACAACATGG - Intronic
1097100266 12:56583149-56583171 ATATATAAAAATATAGCACAAGG - Intronic
1097503622 12:60437803-60437825 AATGATACAAAGAGAGGACAAGG - Intergenic
1097618968 12:61917076-61917098 GAATATACAAGGATAGGAGAGGG + Intronic
1098114829 12:67164047-67164069 AAATATGGAATGATAGAGCAGGG + Intergenic
1098591066 12:72213534-72213556 AAATTAACAGAGCTAGAACAGGG + Intronic
1099164142 12:79281313-79281335 AGATATAGATAGATAGATCATGG + Intronic
1099392857 12:82102014-82102036 AAATTTCCAAAGAAATAACAAGG + Intergenic
1099670504 12:85685878-85685900 AAATTTGCAAAAATAGTACAGGG - Intergenic
1099728860 12:86471463-86471485 AAAAATACAAAAATATAAAAAGG + Intronic
1099793544 12:87365945-87365967 AAAAATACAAATAAAAAACATGG - Intergenic
1100233925 12:92638206-92638228 AAATATACAAAAATATAGCTAGG + Intergenic
1100403977 12:94257083-94257105 AATTAAGAAAAGATAGAACAGGG + Intronic
1100571027 12:95843044-95843066 AAAAATACAAAGGTTGAACTTGG - Intergenic
1100588733 12:96004316-96004338 AAATATACAAAGATAAAGCTAGG - Intronic
1100810480 12:98332544-98332566 AAATATACACAAAAAGCACATGG - Intergenic
1101129789 12:101676953-101676975 AAAAATATAAAGATAGTAGATGG + Intronic
1102132444 12:110542513-110542535 AAATACAAAAAGTTAGATCATGG + Intronic
1102739546 12:115194987-115195009 AAATAGAGGAAGAAAGAACAGGG - Intergenic
1102851071 12:116245738-116245760 AAATAAACAAAAATGGAAAATGG + Intronic
1103289893 12:119836551-119836573 AAATATCCAAAAAAAGAAAAAGG + Intronic
1103922886 12:124408364-124408386 AAATAAAAAAAGATATACCAAGG + Intronic
1104320311 12:127744467-127744489 AAATATACAAAAATAGGAAAAGG - Intergenic
1105268608 13:18847599-18847621 AAATGAACAAAGATAAAATATGG + Intergenic
1106246145 13:27952212-27952234 AAATATACAAAACTACAAAAGGG + Intergenic
1106316008 13:28594324-28594346 AATTAAACAAAAATAAAACAAGG + Intergenic
1107457384 13:40567297-40567319 AAATACAAAAATATAAAACACGG - Intronic
1107775466 13:43835457-43835479 TAATAAAAAAAGAAAGAACAAGG + Intronic
1108016366 13:46080636-46080658 AGATATACAGAGAGAGACCAGGG + Intronic
1108037903 13:46311367-46311389 AAATTTACAAAGATAGTACAGGG + Intergenic
1108069236 13:46610681-46610703 ACATATACAGAGATAGATAATGG - Intronic
1108346000 13:49547737-49547759 AAAGATAGAAAGAAAGAAGATGG + Intronic
1108349353 13:49576853-49576875 AACTGTATAAAGATAAAACAAGG + Intronic
1109076373 13:57841293-57841315 AAATATAAAAAGGTAGAACCTGG + Intergenic
1109191491 13:59329237-59329259 AAATCTAAAAAGAAAAAACAAGG + Intergenic
1109880204 13:68463303-68463325 AAAAATAGACACATAGAACAGGG + Intergenic
1109882736 13:68502315-68502337 AGATATACAAAGAAAGAGAAAGG + Intergenic
1110037427 13:70706059-70706081 AAATATACAGTTATACAACATGG - Intergenic
1110509980 13:76338062-76338084 AAACAGACAAAAATACAACAAGG + Intergenic
1110616001 13:77543047-77543069 AAATAAACAAATACAGAAAAGGG - Intronic
1110867702 13:80415894-80415916 AAAGAAAGAAAGATAGAATAGGG - Intergenic
1110954946 13:81542545-81542567 ACATATACAGAGTTAGAAAAAGG - Intergenic
1111216330 13:85147196-85147218 AAAAATACAAAAAAATAACAGGG - Intergenic
1111443293 13:88309806-88309828 AACTATACAACTATACAACAAGG + Intergenic
1111475763 13:88745177-88745199 AAATTTACAAAGCTAGTAAATGG + Intergenic
1111476245 13:88752041-88752063 AATTATACAAAGCAAGAATAAGG - Intergenic
1111624471 13:90766533-90766555 AAATATACACATACTGAACAAGG + Intergenic
1111999296 13:95195132-95195154 AAAATTACAAAGATAGTTCATGG - Intronic
1112130032 13:96513249-96513271 AAAAATACACAGAAAGATCAAGG - Intronic
1112326912 13:98447676-98447698 AAATACACAAATATATAAAAAGG + Intronic
1113012165 13:105780849-105780871 AAATAAATAAAGAAAGAAAAAGG + Intergenic
1113327760 13:109299122-109299144 AAATTTAAAAAGATAAAAAAGGG + Intergenic
1113364345 13:109662109-109662131 AAATATACAAAGGAAGAAAGTGG + Intergenic
1114461876 14:22891619-22891641 AAATTTCCAAAGGTAGAAAAAGG - Intergenic
1114693053 14:24602792-24602814 AAATATACAAAGAAACAATCTGG - Intergenic
1114784333 14:25577829-25577851 AAATATAAAGACATAGTACAGGG + Intergenic
1114893536 14:26956557-26956579 AAATAAAGAAAAATAAAACAGGG - Intergenic
1115324332 14:32121465-32121487 AAATATATAACAACAGAACAAGG - Intronic
1115337696 14:32258346-32258368 AAATTTACAAAGCTGGAAAATGG + Intergenic
1115482879 14:33879319-33879341 GAATAGACAAAGATAAAAAATGG + Intergenic
1116088236 14:40269236-40269258 AAAAGTACAAATATAGAAAATGG + Intergenic
1116116283 14:40655141-40655163 AAATTTACAAAGATATAATATGG - Intergenic
1116178540 14:41506189-41506211 TATTATATTAAGATAGAACATGG + Intergenic
1116501099 14:45622972-45622994 AAATATATATAGATAGAAAATGG + Intergenic
1116598923 14:46893309-46893331 AAATACACAGAAATAGAACATGG + Intronic
1116694930 14:48161641-48161663 ATAGATACAAATATAGAAAAAGG + Intergenic
1117125790 14:52624219-52624241 AAAAAAAAAAAGAAAGAACAAGG + Intronic
1117260222 14:54025034-54025056 AAATAAAAAAAGATAGTAAAAGG - Intergenic
1117330773 14:54709772-54709794 AAATATAGGCAGATAGAACCCGG + Intronic
1117639303 14:57780756-57780778 ACATATAAAAACATAGACCAAGG + Intronic
1118949454 14:70420728-70420750 AAATGTGCAAAAATAGAGCAAGG - Intergenic
1119172258 14:72544445-72544467 AAAGATAGATAGATAGAAAATGG + Intronic
1119552288 14:75523756-75523778 AAGTATATAAATATTGAACAGGG + Intronic
1119630970 14:76231898-76231920 AAATATATATATATAAAACAGGG + Intronic
1119783109 14:77291609-77291631 AAAGATACAAAGAAACAAAAAGG - Intronic
1120064669 14:80027146-80027168 AAATATGCACAAATAGACCAAGG + Intergenic
1120355140 14:83423451-83423473 AGATATAAAAAGAGAGAAAAAGG - Intergenic
1120572344 14:86136509-86136531 AAAGCTACCAAGATAGAACCAGG + Intergenic
1120581544 14:86256401-86256423 AAATTTACAAAGATAAAATTAGG - Intergenic
1121597386 14:95175425-95175447 AATTATACATAGATAAAACAAGG + Intergenic
1121722445 14:96119290-96119312 AAGAATAAAAAGGTAGAACAAGG + Intergenic
1123159873 14:106268027-106268049 AACTCTCCAAAGAAAGAACATGG + Intergenic
1123753444 15:23377258-23377280 AAATATTCAGAGAAACAACAAGG - Intergenic
1123942964 15:25225503-25225525 AAAGACACAAAGGGAGAACAGGG - Intergenic
1124067387 15:26357395-26357417 AAATATAGAAAGATTAAACTTGG + Intergenic
1124166029 15:27326557-27326579 AAATATACAAAGTGTGAAGAGGG - Intronic
1125090417 15:35784501-35784523 AAAGATAAAAAAATAGAAGATGG - Intergenic
1125359283 15:38848629-38848651 ATATATATATATATAGAACAGGG + Intergenic
1125991199 15:44110027-44110049 AAATACACAAAGTTACAAGAAGG - Intronic
1126016230 15:44353834-44353856 AAAAATAGAAAGAATGAACAAGG + Intronic
1126040724 15:44587846-44587868 AATTATTCAAAGATAGATTATGG + Intronic
1126357112 15:47808273-47808295 AAATATTCAAATATAGAGCCGGG - Intergenic
1127149989 15:56063730-56063752 AAAAATAGGAAGAAAGAACAGGG + Intergenic
1127162951 15:56209911-56209933 AAAAATAAAAACAAAGAACAAGG + Intronic
1127442863 15:59028180-59028202 AAATCTACATAGATAGAATGTGG - Intronic
1127512052 15:59652404-59652426 AAATATTCTAATATAGAACTAGG + Intronic
1127765679 15:62183842-62183864 CCATATCCAAAGACAGAACAAGG - Intergenic
1128247731 15:66144367-66144389 AAAGAGACGAAGAAAGAACAAGG - Intronic
1128467004 15:67921182-67921204 AAAAGGACAAAGATTGAACAAGG - Intergenic
1129947073 15:79548441-79548463 AAAAAAAAAAAGATAGAAAATGG + Intergenic
1130089242 15:80805629-80805651 ATATATACAAACATAAAACTAGG + Intronic
1130141868 15:81233697-81233719 TAATAGACAAATATAGAAGATGG - Intronic
1130342786 15:83013327-83013349 AAATAAACAAAAATAAAATAAGG - Intergenic
1130583602 15:85161000-85161022 AAATAAATAAAAATAGATCATGG + Intergenic
1131936346 15:97509803-97509825 AATTATCCAAAGAGAGGACATGG - Intergenic
1132800765 16:1751752-1751774 AAATCTACAGAGACAGAGCATGG - Intronic
1132899993 16:2248406-2248428 AAAAAAATAAAGATAGAAAATGG - Intronic
1132984579 16:2757996-2758018 AAAAAGACAAAAATAGAGCATGG - Intronic
1133644173 16:7747481-7747503 AAATATACACAGACATAAGATGG + Intergenic
1134206334 16:12241454-12241476 AAAAAAAAAAAGATAGACCAGGG - Intronic
1134571102 16:15291852-15291874 AAAAAAAAAAAAATAGAACAAGG + Intergenic
1134731278 16:16464224-16464246 AAAAAAAAAAAAATAGAACAAGG - Intergenic
1134936150 16:18247643-18247665 AAAAAAAAAAAAATAGAACAAGG + Intergenic
1135252404 16:20912092-20912114 AAAAATACAAAAATTGGACAGGG - Intronic
1135634312 16:24060942-24060964 AAAGATACAAACATTAAACAAGG - Intronic
1136501388 16:30671280-30671302 AAACACACAAATACAGAACACGG + Intergenic
1136660226 16:31751495-31751517 AAATTTCCAAAGATTGAATAGGG - Intronic
1136946147 16:34653553-34653575 AAATATACAGAGATATAAATAGG - Intergenic
1136948993 16:34692116-34692138 AAATATACAGAGATATAAATAGG - Intergenic
1136956483 16:34792628-34792650 AAATATACAGAGATATAAATAGG - Intergenic
1137088882 16:36163398-36163420 AAATATACAGAGATATAAATAGG - Intergenic
1137093411 16:36222645-36222667 AAATATACAGAGATATAAATAGG - Intergenic
1137258772 16:46803632-46803654 AAATAAACAAAAATAGAATCAGG - Intronic
1137454022 16:48604389-48604411 AAAAATACAAAAATACACCATGG + Intronic
1137631755 16:49951419-49951441 AAATGTACAGAGATAGTACAGGG - Intergenic
1138045848 16:53724026-53724048 ATATATGGAAAGATAGAACCAGG + Intronic
1138046773 16:53733029-53733051 AAATTTAAAAAGACAGAAAAGGG - Intronic
1138424006 16:56918346-56918368 GAAAGTACAAAGAAAGAACAGGG + Intergenic
1138691561 16:58773566-58773588 AAATATAAAGAGATAGATAATGG - Intergenic
1138716029 16:59023261-59023283 AAATATACATATATAAAAGAAGG + Intergenic
1138777600 16:59742880-59742902 AAACAAACAAAGAAAAAACAAGG + Intronic
1138864665 16:60801989-60802011 AAAGAAACAAAGAAAGAAAAGGG + Intergenic
1138953195 16:61939389-61939411 AAATAAACAAAGCTTGAAGATGG + Intronic
1139333496 16:66213098-66213120 AAATATTTAAAGAAAGAAAAAGG - Intergenic
1139612736 16:68070437-68070459 AAATGTACAGAGACAGAGCAGGG + Intronic
1139719366 16:68840405-68840427 AAACAAACAAACAAAGAACATGG - Intergenic
1139876414 16:70149624-70149646 AAATAAAGAAAAAAAGAACAAGG - Intronic
1140185639 16:72768103-72768125 AAATACACAAATATAGAAAAGGG + Intergenic
1140314688 16:73884253-73884275 TAATATACAAAAATAAAACAAGG - Intergenic
1140345625 16:74210269-74210291 AAATATATAAATAAAGAATAGGG + Intergenic
1140963392 16:79939962-79939984 AAAGATGCAAAGATAAAAAAAGG - Intergenic
1141008902 16:80378590-80378612 AAAAATAGAAAGAATGAACAAGG + Intergenic
1142727530 17:1827481-1827503 AAATGTACAAAGAGTGAAGATGG + Intronic
1143086387 17:4419169-4419191 TAATATACACAGATAAGACAGGG + Intergenic
1143252275 17:5532580-5532602 ACATATACAAAAATAGTACAAGG - Intronic
1143364495 17:6397018-6397040 AAACAGACATAGATAGAAAAAGG + Intronic
1143462172 17:7110770-7110792 AAACAGACAACTATAGAACATGG + Intronic
1143558634 17:7678266-7678288 AAAGAAAGAAAGAAAGAACATGG - Intronic
1144595883 17:16569651-16569673 AAAGAAAGAAAGAAAGAACATGG - Intergenic
1145026150 17:19469330-19469352 AAATATACAAAAAAAGTACCTGG - Intergenic
1146916853 17:36683440-36683462 AAATAAATAAAAATAGAAAAGGG - Intergenic
1147380023 17:40049179-40049201 AAAAATACAAAAAAAGAAAAAGG + Intronic
1147515877 17:41117273-41117295 ACAGAGACAAAGAGAGAACAGGG + Exonic
1147709427 17:42451775-42451797 AAAAATACAAAAATAGGCCAAGG + Intergenic
1147931723 17:43985658-43985680 ATATATCCAGAGATAGCACAAGG + Intronic
1148527132 17:48350184-48350206 AAATTTAAAAAGACAGAAAATGG + Intronic
1148977654 17:51543832-51543854 AAAGATGCAAATATAGAACTAGG - Intergenic
1149532719 17:57408326-57408348 AAATATACAAATAGAAAACTAGG + Intronic
1149727160 17:58908036-58908058 AAAAATAGAAACAAAGAACAAGG - Intronic
1150042186 17:61875711-61875733 AAATATACAAACAGAAAAAAAGG + Intronic
1150053867 17:61993177-61993199 AAAGAAAGAAAGAAAGAACATGG - Intronic
1150327880 17:64271304-64271326 AAACATAGAAACATAGAAGAAGG + Intergenic
1150617137 17:66781108-66781130 AAAAATATAAAAATAAAACACGG + Intronic
1150888544 17:69116546-69116568 ACATTTACAAAGATTGAACAAGG + Intronic
1151235302 17:72715692-72715714 AAATAAAAAAAGATGGTACATGG - Intronic
1151357498 17:73569175-73569197 AAAGAAAGAAAGAAAGAACATGG - Intronic
1152325869 17:79635901-79635923 AATAATACCAGGATAGAACAAGG + Intergenic
1153017283 18:595676-595698 AAATTTATAAAGATATAAAAAGG + Intergenic
1153362809 18:4216600-4216622 AATCCTACAAAGATAGTACAAGG - Intronic
1153823214 18:8850333-8850355 AATTATACCAAGATAGAATTTGG + Intergenic
1153876612 18:9378191-9378213 GAATATACAAAAACAAAACAAGG + Intronic
1153886434 18:9471858-9471880 AAATAGAAAAAGAAAAAACAGGG - Intergenic
1154193972 18:12252991-12253013 AGAGATACATAGAAAGAACAGGG - Intergenic
1154419416 18:14212402-14212424 AAATGAACAAAGATAAAATATGG - Intergenic
1155005087 18:21721798-21721820 AAAGTTGCAAAGATAGTACAGGG + Intronic
1155243932 18:23889591-23889613 AAATAAAGAAAGAAAGAAAAAGG + Intronic
1155653303 18:28166944-28166966 AGATATACAAATATAAAAAAAGG + Intronic
1155780752 18:29831649-29831671 AAATAAAAAAATATAAAACATGG - Intergenic
1155893856 18:31298859-31298881 AAAAATAAAAAAATAGGACAGGG + Intergenic
1155897043 18:31342819-31342841 AAATATTAAAGGAGAGAACAAGG - Intronic
1156035648 18:32764568-32764590 AAAAATATAAAAATAGAACATGG - Intronic
1156076960 18:33290472-33290494 AAATAAACAGAGATAGATCATGG + Intronic
1156171533 18:34492907-34492929 AAATATACAAGGCTTGAATATGG - Intergenic
1156282607 18:35655375-35655397 AAATATACAAATATAAAGGAGGG + Intronic
1156409508 18:36814393-36814415 AAATATATAAACATGGAAAAAGG + Intronic
1156602551 18:38626402-38626424 AAACAAAGAAAGATAGAAAATGG - Intergenic
1156605301 18:38659304-38659326 AAAAATAAAGAGATAGAATATGG - Intergenic
1156766307 18:40660717-40660739 AAGTTTACTAAGATAGAAAATGG + Intergenic
1156789532 18:40954268-40954290 CAAGATACAATGATGGAACAAGG - Intergenic
1156843800 18:41639420-41639442 AAATAAAGAAAGAAAGAAAAAGG + Intergenic
1156996051 18:43468187-43468209 AAATATAGAAGAATAGAATAGGG - Intergenic
1157005807 18:43582589-43582611 AAATGTACATAAACAGAACAAGG + Intergenic
1157010938 18:43647892-43647914 AAATATACAACCAAAGACCAAGG + Intergenic
1157151374 18:45222026-45222048 TAAGATACAAAGAGAGAAGATGG + Intronic
1157401165 18:47389734-47389756 CAATTTACAAACATAAAACAAGG - Intergenic
1157465345 18:47939423-47939445 AAATCTATAAAGATAGAAAGTGG + Intergenic
1158014821 18:52771882-52771904 AAAAAGAAAAAGAAAGAACAAGG + Intronic
1158135609 18:54204525-54204547 AAATATCCAAACATAGAATTAGG + Intronic
1158474724 18:57769894-57769916 AAATATACAAGGATCCAATAAGG + Intronic
1158502212 18:58012787-58012809 ATATATAATAAGATAGAAAAGGG + Intergenic
1158678651 18:59546615-59546637 GAAAATACAAAAATAGATCAAGG - Intronic
1158697661 18:59717141-59717163 AAATATTCAAAGATATATAATGG - Intergenic
1159169415 18:64745576-64745598 ATAAATAGAAAGATAGAACTAGG - Intergenic
1159733212 18:72058761-72058783 AAAAATACACAGATATAACAAGG + Intergenic
1159891686 18:73959023-73959045 AATTCTACCAAGATAGACCAGGG + Intergenic
1160087206 18:75787432-75787454 ATAAATACAGAGATAGAATAGGG + Intergenic
1160090688 18:75823946-75823968 AAAGAAACAAAGGAAGAACATGG - Intergenic
1161145233 19:2673824-2673846 AAATATACAAAAGCAGTACAAGG - Intronic
1163102362 19:15106009-15106031 AAATATATAAAACTAGACCAAGG - Intergenic
1163198644 19:15745637-15745659 AAATATACAATGAGAACACACGG - Intergenic
1163931335 19:20395439-20395461 AATTATACAGAAATAGAATATGG - Intergenic
1164826148 19:31286383-31286405 AAAAACACAAAGACAAAACACGG + Intronic
1164909869 19:32000129-32000151 AAATATTAAAAAATTGAACACGG + Intergenic
1165103221 19:33451954-33451976 AAATATACAAAAATAGGGGAGGG + Intronic
1166130537 19:40743225-40743247 AAAAAAAAAAAAATAGAACAGGG - Intronic
1167219116 19:48185988-48186010 AAAAATAAAAAGAAAGAAAATGG + Intronic
1167275539 19:48536678-48536700 AATTTTACAAAGATAAAACCTGG + Intergenic
1167926424 19:52824806-52824828 AGATATACAAAGAGATAACGTGG + Intronic
1168145525 19:54418429-54418451 AAAGAGACAAAGATAAGACAAGG - Intronic
925037328 2:698823-698845 AAATATTCAGAGATAGATCGGGG - Intergenic
925109280 2:1319821-1319843 ATATACAGAAAGTTAGAACATGG + Intronic
925453112 2:3988870-3988892 AAAAATAAAAAGATAGGAAATGG - Intergenic
925666361 2:6260875-6260897 AGATATAAAAATATAGATCAAGG + Intergenic
926026121 2:9546102-9546124 AAAAAAAAAAAGAAAGAACATGG + Intronic
926359470 2:12072260-12072282 AAAAGTACAAAAATATAACACGG + Intergenic
926770048 2:16363425-16363447 CAATATCCATAGCTAGAACATGG - Intergenic
926966296 2:18416153-18416175 AAAAATACAAATAAACAACATGG - Intergenic
927586942 2:24316627-24316649 AAATTCACAAAGATAGTACATGG + Intronic
927682794 2:25151249-25151271 AAATAAACAAAAAAAGAAGAGGG - Intronic
927766647 2:25815891-25815913 AAATTTACAGAGATAGGAAAGGG + Intronic
927769573 2:25847662-25847684 AAATAAACAAAAATACACCATGG + Intronic
927839564 2:26430947-26430969 AAAAAAAAAAAGATAGAAAAAGG - Intronic
927924477 2:27000921-27000943 AAATATTAAAAAATAAAACAAGG - Intronic
928345701 2:30493031-30493053 AATTTTACAAAGAAAAAACATGG - Intronic
928375944 2:30773508-30773530 AGATGAACAAAAATAGAACAGGG + Intronic
928746367 2:34420377-34420399 AAAGATACACAGTCAGAACAGGG - Intergenic
928749188 2:34451998-34452020 AAACCTACAAAGATTGAACCAGG - Intergenic
928831270 2:35487396-35487418 AAATATATAAGGATATAAAATGG - Intergenic
929107939 2:38382270-38382292 AAAAAAAAAAAAATAGAACATGG - Intergenic
929335510 2:40739491-40739513 AAATGTATCAAGATAGAAAATGG - Intergenic
930194026 2:48490632-48490654 AAATATTCAAAGTTAAAATATGG + Intronic
930331802 2:49994650-49994672 AAGGAAACAAAGACAGAACATGG + Intronic
930985065 2:57575658-57575680 CAACATACAATGATAAAACAGGG - Intergenic
932268722 2:70390405-70390427 AAATAAACAAAGGTATAACTAGG + Intergenic
932534401 2:72577344-72577366 AAATATACAAAAAGGGATCAAGG + Intronic
932636602 2:73394507-73394529 AAAAATACAAAAATAAACCAGGG - Intronic
932728097 2:74197357-74197379 AAACAAACAAACAAAGAACAGGG - Intergenic
932879638 2:75489219-75489241 AAACATACAATGATAGCAGAAGG + Intronic
933038295 2:77428482-77428504 AAATATAAAATTATGGAACAGGG - Intronic
933220698 2:79684298-79684320 AATTATACAAGAAAAGAACAGGG - Intronic
933593050 2:84254052-84254074 AAATATAAAAATATAGTATATGG - Intergenic
933971150 2:87470666-87470688 AAATTTACAAAGAGAGGAGATGG + Intergenic
934173823 2:89561996-89562018 AACTATAGAAAGAAAGAAAAGGG - Intergenic
934284137 2:91636345-91636367 AACTATAGAAAGAAAGAAAAGGG - Intergenic
935514186 2:104015268-104015290 AAACTTACAAAGAGAGAAAAAGG - Intergenic
935554720 2:104496762-104496784 AAATAGACACAGATAGAGAAGGG - Intergenic
935614520 2:105063070-105063092 AAATTTAGAAGTATAGAACATGG + Intronic
936227017 2:110664102-110664124 AAAAGGACAAAGATAGAAAATGG + Intronic
936322579 2:111479523-111479545 AAATTTACAAAGAGAGGAGATGG - Intergenic
936704803 2:115059178-115059200 AAAGATAAAAAGAAAGAAGAGGG + Intronic
936822896 2:116544549-116544571 AAAAATACAAAGATATTACTTGG + Intergenic
937269207 2:120637205-120637227 AGAAATACAAAGATAAAACATGG - Intergenic
937336414 2:121065066-121065088 ACAGTTACAGAGATAGAACAGGG - Intergenic
937416544 2:121719428-121719450 AAATAAACAAACAAAAAACAGGG - Intergenic
937502229 2:122491669-122491691 AAATCTAAAAAGAGAGAGCATGG - Intergenic
937889179 2:126923435-126923457 AAAAATACACAGAAAGAAAAGGG - Intergenic
938232359 2:129672212-129672234 CAATATCCAATGATGGAACAGGG - Intergenic
938276686 2:130032247-130032269 AAATATAAAAAAAGATAACATGG + Intergenic
938327646 2:130423016-130423038 AAATATAAAAAAAGATAACATGG + Intergenic
938362301 2:130698462-130698484 AAATATAAAAAAAGATAACATGG - Intergenic
938881097 2:135589901-135589923 TAATATACATAGATATAAAAAGG + Intronic
939027013 2:137026107-137026129 TAATATAGAATGATAGAACAGGG + Intronic
939083643 2:137690663-137690685 AACCATACAAAGATGGAATATGG - Intergenic
939128680 2:138207217-138207239 AAACATGCAAATATAAAACAAGG - Intergenic
939346511 2:140972250-140972272 AAATATAAAAGTATGGAACAAGG + Intronic
939371419 2:141306052-141306074 AACCAGACAAAGATACAACAAGG - Intronic
939879516 2:147614089-147614111 AAATATGCTGAAATAGAACAGGG - Intergenic
940016575 2:149112394-149112416 ATACATACAAAGATAGAATATGG + Intronic
940111380 2:150158382-150158404 GAATATACAAAGATATAAAGAGG + Intergenic
940518673 2:154714712-154714734 AAATATAAAAAGAAAAAACAGGG - Intronic
941229159 2:162887232-162887254 AAATATAGACAAATAGAACGTGG - Intergenic
941264427 2:163342348-163342370 AAATATACAATGCCAGATCAAGG + Intergenic
941267454 2:163380214-163380236 ACATATCAAAACATAGAACAGGG + Intergenic
941463461 2:165797999-165798021 AAATATAGCAAGTTAAAACAGGG + Intergenic
941897133 2:170640344-170640366 ATATATGAAAAGATAAAACATGG - Intronic
942134849 2:172914637-172914659 AAATATAGAAAGAAAGAAAGAGG + Intronic
942705549 2:178767694-178767716 AAATATAAAATGATAGATTATGG + Intronic
942738610 2:179146526-179146548 ACATATAAAAAAACAGAACAGGG + Intronic
943131461 2:183858308-183858330 AAAAATAAAAAAATAGAATAGGG + Intergenic
943154771 2:184160645-184160667 AAATCTACAAACATCGAACCAGG - Intergenic
943275513 2:185862752-185862774 AAATAGACAAAGAGGAAACAAGG + Intergenic
943684442 2:190803027-190803049 AAATAAATACAGATACAACATGG - Intergenic
943928201 2:193815913-193815935 AAATTTACAAAGAAAGCCCATGG - Intergenic
943935915 2:193917314-193917336 AAATAAAAAAAGAAAGAAAAGGG - Intergenic
944177178 2:196844474-196844496 AAATTTAAAATGAAAGAACATGG - Intronic
944403492 2:199355104-199355126 AAATATATAAATATATATCAGGG - Intronic
944818400 2:203403725-203403747 AAAAACAGAAAGAAAGAACATGG - Intronic
945369379 2:208997932-208997954 AAAGAAAGAAAGAGAGAACATGG + Intergenic
945408037 2:209473960-209473982 AAATAGACAAAGATTGCATAAGG - Intronic
945539755 2:211070177-211070199 AAATATACACAGATAGTCCTTGG - Intergenic
945547819 2:211179100-211179122 AAATAGTCAAAGATAGAACCAGG - Intergenic
945741287 2:213665669-213665691 AAATAAACACACATAAAACAAGG - Intronic
945883103 2:215347182-215347204 AAATATACAAACCTACACCAAGG - Intronic
946092114 2:217236556-217236578 AAATAAACACAGAAATAACAAGG - Intergenic
946988010 2:225295602-225295624 AAGTATAGAAAGATTTAACAAGG - Intergenic
947899651 2:233711003-233711025 AAAAATTCAGAGATAGAAAAAGG - Intronic
948088908 2:235274353-235274375 AAATTTACAAAGATAATACAGGG - Intergenic
948323726 2:237093831-237093853 AAAATTACAAAGATGGAAAAAGG - Intronic
1169292250 20:4362569-4362591 AAATCTACAAAGAAAAAAGATGG - Intergenic
1170099960 20:12687918-12687940 AAATATACAAAGGTCCATCATGG + Intergenic
1170399513 20:15965662-15965684 AAATATACAATGATTTAAAAAGG - Intronic
1170479733 20:16754042-16754064 AAGTATACACAGCTAGAAAACGG - Intronic
1170489214 20:16854739-16854761 AAAAAAACAAAGAAAGATCAGGG - Intergenic
1170599492 20:17830238-17830260 AAATATAGAAAGAAACAAAAAGG + Intergenic
1170868863 20:20186212-20186234 AAATTTACAATGATAGAAAGTGG - Intronic
1170992001 20:21311272-21311294 AAATTTATAAAGATAGAAAGTGG - Intronic
1171117680 20:22540281-22540303 AAAACTAGAAAGATAGAAAATGG + Intergenic
1171440305 20:25155453-25155475 AAACATACAAAGGTCCAACAAGG - Intergenic
1172510981 20:35500882-35500904 AAATCTACAGAGACAGAAAATGG - Intronic
1173143745 20:40507023-40507045 AAATATAGAAATATAGAAATGGG + Intergenic
1173171707 20:40730808-40730830 ACATATACAAAAATAGAGAAGGG - Intergenic
1173303883 20:41829446-41829468 AAATCTATAGAGATAGAAAATGG + Intergenic
1174967446 20:55233743-55233765 AAATATAAAAAGATACAGCCGGG - Intergenic
1175135910 20:56823856-56823878 AAAATTACAAAGATAGTACCGGG - Intergenic
1176912969 21:14590182-14590204 GAATATATAAAGATAGAAAAAGG - Intergenic
1177051173 21:16236059-16236081 AACTATACAAAAATATAACAAGG - Intergenic
1177320217 21:19511588-19511610 AACTATTAAAAAATAGAACAAGG + Intergenic
1177574301 21:22930888-22930910 ATATTTATAAAGATATAACATGG - Intergenic
1177694019 21:24548951-24548973 ATATATATAAAGTTAAAACATGG + Intergenic
1177956297 21:27603269-27603291 AAATAGACAAAAATATAAAATGG - Intergenic
1177957117 21:27612509-27612531 AAAAATAAGAAGATAAAACATGG + Intergenic
1178085725 21:29110384-29110406 AAAGATACAGAGATAAAAAACGG - Intronic
1178545581 21:33490765-33490787 AAATATAGATAGATAGAATCTGG + Intronic
1178972270 21:37190715-37190737 AAGTATAGAAACATAGAAAAGGG + Intronic
1180654081 22:17404357-17404379 AAAAAAAAAAAGAAAGAACAGGG - Intronic
1180747543 22:18101190-18101212 AAAGATTCAAATATAGAACTAGG + Exonic
1181758519 22:25041730-25041752 AAATAAACAAACAAAGAACCAGG - Intronic
1182036440 22:27202281-27202303 AAATCTTCCAAGGTAGAACAAGG - Intergenic
1182037863 22:27213653-27213675 AAATACAGAATGCTAGAACAAGG + Intergenic
1182104317 22:27678386-27678408 AAATAGCCAAAGTTTGAACATGG - Intergenic
1182597310 22:31431872-31431894 AAATCTACAAAGTTTGAAAAAGG - Intronic
1182673212 22:32015451-32015473 TGAGATACAAAGTTAGAACAGGG + Intergenic
1182886961 22:33782292-33782314 AAATCCACAGAGACAGAACATGG + Intronic
1183802460 22:40178588-40178610 AAAAATAAAAAGATAGAAAAAGG - Intronic
1183983058 22:41553698-41553720 AAATAAACAAAAATAAAACAGGG - Intergenic
1184050958 22:42004290-42004312 AAATTTAAAAAGAAGGAACAAGG + Intronic
1184486133 22:44780756-44780778 AAGTCTACAAAGATAAAACATGG - Intronic
1184496288 22:44843963-44843985 ATATATACATAGAGAGAAGAGGG + Intronic
1185008868 22:48301954-48301976 AATTCTACAAAGATAGAGGATGG - Intergenic
1185187370 22:49409646-49409668 AAATGTACATATATAGAACAAGG - Intergenic
1185396047 22:50589332-50589354 AAACATACAAAGAAAGATTAAGG + Intronic
949528799 3:4933348-4933370 AAATATAAGTAGATAGGACAGGG + Intergenic
950072333 3:10162935-10162957 AAATAAACAAAGAGGGTACAAGG - Intergenic
950238430 3:11344942-11344964 AAATATACAAAGATAGAACAAGG - Intronic
950335526 3:12189814-12189836 AAACAAACAAAAAGAGAACAGGG + Intronic
950879209 3:16308835-16308857 AAATATAGCAAAATAGGACATGG - Intronic
950985727 3:17363557-17363579 AAATAAAAAAAGAAAGAAAAAGG - Intronic
951322451 3:21262158-21262180 AAATCTATAAATATAGAACATGG - Intergenic
951660164 3:25054488-25054510 AGATATACAAAGTGAGATCATGG - Intergenic
953098134 3:39798940-39798962 AAATAAAAAAAGAAAGAAAATGG - Intergenic
953124096 3:40074976-40074998 AAAGATACTAAAATAGAAAAAGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953440364 3:42910815-42910837 TAATATGAAAAGACAGAACAAGG - Intronic
953542044 3:43829353-43829375 AAATAGTCAAAGATAATACAAGG + Intergenic
953689466 3:45105771-45105793 AATTATACAAAGAGAGAAACAGG + Intronic
954196442 3:48999813-48999835 AAATTTAAAAAGAAAGAAAAAGG - Intronic
954359157 3:50109499-50109521 ACATATACAATGACAGAAGAAGG + Intronic
954770539 3:52964000-52964022 AAACAAACAAAAATAAAACAGGG - Intronic
955149328 3:56351344-56351366 AAATATGAAAAGAAAGAAAAAGG - Intronic
955166971 3:56524618-56524640 CAATTTAAAAAAATAGAACATGG + Intergenic
955188803 3:56741063-56741085 AAATGTATATACATAGAACATGG - Intronic
955385226 3:58474116-58474138 CAACATACAGAGATAGAACAGGG + Intergenic
955451295 3:59069824-59069846 TAATATACAAAGGTGGAACAGGG + Intergenic
955790773 3:62586842-62586864 AAATATACAAAAATCAAAGATGG + Intronic
955942527 3:64159721-64159743 AAATAGAAAAAGATACAGCAAGG - Intronic
956053451 3:65274122-65274144 AAATAAAATAAAATAGAACAGGG + Intergenic
956305375 3:67818618-67818640 AATTAGACAAAGATATTACATGG + Intergenic
956819731 3:72943272-72943294 AAATTTACAAAGATAAAAATGGG + Intronic
957156883 3:76555263-76555285 AATTATCCAAAGTTAGAACTTGG + Intronic
957157318 3:76561583-76561605 CAAAAGGCAAAGATAGAACAAGG + Intronic
957278999 3:78125853-78125875 AAATATAAAAAAAGAGAAAAGGG - Intergenic
957323190 3:78658700-78658722 AAATATAAAAAGATAAATGATGG - Intronic
957371970 3:79306116-79306138 AAATATACAAAAATAATATAGGG + Intronic
957381469 3:79435220-79435242 AAATAAATAAAAATAAAACAAGG + Intronic
957561818 3:81832029-81832051 AAATATTCAAAGATACATCAAGG - Intergenic
957689059 3:83544078-83544100 AAATATATAAATAAAGAAAAGGG - Intergenic
957733862 3:84180652-84180674 CAATATACAAAGGCAGAGCAAGG - Intergenic
958112063 3:89161511-89161533 AAACATAAAAATAAAGAACAAGG - Intronic
958114462 3:89197574-89197596 AATTACAGAAATATAGAACATGG + Intronic
959301707 3:104610695-104610717 AAAATTTTAAAGATAGAACATGG + Intergenic
959395203 3:105828326-105828348 AAATATATAATGATAGGAAAGGG + Intronic
959446104 3:106441631-106441653 AAATATACTAATAAACAACATGG + Intergenic
959867514 3:111288153-111288175 AAAAAAAAAAAGACAGAACATGG - Intergenic
959924517 3:111906502-111906524 AGATGGACAAAGATAGAAGAGGG + Intronic
960311095 3:116117311-116117333 TAATATATAAAGAAAGAATAGGG - Intronic
960445488 3:117743981-117744003 GAAGATACAAAGAAAGAAAAGGG + Intergenic
960540140 3:118852617-118852639 AAAAATACAAATATAGTAGAAGG + Intergenic
960762327 3:121086451-121086473 AAATATTTAAATATAGAAAAGGG - Intronic
961612181 3:128148909-128148931 AAATAGAAAAAGAGAGATCATGG - Intronic
961900852 3:130210029-130210051 AAATAAACAAAAATAGAGCTGGG - Intergenic
962420218 3:135221476-135221498 AAACATTGAAAAATAGAACAAGG - Intronic
963232555 3:142923184-142923206 AAACATAGAAAGAAAGAACAAGG - Intergenic
963293731 3:143521578-143521600 AAATATAAAAGTATAGAAAAAGG - Intronic
963412226 3:144944211-144944233 AGATTTGCAAAGATAAAACACGG - Intergenic
963689216 3:148477701-148477723 AAATATTCCAATATAGAAGATGG + Intergenic
963740859 3:149079513-149079535 ACATATATAAAGATATAACTTGG + Intronic
964192067 3:154014767-154014789 AAATAGTAAAGGATAGAACAAGG + Intergenic
964597454 3:158451615-158451637 TAATAAACAAAGATAGAAAGGGG - Intronic
965108690 3:164392025-164392047 AAATATAAAAACATGGAAAAAGG + Intergenic
965368022 3:167823096-167823118 AAAAATACAAATCTAGAAGAGGG - Intronic
965551715 3:169972569-169972591 AAAAAAAAAAAGATAGAAAAAGG - Intronic
965791975 3:172398995-172399017 AAATATACAAAAACAGAAGCAGG - Exonic
965821834 3:172691974-172691996 AAAGAAAGAAAGAAAGAACAGGG + Intronic
965843353 3:172932912-172932934 AAATATACAAAAATTGATCTTGG - Intronic
965935697 3:174108012-174108034 AAATATAAAAATATGGTACAAGG - Intronic
966017422 3:175158940-175158962 ATATATTCAAAAATAGAAAATGG - Intronic
966026655 3:175292447-175292469 GAATATACCAAGATAAAAAATGG - Intronic
966042746 3:175511413-175511435 GGACATACAAAGAAAGAACAGGG + Intronic
966076285 3:175939282-175939304 AAATATATAAAGATACATCTGGG + Intergenic
966103228 3:176301729-176301751 AAATATATAATGACAGAAAAAGG - Intergenic
966260203 3:177968236-177968258 AAATAAACAAAGAAATAAAATGG + Intergenic
966518113 3:180842807-180842829 AACTATAAAATGATAGAAGAAGG - Intronic
966555547 3:181255937-181255959 AAATATACACATATAAAATAGGG - Intergenic
966797185 3:183726723-183726745 AAATATACGAAAATAGAAAATGG - Intronic
967094919 3:186169791-186169813 ATATAGTCAAAGAAAGAACAAGG + Intronic
967859141 3:194138411-194138433 ATATATACAAATATAGTGCATGG - Exonic
968454749 4:691598-691620 AAAAAAACAAAAATAAAACAAGG + Intergenic
969914590 4:10477605-10477627 AAATATAAAAATATAAAAAAAGG - Intergenic
969915897 4:10491441-10491463 TAGTATACATAGAAAGAACAGGG + Intronic
970215910 4:13760398-13760420 AAACATACAGAAATAGAACAAGG - Intergenic
970544825 4:17117052-17117074 AAGAAGACAAAAATAGAACAAGG + Intergenic
970737049 4:19184098-19184120 AATTATAGAAAGATACAGCATGG - Intergenic
970761443 4:19493789-19493811 AAATGTTAAAATATAGAACATGG - Intergenic
970885244 4:20980538-20980560 AATTAGACACAGATAGAAAAGGG - Intronic
970950998 4:21755143-21755165 AGAAATAGAAAGAAAGAACATGG + Intronic
970991942 4:22222881-22222903 ATATAGATAAAGATAAAACATGG + Intergenic
971430476 4:26560747-26560769 AAATATATTAAGATGAAACAGGG + Intergenic
971680682 4:29695841-29695863 AAAAAGAGAAAGATATAACATGG - Intergenic
971872521 4:32262278-32262300 AAATATATAAAGAGATAAAATGG + Intergenic
972159073 4:36200234-36200256 AAATAAACAAAAATAAAAAAAGG - Intronic
972228992 4:37048661-37048683 AAATATACAAAGGCAGAAAGTGG - Intergenic
972277892 4:37574690-37574712 AAAGTTACAAAGAAAGAATAAGG - Intronic
972755171 4:42039245-42039267 AAATATACAGAGAATGAGCATGG - Intronic
972841587 4:42936468-42936490 AAAATTGCAAAGATAGTACAAGG + Intronic
972988010 4:44789211-44789233 AAAAATAGAAAGAATGAACAAGG - Intergenic
973317160 4:48774095-48774117 AAATATAGAAACAAAGAATATGG + Intronic
974578617 4:63764418-63764440 AAACAAACTAGGATAGAACATGG - Intergenic
975261604 4:72307994-72308016 TAATATACAATGAATGAACATGG + Intronic
975270086 4:72421146-72421168 AAATAGACAAGGCTAGGACATGG - Intronic
975299262 4:72770575-72770597 AAATATACAGAGAGAGATCTTGG - Intergenic
975710209 4:77153923-77153945 AAAAATACATAAATAAAACAAGG - Intergenic
975950417 4:79763555-79763577 AAATATAGAAAGGAAGAAAAAGG + Intergenic
976000486 4:80368700-80368722 TGATATACAAAAATAAAACAAGG - Intronic
976171237 4:82306990-82307012 AAATATAAGAAGATACAATAAGG - Intergenic
976193842 4:82514332-82514354 CAATATACCACGGTAGAACAGGG - Intronic
976246071 4:83007313-83007335 AAATATACAAAAATAAAAAAGGG + Intronic
976638809 4:87315452-87315474 AAGTATAAAAATATATAACATGG + Intronic
976821318 4:89210229-89210251 AAAGATACTAATAAAGAACATGG - Intergenic
976913054 4:90332393-90332415 AAAAATACAAAGTTAGCCCAGGG - Intronic
976992768 4:91388779-91388801 AAAAAAACAAAGTTAGAAGACGG - Intronic
976992818 4:91389512-91389534 AAAAAAACAAAGTTAGAAGACGG - Intronic
977077169 4:92469513-92469535 AAATATACAAATAGAAAACATGG - Intronic
977168998 4:93737018-93737040 AAGGATACAAAGATAGTACATGG - Intronic
977265916 4:94854083-94854105 AAATATATGAAGATAGCCCAGGG - Intronic
977907096 4:102489611-102489633 AGATATACATAGATAGATGATGG + Intergenic
978171351 4:105674106-105674128 AAATGCACAAATATAGAATAAGG + Intronic
978555441 4:109974433-109974455 AAATACACAATGACAGGACAAGG - Intronic
979041554 4:115803867-115803889 AAATATACAAGTTTAGACCAAGG - Intergenic
979105207 4:116676855-116676877 AAATATACAAACATAGCAAAAGG - Intergenic
979120938 4:116900105-116900127 ATATATACAGAGAGAGAGCAAGG - Intergenic
979219616 4:118207310-118207332 AAATTTATAAAGAAAGAATATGG + Intronic
979318505 4:119296602-119296624 CAATGTCCAAGGATAGAACATGG + Intergenic
979472466 4:121115950-121115972 AAATATACTATGATAGAAGGTGG + Intergenic
980465121 4:133166185-133166207 AAATTTAAACAGGTAGAACATGG + Intronic
981036781 4:140177872-140177894 AAAGATAGAAAGAAAGAAGAAGG - Intergenic
981302369 4:143202658-143202680 AATTTTACAATGAAAGAACATGG + Intronic
981510362 4:145550104-145550126 AAATATACAATTATAGATAATGG + Intronic
981723745 4:147826614-147826636 AAATATACAATGAAACTACATGG + Intronic
981819506 4:148869414-148869436 AAATATAGAAAAGTAGATCAGGG + Intergenic
981877515 4:149565431-149565453 AAATATGAAAAGACAGAACTGGG - Intergenic
981963766 4:150576534-150576556 AAATATACAATGATAGAGTAAGG - Intronic
982242923 4:153318682-153318704 GAATTTACAAAGACAGATCACGG - Intronic
982317027 4:154042403-154042425 AAAAAAAAAAAGATGGAACAGGG - Intergenic
982644626 4:158008140-158008162 ACCTATACAAATATAGAAAATGG - Intergenic
982697279 4:158616447-158616469 AAATAAATAAAAATAAAACAAGG + Intronic
983196120 4:164808331-164808353 AAATATATAGAGATAGAGCTGGG + Intergenic
983365603 4:166783525-166783547 AAATATAAAAATAAAGAAAATGG + Intronic
983488041 4:168354418-168354440 AAATATAAAAAGAAATAAAATGG - Intergenic
983709826 4:170700099-170700121 AAATATTCAAATTTAGAAAATGG - Intergenic
984056374 4:174934433-174934455 AAAAATACAAAGAAAGAAAATGG - Intronic
984314516 4:178109989-178110011 CAAACCACAAAGATAGAACAAGG + Intergenic
984651020 4:182270645-182270667 AAATAAAGAAAGAAAGAGCATGG + Intronic
984680236 4:182599040-182599062 ATAGAAACAAAGAGAGAACAGGG - Intronic
986054419 5:4121716-4121738 AAACAGACAAAGAAAAAACAAGG + Intergenic
986292248 5:6409670-6409692 GAATTTGCAAAGATAGCACAGGG - Intergenic
987430820 5:17830919-17830941 AAATATTCAATGATAAAAAAAGG + Intergenic
987467266 5:18286592-18286614 AAATATAGAAACGTAGAAAATGG + Intergenic
987548419 5:19345166-19345188 AAATTTACAAAGATAAAGCCTGG - Intergenic
987691488 5:21272597-21272619 ATATATACAAAAAAAGAAAATGG + Intergenic
988262783 5:28910356-28910378 AAAAATAGAAAGATAAAACTTGG - Intergenic
988411107 5:30886859-30886881 AAATATAAAAAGATATTTCAAGG - Intergenic
988719841 5:33866317-33866339 AAAAATACAAAAATAAAACTTGG + Intronic
989723268 5:44554442-44554464 AGCTATACAAAGATAAAACCAGG + Intergenic
989951230 5:50299812-50299834 AAATAAACATTGATAGATCAAGG - Intergenic
991031898 5:62090196-62090218 AAATGGAAAAAGATTGAACATGG - Intergenic
991096154 5:62741700-62741722 AAATATACCAGAATAGAAAAGGG - Intergenic
991135988 5:63182426-63182448 AAATATTCACATATAGAACTCGG - Intergenic
991315835 5:65305154-65305176 AAATAGAGAAAGATAAAACAAGG + Intronic
991748892 5:69777540-69777562 ATATATACAAAAAAAGAAAATGG - Intergenic
991765672 5:69976257-69976279 AAAAATAAAAAGAAAGAAAATGG - Intergenic
991781650 5:70141904-70141926 AAAAATAAAAAGAAAGAAAATGG + Intergenic
991800470 5:70357352-70357374 ATATATACAAAAAAAGAAAATGG - Intergenic
991828130 5:70652689-70652711 ATATATACAAAAAAAGAAAATGG + Intergenic
991844907 5:70851329-70851351 AAAAATAAAAAGAAAGAAAATGG - Intergenic
991874093 5:71142218-71142240 AAAAATAAAAAGAAAGAAAATGG + Intergenic
991892828 5:71356792-71356814 ATATATACAAAAAAAGAAAATGG - Intergenic
991978165 5:72203533-72203555 AAATAAACAAAGACAAAGCAAGG - Intronic
992052095 5:72950687-72950709 AAATAGACAAATGTAAAACATGG - Intergenic
992147879 5:73870300-73870322 AAATAGAAAATGATAGAACTGGG - Intronic
992554566 5:77890766-77890788 CACTACACAAATATAGAACAAGG + Intergenic
992931820 5:81655153-81655175 AAATATACATATAAAGAAAAAGG + Intronic
993049202 5:82906674-82906696 AAATATAAAAATAGAGAATATGG + Intergenic
993256562 5:85598452-85598474 AGAAATAAAAAGATAGAACATGG - Intergenic
993434854 5:87879982-87880004 AAAATTACAAAGCTAGAACGTGG + Intergenic
993553812 5:89310004-89310026 AAATAAAGAAAAATAGACCAAGG - Intergenic
993590195 5:89784944-89784966 AAATATACAAAGAACAAATATGG + Intergenic
993676871 5:90826038-90826060 AAATTTAAAAAGAGAGAAGATGG + Intronic
993761155 5:91799322-91799344 AAATGTACAATGATAGCAGAAGG + Intergenic
993775720 5:91993256-91993278 AAAGATAGAAAGAAAGAAAAGGG + Intergenic
993802937 5:92366600-92366622 CAATATATAAAGGTAGAAAATGG - Intergenic
994398639 5:99250847-99250869 AAATAAATAAAAATAAAACAAGG - Intergenic
994534699 5:101014092-101014114 AAATATACAAAAATACAAGTGGG + Intergenic
994546374 5:101171860-101171882 AACTCTACCAAGATGGAACAAGG + Intergenic
995016065 5:107310138-107310160 AAAGTCACAAAAATAGAACAGGG - Intergenic
995073859 5:107958187-107958209 AAATAAATAAAGACAGAACCTGG - Intronic
995118822 5:108513949-108513971 AAATAAAGAAAGAAAGAAAATGG + Intergenic
995488293 5:112661785-112661807 AAATATGCCAAGATTGAACCAGG + Intergenic
996148316 5:120002698-120002720 AAATATACATAATTACAACATGG - Intergenic
996191083 5:120542368-120542390 AAAGTTGCAAAGATAGTACAGGG + Intronic
996378347 5:122839169-122839191 AAATATACCAAGAAAGAGGAAGG - Intergenic
996447851 5:123577533-123577555 AAAGATACAAATATGGAAAAGGG - Intronic
996486142 5:124037156-124037178 AAATATAGAAAAATAGGAAAAGG - Intergenic
996793222 5:127315800-127315822 AAATATAGACAGAAAGAAAAAGG - Intronic
996940062 5:128993967-128993989 TAAAATACAAAAATACAACATGG + Intronic
997638514 5:135433249-135433271 AAATATACATACACAGTACATGG + Intergenic
998014062 5:138718320-138718342 AAATACATAAAAATAAAACATGG - Intronic
998029408 5:138852090-138852112 AAATAAATAAATATATAACATGG + Intronic
998344811 5:141452570-141452592 AAAAATACAAAGATGGAAAGGGG - Intronic
998988187 5:147785309-147785331 GTATATAGAAAAATAGAACATGG - Intergenic
999447626 5:151652931-151652953 AAATTTAAAAACATAAAACATGG - Intergenic
999874714 5:155790952-155790974 CAATAAACAAAAATAGAATAAGG + Intergenic
999936346 5:156490137-156490159 AAATGAACAAAGATTGAACCAGG + Intronic
999963219 5:156779456-156779478 AAATATAAAAAGAGATAAAATGG + Intergenic
999991175 5:157051510-157051532 AAATTTACACAGATAGAAAGTGG - Intronic
1000657735 5:163901809-163901831 AAAAATAGGAAGAAAGAACAAGG + Intergenic
1000783796 5:165517528-165517550 ATAGAGAAAAAGATAGAACACGG - Intergenic
1000967888 5:167681639-167681661 ATATATACATAATTAGAACATGG - Intronic
1001401230 5:171447695-171447717 AAATTTACAAATATAGACCCTGG - Intronic
1001813335 5:174647325-174647347 AAATATAGACAGAGAGAAAAAGG + Intergenic
1001974052 5:175982232-175982254 AAAAATAAAAAAATAGAACTTGG + Intronic
1002084570 5:176764794-176764816 AAAAATAGAAACAGAGAACAAGG - Intergenic
1002243381 5:177861547-177861569 AAAAATAAAAAAATAGAACTTGG - Intergenic
1002517838 5:179772886-179772908 AAACAAACAAACAAAGAACAGGG - Intronic
1002952302 6:1826018-1826040 AAAAATAAAAAGATAGAAAATGG + Intronic
1002970670 6:2015267-2015289 ACATTTACTAAGATAGACCATGG + Intronic
1003044945 6:2725153-2725175 AAACAAACAAAAATAGAATATGG + Intronic
1003140008 6:3463502-3463524 AATATTACAAAGATAGTACAGGG - Intergenic
1003684732 6:8290815-8290837 AATGATAGAAAGATAGAAAAGGG - Intergenic
1003922065 6:10841793-10841815 ATATATACAGAAATAGAAGAAGG + Intronic
1003950998 6:11115656-11115678 AAAGAAAGAAAGAAAGAACATGG - Intronic
1004039001 6:11956619-11956641 AAATGTATTAAGATAAAACACGG + Intergenic
1004092070 6:12514042-12514064 AAAGATACAAATAAAGAAGATGG + Intergenic
1004843963 6:19618229-19618251 AAATAAACAAAGTCAGAAAAAGG + Intergenic
1004969446 6:20892567-20892589 AAATATATAAATATACAATACGG - Intronic
1005628594 6:27686530-27686552 AAATAAACAAAAATAAAATAGGG + Intergenic
1006225519 6:32533593-32533615 AAAGATACAAAGCTAGTAAATGG + Intergenic
1006291183 6:33138055-33138077 AAAAAAAGAAAGATAGAAAAAGG + Intergenic
1007487779 6:42194301-42194323 AAATACACAAAGAGAGGACCTGG + Intronic
1008171957 6:48218920-48218942 ACATTTACAAACAGAGAACAAGG - Intergenic
1008356447 6:50559727-50559749 AAATCTGCAAATATAGAAAATGG + Intergenic
1009353846 6:62715032-62715054 AAAAATAAAAAGAAAGAAGAAGG + Intergenic
1009789376 6:68381628-68381650 CAATATACCAAGATTGAACCAGG - Intergenic
1010167559 6:72935053-72935075 AAAAAAAAAAAGATAGAACAAGG - Intronic
1010334921 6:74669666-74669688 ACATATACAATTTTAGAACACGG - Intergenic
1010349271 6:74852762-74852784 ATATATACAAAGATATTATAAGG + Intergenic
1010556490 6:77286348-77286370 ACATATGCAAATATAGCACATGG - Intergenic
1010902931 6:81450078-81450100 AAATACAAAAAGTTAGAAAAAGG - Intergenic
1011819471 6:91234657-91234679 AAGTATACAAAGATTAAATAAGG + Intergenic
1012063998 6:94524135-94524157 AAATATAAAAAAATAAAAAAAGG + Intergenic
1012608277 6:101185385-101185407 AAATATATGAAGATAAAAGATGG + Intergenic
1012643740 6:101654259-101654281 AACTATATAAAGATACAACTGGG + Intronic
1012663057 6:101928573-101928595 AAACAAACCAAGATAGAATATGG + Exonic
1012744342 6:103065327-103065349 AAATAAATAAAGTTAGAAAAAGG - Intergenic
1012858795 6:104534204-104534226 AAAGATATAAAGCTATAACAGGG - Intergenic
1012910259 6:105109928-105109950 TAATATACATAGATATCACATGG - Intronic
1013075202 6:106764977-106764999 AACAATTCAAAGATAGAAAAAGG + Intergenic
1013339230 6:109197041-109197063 AGAGATACAAAGATAGAACTTGG - Intergenic
1013348241 6:109282987-109283009 AAATATACAGAGAGAGAAGAAGG - Intergenic
1013445094 6:110217203-110217225 AAATATACAATTATTGAACAAGG + Intronic
1014149560 6:118038101-118038123 TAATATAAAAAGATAGCAGAAGG - Intronic
1014456967 6:121647155-121647177 AAATATTCCAAGTTGGAACATGG + Intergenic
1014539440 6:122655979-122656001 AAAAATACAAAAATATAATATGG - Intronic
1014605159 6:123464504-123464526 AAATTTACAAAGCTAGGAAAAGG + Intronic
1014822811 6:126011644-126011666 TAATATAAAAGGATATAACAGGG - Intronic
1014827673 6:126064869-126064891 AACTAAACAAACATAAAACAAGG - Intergenic
1014950880 6:127554201-127554223 AAATATGCATAGAAAGAATACGG + Intronic
1015166451 6:130205275-130205297 AAATATAATAAAATAGAACTTGG - Intronic
1015174043 6:130287008-130287030 AGATTTTGAAAGATAGAACAAGG - Intronic
1015245761 6:131072763-131072785 GAACATACAAAGAGAGAACAAGG + Intergenic
1015463307 6:133518307-133518329 AAATAAATAAAGATATAACAAGG + Intronic
1015467798 6:133567322-133567344 AAACAAACAAACATAAAACACGG + Intergenic
1015545960 6:134361559-134361581 AAATATACAATGATAGACAGTGG - Intergenic
1015745080 6:136501370-136501392 AAATATACACAGCTAGCAAATGG - Intronic
1015980346 6:138832233-138832255 AAATATTCAAAGAGAAATCAAGG - Intronic
1016092964 6:140000931-140000953 AAATATACAAGCATAGTATATGG - Intergenic
1016651412 6:146465478-146465500 CAATATACAAAGCATGAACAAGG - Intergenic
1016665670 6:146637172-146637194 AAATAAATAAACAAAGAACAAGG - Intronic
1016770873 6:147849141-147849163 AAAAATTCACATATAGAACAGGG - Intergenic
1016897993 6:149072793-149072815 AAATTCATAAAGATAGAACATGG + Intronic
1017655230 6:156621142-156621164 AAAAAAACAAAAAAAGAACAAGG + Intergenic
1017792241 6:157811543-157811565 AAATGTACAAAGATAAGATAGGG + Intronic
1018300850 6:162401716-162401738 AAATATACAAAATTAAAATAAGG + Intronic
1018305565 6:162450971-162450993 AAAGATGCAAAAATAGTACAGGG - Intronic
1018571340 6:165213769-165213791 AAATAAAAAAAGAAAGAAAATGG + Intergenic
1018588990 6:165395570-165395592 AAATATACAATCATAGAAAAGGG + Intronic
1018617343 6:165700249-165700271 AAATCTATAAAGACAGAAGATGG + Intronic
1018871717 6:167789255-167789277 AAAAATAAAAAGAAAGAAAAAGG - Intronic
1018938021 6:168286486-168286508 AAATAAAAAAAGAAAGAAAAGGG - Intergenic
1020164646 7:5798296-5798318 AAAAAAAAAAAGATAAAACAAGG + Intergenic
1020356874 7:7287042-7287064 ACACATAGAAAAATAGAACACGG + Intergenic
1020594553 7:10189667-10189689 ACATATAAAAAGAAAGAAAAAGG + Intergenic
1021338221 7:19430547-19430569 ACAAAAACAAAGAAAGAACAGGG + Intergenic
1021412867 7:20347853-20347875 AAATAGCCAAAGACATAACAAGG + Intronic
1022058117 7:26761902-26761924 AAATATACATATATATAATAGGG + Intronic
1022211779 7:28217897-28217919 AAATCTATAAAGACAGAAGATGG - Intergenic
1022888406 7:34670616-34670638 AATTATATAAAAATATAACATGG + Intronic
1022896862 7:34758902-34758924 TAAGATACAAAGAAAGACCAAGG - Intronic
1023463225 7:40423703-40423725 AAACATACACATATAGAAGATGG - Intronic
1023469017 7:40492618-40492640 ATATATACAAAGATCTAACTTGG - Intronic
1023538900 7:41243528-41243550 AAAAGTACATAGAAAGAACAGGG - Intergenic
1023692314 7:42802764-42802786 AAAAATACAAACAAAGAACAAGG + Intergenic
1024159667 7:46661676-46661698 AAAGAAAGAAAGAAAGAACAGGG - Intergenic
1024162964 7:46697962-46697984 TAAGATACAAACAAAGAACAAGG + Intronic
1024182588 7:46910806-46910828 AAAAATGCAAAGATGGTACACGG + Intergenic
1024353323 7:48389994-48390016 AAAAATAGAAAGAAAGAATATGG + Intronic
1025283494 7:57645040-57645062 AAATATACAAAGAATTAACCAGG - Intergenic
1025864158 7:65364542-65364564 ACATATAAAAAGATTAAACAGGG + Intergenic
1026476756 7:70743153-70743175 AAAGAAACAAAAATAAAACAAGG - Intronic
1026544998 7:71314576-71314598 AACAAAACAAAAATAGAACATGG - Intronic
1026547831 7:71339526-71339548 AAATATACAAAAAAAGAAGCGGG + Intronic
1026723760 7:72855031-72855053 AAATAAAGAAAGAAAGAAAAGGG - Intergenic
1027168557 7:75853537-75853559 AAAGAAAAAAAGAAAGAACAAGG - Intronic
1027370247 7:77501757-77501779 AAATATACAAAAATCATACAGGG - Intergenic
1027473318 7:78599234-78599256 AAGTATACAAAAATGGAACTGGG - Intronic
1027863312 7:83613303-83613325 AAATATACAGAAGTAAAACATGG + Intronic
1027889692 7:83955822-83955844 AGATTTACAAAGAGAGAAGACGG + Exonic
1028178765 7:87690865-87690887 AAATGTACCAAGATGGAATATGG - Intronic
1028392312 7:90330765-90330787 AAAAAAAGAAAGATAAAACATGG + Intergenic
1028435965 7:90804024-90804046 TAGAATACAAAGAAAGAACATGG - Intronic
1028444472 7:90904563-90904585 AAAAATACAAAGATGAAAAATGG + Intronic
1028796988 7:94914026-94914048 AAAGAAACACAGATAGAAAATGG - Intronic
1028840299 7:95422415-95422437 CAATATAGAAAGATATAAAATGG - Intronic
1028932761 7:96431404-96431426 AAATAAACAAAGATAAAATAAGG - Intergenic
1028939470 7:96504938-96504960 AAATATACTAAGCTACACCATGG - Intronic
1029185398 7:98734865-98734887 AAATAAATAAAAATAGAACGTGG - Intergenic
1029316345 7:99718062-99718084 AAATATACAATGAGAACACATGG + Intronic
1029433759 7:100549660-100549682 AAATAAACAAATATTGAGCATGG - Intronic
1029964866 7:104728964-104728986 AAATATAAAAAGAGACAACATGG + Intronic
1030131079 7:106200956-106200978 AAAAAAAAAAAGAAAGAACAAGG + Intergenic
1030236912 7:107273833-107273855 AAAGATAAAAAAATAGAAAAGGG + Intronic
1030468561 7:109934335-109934357 AAAAATATAAAGATGGAACATGG - Intergenic
1030557189 7:111041414-111041436 AAATATCCAATTATAGAAAAAGG + Intronic
1030570851 7:111221799-111221821 AACTATGAAAAGATAGTACAAGG + Intronic
1030707152 7:112704887-112704909 AAATAGAAAAACAAAGAACAGGG + Intergenic
1030953865 7:115826321-115826343 AAATACACGAAAATAAAACAGGG + Intergenic
1031095038 7:117406965-117406987 AACTACAGAAAGATAGAAAATGG + Intronic
1031171040 7:118291895-118291917 AAATTTACAATGATGGCACAAGG - Intergenic
1031575152 7:123406870-123406892 AAATTCAGAAAGATATAACAAGG - Intergenic
1031655977 7:124355830-124355852 AAATATACATGGATAAAAAATGG - Intergenic
1031769010 7:125818901-125818923 AGATATACAAATATAATACATGG - Intergenic
1031854150 7:126901555-126901577 ATATAAACAGAGACAGAACAAGG - Intronic
1032644509 7:133807598-133807620 AAATAAAGAAAGAAAGAAGAGGG + Intronic
1033110786 7:138573549-138573571 AAAGATACTAATATAGATCATGG + Exonic
1033533769 7:142292969-142292991 GAATATAATAAGAGAGAACAGGG + Intergenic
1033772294 7:144565878-144565900 AAATATGCAAACAGAGAATAGGG + Intronic
1034374187 7:150628517-150628539 AAATATCCAAAGAAAGCAGAGGG + Intronic
1034443236 7:151098383-151098405 ATATACACAAAGATAACACATGG + Intronic
1034656312 7:152732127-152732149 AAATATACAGAAATGAAACAAGG + Intergenic
1034735440 7:153425214-153425236 AAACATACAAACAAAAAACAAGG + Intergenic
1035847577 8:2882051-2882073 AAAGAAACAAAGAAAGAAAAAGG + Intergenic
1036596499 8:10217652-10217674 AAATATGCTAGGATAGAAGAGGG - Intronic
1036965011 8:13287772-13287794 AAATATTCAAAGATAAAGAAAGG + Intronic
1037067392 8:14598929-14598951 AAAAATAAAAAGACAAAACAAGG - Intronic
1037123769 8:15320373-15320395 AAATATATAAAGATAGGTTAAGG - Intergenic
1037346511 8:17906944-17906966 AAATATATAAAAATGGACCATGG - Intronic
1037495062 8:19431628-19431650 AACCAGACAAAGACAGAACAAGG - Intronic
1037515498 8:19627395-19627417 AACTATAAAAAGATTGCACAAGG + Intronic
1037549079 8:19952151-19952173 AAATATCAAACGATAGAGCAGGG - Intronic
1037963141 8:23114882-23114904 AAATATATAATCATAGAACAGGG - Intronic
1038153243 8:24961255-24961277 AAATATACAAAGAAATAAACTGG - Intergenic
1038180899 8:25226557-25226579 AAAAATAAAAAAATAAAACATGG - Intronic
1038540961 8:28389702-28389724 AAAAATACAAAAATAAACCAGGG - Intronic
1038613332 8:29072523-29072545 AAATAAATAAATAAAGAACATGG + Intronic
1038789231 8:30653462-30653484 AAGAAAACAAAGGTAGAACATGG - Exonic
1038856801 8:31342480-31342502 AAATTTACAATGTTAGAAAAAGG + Intergenic
1038969352 8:32614703-32614725 AAATCCAAAAAGACAGAACAAGG - Intronic
1039090452 8:33822900-33822922 AAATTTATATAGATAGAAAAGGG + Intergenic
1039204542 8:35136698-35136720 AAATATTGAAAGCTAGAATATGG + Intergenic
1039327353 8:36500157-36500179 ATAGATACAGATATAGAACAAGG + Intergenic
1039388154 8:37154684-37154706 GAATATACAAAGGTATAGCAAGG - Intergenic
1039755393 8:40517151-40517173 AAGTAGACAAACCTAGAACAGGG - Intergenic
1039815808 8:41093497-41093519 AAAAATAAAAAGATAAAAAAAGG + Intergenic
1039875474 8:41581338-41581360 AAACATACTAAGATTGTACAAGG - Intronic
1039976763 8:42373107-42373129 AAATATACAAAGTTATCAAATGG + Intergenic
1040007757 8:42634752-42634774 AACTATACATACATAGAACAAGG + Intergenic
1040020914 8:42740098-42740120 AAATATAGAAATTTAGAGCAGGG - Intergenic
1040045058 8:42954253-42954275 AAATTTAAAAATATAGAAAAGGG - Intronic
1040115043 8:43607572-43607594 GAATATCCCAAGATAAAACAGGG + Intergenic
1040120583 8:43680568-43680590 AAATATCCCCAGATAGAAAATGG + Intergenic
1040135950 8:43853959-43853981 AAATATACCCAGATAAAACATGG + Intergenic
1040321679 8:46312298-46312320 AAATAAAAAAAGAAAGAAAAAGG + Intergenic
1041129266 8:54680321-54680343 AAATGTACAAAGGAAAAACAAGG + Intergenic
1041327562 8:56685115-56685137 AAATATACAAAGATCTGGCATGG + Intergenic
1041421331 8:57670128-57670150 TAATATACAGAGATAGAACAGGG + Intergenic
1041782050 8:61587694-61587716 ATATATGAAAAGATAGAACATGG - Intronic
1042074577 8:64977762-64977784 ATATTTACAGAAATAGAACACGG + Intergenic
1042882022 8:73503978-73504000 ACATATAAAAAGAAAGAAGAGGG + Intronic
1042893538 8:73640678-73640700 AAATATACAACCTTAGATCATGG + Intronic
1043136482 8:76532812-76532834 AACTATGCAAAGATAAGACATGG - Intergenic
1043321324 8:78990190-78990212 AAACATAGAAACATAGAAAATGG - Intergenic
1043632301 8:82351376-82351398 AAGTATAGAAATATGGAACATGG + Intergenic
1043646015 8:82519921-82519943 AAATATCCAAAGATATAACTTGG + Intergenic
1044185668 8:89248580-89248602 AAATATGCCAAGATTGAACTAGG - Intergenic
1044354960 8:91210402-91210424 AAATATACAAAGATAGCTATTGG - Intronic
1044534822 8:93346358-93346380 AAACAAAACAAGATAGAACAAGG - Intergenic
1044643275 8:94409233-94409255 AAATATCCAAACATAGGACTTGG - Intronic
1044644769 8:94427895-94427917 ACATAAGTAAAGATAGAACAGGG + Intronic
1044679366 8:94762110-94762132 AAATGTAGAAATGTAGAACAGGG + Intronic
1045894579 8:107199410-107199432 AAATCTATAAAGATAGAAGTAGG - Intergenic
1046028442 8:108753539-108753561 AAATATTGAAAGATAAAATAAGG - Intronic
1046354314 8:113059972-113059994 AAATAAATAAAAATAAAACAAGG - Intronic
1046377876 8:113410600-113410622 AAAGTTCCAAAGATAGAACTTGG - Intronic
1046452204 8:114407834-114407856 AGATATACAAAGAGTGAAGATGG + Intergenic
1046530453 8:115438554-115438576 AAATATATAAAGAAAGAAGGAGG - Intronic
1046573749 8:115999527-115999549 AAATATACAAAGAAAAGAGATGG + Intergenic
1046655003 8:116884096-116884118 ATATATACAAAGGTAGAAAGAGG - Intergenic
1046686514 8:117233611-117233633 TAATATTCAAAAAGAGAACATGG + Intergenic
1046890194 8:119414420-119414442 GAATAGACTCAGATAGAACAAGG - Intergenic
1047003668 8:120597660-120597682 AATTATACAAAGTAAGAATATGG + Intronic
1048072232 8:131033812-131033834 AAAAATAGAAAGAAAGAAAAAGG + Intronic
1048134617 8:131736566-131736588 AAATTTATAAAAATAGAAAATGG + Intergenic
1048411032 8:134172857-134172879 AAAAAAAAAAAGAAAGAACATGG - Intergenic
1048456764 8:134585340-134585362 AACCATACAAAGAGGGAACATGG + Intronic
1048525270 8:135196669-135196691 AAATTTGCACAGATAGAAAAAGG - Intergenic
1048721519 8:137331011-137331033 AAATTTAGAAAGAAAGAACCTGG + Intergenic
1049516630 8:143062190-143062212 AAATATACATAAATTTAACAGGG + Intergenic
1050015984 9:1235114-1235136 AATTATATAAATATAGAAGAAGG - Intergenic
1050442250 9:5677537-5677559 AAATATATACAAATAGATCATGG - Intronic
1050832003 9:10026249-10026271 AATAGTACAAAGATTGAACAAGG + Intronic
1050975878 9:11937173-11937195 AAAGAAAGAGAGATAGAACATGG + Intergenic
1051190781 9:14509725-14509747 AAATGGAGAAAGATAGAATAGGG + Intergenic
1051320454 9:15898729-15898751 AAAAGTACAAAAATAGCACAGGG + Intronic
1051543005 9:18241799-18241821 CAACATACAAAGATAGAATCAGG + Intergenic
1051904702 9:22081797-22081819 AAATGTAGAAAGGAAGAACATGG + Intergenic
1052022233 9:23538508-23538530 AAAAATAAACAGATAAAACATGG + Intergenic
1052147625 9:25070770-25070792 AAATATGGAAAGAGAAAACAGGG + Intergenic
1052318921 9:27146216-27146238 AAATATGCAAAGATATGGCAAGG - Intronic
1053156542 9:35784761-35784783 AAATATATAGAGATAGGGCAGGG - Intergenic
1053944356 9:43291142-43291164 AAATATATAGAGATAGAAATAGG + Intergenic
1053946438 9:43313649-43313671 AAATATATAGAGATAGAAATAGG - Intergenic
1055004843 9:71494136-71494158 AAAAATAGAAACAAAGAACAAGG + Intergenic
1055257358 9:74387192-74387214 AAATAAGCAAACATAGAACTGGG + Intergenic
1055403280 9:75947361-75947383 AAATAAAGTCAGATAGAACAAGG + Intronic
1055868019 9:80839509-80839531 AAATCTACAAAGATATATTATGG + Intergenic
1056112996 9:83414824-83414846 AAATATCAAAACATACAACAAGG - Intronic
1056273120 9:84966775-84966797 AAGTAGACAAGGATATAACACGG + Intronic
1056418297 9:86399016-86399038 AAAGATACAAATATAGATTAGGG - Intergenic
1057339226 9:94184444-94184466 AACTATGCAAAGCAAGAACAAGG + Intergenic
1057452965 9:95182212-95182234 AAATATACAAAAAAAAAAAAAGG + Intronic
1058128225 9:101221056-101221078 AAAGTTGCAAAAATAGAACAGGG - Intronic
1058138290 9:101331678-101331700 ACATATAAAAAGAAAGAGCAAGG + Intergenic
1058167833 9:101640366-101640388 AAATTTGCAAAGAAAGAAGAAGG - Intronic
1058285559 9:103172668-103172690 ATATATAAAAATATAGAAAAAGG + Intergenic
1058370915 9:104266605-104266627 AAACAGACACAGATAAAACAAGG + Intergenic
1058420782 9:104831202-104831224 AAAGATACAAAAATAGAAAAAGG - Intronic
1058820597 9:108725711-108725733 AAAAGTACAAAGATTGAAAAGGG + Intergenic
1058863571 9:109140836-109140858 AAATATAAAAAGACTGAACGGGG - Intronic
1058929320 9:109703172-109703194 AAATATACATATATATAACTTGG + Intronic
1059483520 9:114610563-114610585 AAAAATACAAGGAAAGCACAAGG + Intergenic
1059583650 9:115580639-115580661 ATAGATAAATAGATAGAACAAGG - Intergenic
1059585440 9:115601140-115601162 AAATATAGAAAGATAAAATATGG + Intergenic
1059703909 9:116802064-116802086 AAAGAAAGAAAGAAAGAACATGG - Intronic
1059742096 9:117161790-117161812 AAATCTACAGAGAGAGAAAAGGG + Intronic
1060059178 9:120443814-120443836 AAGAACACAAAGATACAACAGGG + Intronic
1060600316 9:124872920-124872942 AAAGCTTCAAAAATAGAACAAGG - Intronic
1061945425 9:133906040-133906062 AAATATACAAAAAAAGAAAGAGG + Intronic
1203587492 Un_KI270747v1:19720-19742 AAATATATAGAGATAGAAATAGG + Intergenic
1203589568 Un_KI270747v1:42207-42229 AAATATATAGAGATAGAAATAGG - Intergenic
1185649059 X:1635558-1635580 AAAGAAAGAAAGAAAGAACATGG + Intronic
1185752172 X:2621469-2621491 AAATGTACAAATATAGAAAAGGG - Intergenic
1186015925 X:5193387-5193409 AAATATGCAAAAATAGCAAAAGG + Intergenic
1186337437 X:8605681-8605703 AAAGAAAGAAAGATAGATCAAGG + Intronic
1186572603 X:10731375-10731397 AAATAAACGAAGATAGAAAAAGG + Intronic
1186798475 X:13069104-13069126 AAATATTCTAAAATAGAACAAGG - Intergenic
1186927337 X:14349401-14349423 AAATATGGAAAGATATACCATGG + Intergenic
1187115306 X:16343547-16343569 AAATATACAAGGATTGAACCAGG - Intergenic
1187154342 X:16709906-16709928 AAATATATTAAGACATAACATGG - Intronic
1187411908 X:19058554-19058576 AGATAAACAAAGATATAAAATGG - Intronic
1187623323 X:21083099-21083121 AACTATACAAAAATAGGCCATGG + Intergenic
1187780858 X:22822357-22822379 AAATTTACAAACATCTAACAAGG - Intergenic
1187826726 X:23338665-23338687 AAAAATACAAGGCTAGAACCAGG + Intronic
1188058941 X:25576791-25576813 AATTATATCAAGATAGAAGATGG - Intergenic
1188104190 X:26129111-26129133 AAATATATAAAAAAAGAATATGG - Intergenic
1188394990 X:29671255-29671277 AAATACAGAAATATAGAAAATGG - Intronic
1188475713 X:30589462-30589484 AAATGGACAAAGACAGAAAATGG - Intergenic
1188538459 X:31222719-31222741 AAAAAAACAAAGGTAGAACAAGG + Intronic
1188739659 X:33763259-33763281 AAATATAAAAAATTAGAAAAAGG - Intergenic
1188787977 X:34372349-34372371 GAAAAAATAAAGATAGAACAGGG - Intergenic
1188855064 X:35184199-35184221 ACACATACAAAGAGACAACAGGG + Intergenic
1189092376 X:38099379-38099401 AAACATAAAAATATAGAAAAGGG + Intronic
1189666325 X:43358721-43358743 AAATGGACTAAGATAGAAAATGG - Intergenic
1189828125 X:44941445-44941467 ATATATACAACGATGGAAGAGGG - Intronic
1190027400 X:46937653-46937675 AAAATTACCAAGATAGAAGAGGG - Intronic
1190159353 X:48019469-48019491 AAATATAAAGAGAAAGAACAAGG + Intronic
1190175066 X:48141702-48141724 AAATATAAAGAGAAAGAACAAGG + Intergenic
1190204493 X:48392122-48392144 AAAAATAGAAAGAAAGAGCATGG - Intronic
1190206043 X:48403281-48403303 AAAAATAGAAAGAAAGAGCATGG + Intronic
1190871483 X:54428252-54428274 AAATAAATAACGATAGAATATGG + Intergenic
1190930692 X:54947544-54947566 AAATACACATAGTTAGAAAAGGG - Intronic
1191015528 X:55806021-55806043 AAAAATAAAAAGAAAGAGCAAGG - Intergenic
1191144770 X:57154571-57154593 AAAAATAAAAAGATACAACAAGG - Intergenic
1192268060 X:69553955-69553977 AAATTCACAGAGATAGAAAATGG + Intergenic
1192363008 X:70451086-70451108 AAAAAAACAAAGACAGAACTGGG - Intronic
1192493859 X:71600342-71600364 AAAATTACAAAGATAGTAAATGG - Intronic
1192538398 X:71948042-71948064 AAATAAAAAAAGAAAGAAAATGG + Intergenic
1192589582 X:72348840-72348862 AAATAGAAAAAGAAAGAATATGG - Intronic
1192611720 X:72573307-72573329 ATATAAACACAGATAGAACGTGG + Intergenic
1192907697 X:75568984-75569006 AAAAATAGAAAAATAAAACAGGG - Intergenic
1193004774 X:76603442-76603464 GAATATAAAAAAATAGAACGAGG - Intergenic
1193267655 X:79492263-79492285 CAACATACAAAGATTGAACCAGG + Intergenic
1193629574 X:83866195-83866217 AAAAATACAATGATTGAACATGG + Intronic
1193650764 X:84128638-84128660 AAAAACAGAAACATAGAACAGGG + Intronic
1193781520 X:85708351-85708373 AAAACTACCAAGATTGAACAAGG + Intergenic
1193782684 X:85723195-85723217 AAATAAATAAAGATTGAACTGGG - Intergenic
1194149221 X:90302530-90302552 AAAAATACAAAAATATAACCAGG - Intergenic
1194178504 X:90683950-90683972 AGATATAGAAAGAAATAACATGG + Intergenic
1194256138 X:91636813-91636835 AAATAGGAAAAGATAGAGCATGG + Intergenic
1194269725 X:91796857-91796879 AAATGTACAAAGACAGTAAATGG + Intronic
1194369409 X:93053375-93053397 AAAAATAGAAACAAAGAACAAGG - Intergenic
1194754473 X:97721713-97721735 AAATAGGCAAAAATATAACAAGG + Intergenic
1194783504 X:98053996-98054018 CAATATACAAAGATTGAACCAGG - Intergenic
1195030878 X:100926870-100926892 AAATATACAAAGAGATAAATAGG + Intronic
1195076826 X:101335305-101335327 AAATATTTAAAGATAAAATAGGG - Intergenic
1195296452 X:103482870-103482892 AAAGATATAAAGAAAGAAAATGG - Intergenic
1195335568 X:103850064-103850086 CAATATATAAAGAAAGATCAGGG - Intergenic
1195349412 X:103982731-103982753 ATATATAAAAAGATACATCATGG + Intergenic
1195358031 X:104056108-104056130 ATATATAAAAAGATACATCATGG - Intergenic
1195426628 X:104739817-104739839 AAATATCCAAATATACAAGATGG - Intronic
1195438182 X:104869783-104869805 AGATATTCAAACATAGAAAAGGG + Intronic
1195629889 X:107044054-107044076 AAAGCTGCAAAGATAGTACATGG + Intergenic
1195631749 X:107063248-107063270 AAATATATAGAGATAGAAAGTGG - Intergenic
1195857158 X:109343777-109343799 AAAAATATACAGCTAGAACAAGG + Intergenic
1195907386 X:109858269-109858291 AAATATGCAGAGATAGAACAAGG - Intergenic
1196266727 X:113657618-113657640 AAATATACATAGCTAGAAGGTGG + Intergenic
1196654734 X:118205782-118205804 AAAAATACAAAAATAAAATAGGG - Intergenic
1197069171 X:122273071-122273093 AAATATACAAAGACAATTCATGG + Intergenic
1197075178 X:122344511-122344533 AAAAATAAAAAGAGACAACATGG + Intergenic
1197558656 X:127990742-127990764 AAATAGAAAAAGATAGACAAGGG + Intergenic
1197699239 X:129585339-129585361 TAAGATAAAAAGACAGAACATGG - Intronic
1198173704 X:134133550-134133572 ATGTATCCAAAGATAGACCATGG + Intergenic
1198217131 X:134565881-134565903 GAATATAAAAATATAGAAAAAGG + Exonic
1198399488 X:136255241-136255263 AAATAAAAAAAGAAAAAACATGG + Intronic
1198409850 X:136355533-136355555 AAATATATATATATATAACATGG + Intronic
1198622316 X:138527271-138527293 AAAAATACAAAAATAGATTAAGG - Intergenic
1198625099 X:138562940-138562962 AAACAAACAAAGAAATAACAAGG - Intergenic
1198638022 X:138721629-138721651 AAAGATACAGAGATGGAACTAGG - Intronic
1198982264 X:142412336-142412358 AAACCTACAAAGATTGAACCAGG + Intergenic
1199405432 X:147452666-147452688 AAAAAGACAAAGAAAGAAAAAGG + Intergenic
1199641468 X:149866574-149866596 AAATATAGAAAAATAGGACATGG + Intergenic
1200495594 Y:3879267-3879289 AAAAATACAAAAATATAACCAGG - Intergenic
1200525167 Y:4266115-4266137 AGATATAGAAAGAAATAACATGG + Intergenic
1200586945 Y:5017838-5017860 AAATGTACAAAGACAGTAAATGG + Intronic
1200677601 Y:6169602-6169624 AAAAATAGAAACAAAGAACACGG - Intergenic
1200736625 Y:6805761-6805783 AAATATCAAAAGAAAGAAAAAGG + Intergenic
1201219366 Y:11753014-11753036 AAACATATAAAGATACAAAATGG - Intergenic