ID: 950240156

View in Genome Browser
Species Human (GRCh38)
Location 3:11362291-11362313
Sequence TCACCTCTCTGTGTGATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 288}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950240156_950240157 -5 Left 950240156 3:11362291-11362313 CCTAGAATCACACAGAGAGGTGA 0: 1
1: 0
2: 1
3: 25
4: 288
Right 950240157 3:11362309-11362331 GGTGATGCCCATGTTGTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 139
950240156_950240163 19 Left 950240156 3:11362291-11362313 CCTAGAATCACACAGAGAGGTGA 0: 1
1: 0
2: 1
3: 25
4: 288
Right 950240163 3:11362333-11362355 ACATAGGAACTGAGGGCCGCAGG 0: 1
1: 0
2: 1
3: 8
4: 83
950240156_950240162 12 Left 950240156 3:11362291-11362313 CCTAGAATCACACAGAGAGGTGA 0: 1
1: 0
2: 1
3: 25
4: 288
Right 950240162 3:11362326-11362348 GAGAGGCACATAGGAACTGAGGG 0: 1
1: 0
2: 1
3: 24
4: 259
950240156_950240160 3 Left 950240156 3:11362291-11362313 CCTAGAATCACACAGAGAGGTGA 0: 1
1: 0
2: 1
3: 25
4: 288
Right 950240160 3:11362317-11362339 CCATGTTGTGAGAGGCACATAGG 0: 1
1: 1
2: 2
3: 24
4: 210
950240156_950240161 11 Left 950240156 3:11362291-11362313 CCTAGAATCACACAGAGAGGTGA 0: 1
1: 0
2: 1
3: 25
4: 288
Right 950240161 3:11362325-11362347 TGAGAGGCACATAGGAACTGAGG 0: 1
1: 0
2: 3
3: 26
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950240156 Original CRISPR TCACCTCTCTGTGTGATTCT AGG (reversed) Intronic