ID: 950240401

View in Genome Browser
Species Human (GRCh38)
Location 3:11364842-11364864
Sequence CCCTGCAGCTGGGATTTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 480}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950240394_950240401 0 Left 950240394 3:11364819-11364841 CCACTTCATATCCACCCTACTTA 0: 1
1: 0
2: 0
3: 11
4: 132
Right 950240401 3:11364842-11364864 CCCTGCAGCTGGGATTTCAATGG 0: 1
1: 0
2: 5
3: 30
4: 480
950240391_950240401 6 Left 950240391 3:11364813-11364835 CCCAGCCCACTTCATATCCACCC 0: 1
1: 0
2: 0
3: 18
4: 185
Right 950240401 3:11364842-11364864 CCCTGCAGCTGGGATTTCAATGG 0: 1
1: 0
2: 5
3: 30
4: 480
950240390_950240401 13 Left 950240390 3:11364806-11364828 CCATCTGCCCAGCCCACTTCATA 0: 1
1: 1
2: 1
3: 34
4: 322
Right 950240401 3:11364842-11364864 CCCTGCAGCTGGGATTTCAATGG 0: 1
1: 0
2: 5
3: 30
4: 480
950240392_950240401 5 Left 950240392 3:11364814-11364836 CCAGCCCACTTCATATCCACCCT 0: 1
1: 0
2: 1
3: 30
4: 237
Right 950240401 3:11364842-11364864 CCCTGCAGCTGGGATTTCAATGG 0: 1
1: 0
2: 5
3: 30
4: 480
950240393_950240401 1 Left 950240393 3:11364818-11364840 CCCACTTCATATCCACCCTACTT 0: 1
1: 0
2: 1
3: 15
4: 166
Right 950240401 3:11364842-11364864 CCCTGCAGCTGGGATTTCAATGG 0: 1
1: 0
2: 5
3: 30
4: 480
950240389_950240401 18 Left 950240389 3:11364801-11364823 CCATTCCATCTGCCCAGCCCACT 0: 1
1: 0
2: 6
3: 85
4: 559
Right 950240401 3:11364842-11364864 CCCTGCAGCTGGGATTTCAATGG 0: 1
1: 0
2: 5
3: 30
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950240401 Original CRISPR CCCTGCAGCTGGGATTTCAA TGG Intronic
901548903 1:9980495-9980517 CCGAGCAGCTGGGATTACAGGGG - Intronic
901663179 1:10811674-10811696 CCGAGTAGCTGGGATTACAAAGG - Intergenic
901663235 1:10812127-10812149 CCGAGTAGCTGGGATTACAAAGG + Intergenic
902030833 1:13420982-13421004 CCGTGGAGATGGGATTTCCACGG - Exonic
902092225 1:13912727-13912749 CCCAGTAGCTGGGATTACAGGGG + Intergenic
902961837 1:19969025-19969047 CCGAGCAGCTGGGATTACAGGGG + Intergenic
903468920 1:23571434-23571456 CCGAGCAGCTGGGATTACAGTGG - Intergenic
903608595 1:24593050-24593072 CCACGTAGCTGGGATTACAAGGG - Intronic
903653891 1:24937183-24937205 CCCTGCCTCTGGGATATCTAGGG - Intronic
903930635 1:26860164-26860186 CCGAGTAGCTGGGATTACAAGGG - Intergenic
904032826 1:27543817-27543839 TCCTGTAGCTGGGATTACAGGGG - Intronic
904164739 1:28546843-28546865 CCCTGCAGCTTGGATATCCTGGG - Intergenic
905688644 1:39926843-39926865 CCATGAAGCTGGGCTTTGAAGGG - Intergenic
906508148 1:46395064-46395086 CCCAGTAGCTGGGATTACAGGGG + Intronic
907090017 1:51714835-51714857 CCCTGGAGCTGGGATGTTACTGG + Intronic
907164202 1:52395867-52395889 CCCAGTAGCTGGGACTACAAGGG - Intronic
907271367 1:53293290-53293312 CCCTGCAGCTGCCATTTCCTGGG - Intronic
908347727 1:63252435-63252457 CCAAGTAGCTGGGATTACAAGGG - Intergenic
908896999 1:68911852-68911874 CCCGGCAGCCGGGGTTTTAAGGG - Intergenic
909371800 1:74892244-74892266 TCCTGCAGCTAGGATTCCAGAGG - Intergenic
909741293 1:79032509-79032531 CCCAGTAGCTGGGATTACAGGGG - Intergenic
910429945 1:87150887-87150909 AACTGCAGCTGGGTCTTCAAGGG - Intronic
910633969 1:89386639-89386661 TACTGTAGCTGAGATTTCAAAGG - Intergenic
911366665 1:96946924-96946946 CCAAGCAGCTGGGATTACAGGGG + Intergenic
912414478 1:109498624-109498646 TCCTCCAGCTGGGATCTCAGTGG + Intronic
913194300 1:116442870-116442892 CCCAGTAGCTGGGATTACAGGGG + Intergenic
914587530 1:149076321-149076343 CCAAGCATCTGGGATTACAAGGG + Intronic
914639191 1:149586366-149586388 CCCAGTAGCTGGGATTACAGGGG - Intergenic
915013017 1:152707729-152707751 CCCTTCAGCCTGGAATTCAAAGG - Intergenic
915156942 1:153884880-153884902 CCAAGCAGCTGGGATTACACGGG + Intronic
915453596 1:156024117-156024139 CCTAGTAGCTGGGATTACAAGGG - Intergenic
915660338 1:157400134-157400156 CTCTGCTCCTGGTATTTCAAAGG - Intergenic
915699426 1:157776907-157776929 GCCTGCAGCTTGGGCTTCAAAGG - Intronic
915759376 1:158295407-158295429 TCCTGCAGCTAGGATTCCAGAGG - Intergenic
915946111 1:160152906-160152928 CCAAGCAGCTGGGATTACAGGGG - Intronic
916067623 1:161149089-161149111 CCCAGTAGCTGGGATTACAGGGG - Intergenic
917012294 1:170488323-170488345 CTCTGCAGCTAGGATTCCAGAGG - Intergenic
917871666 1:179247873-179247895 CCGAGTAGCTGGGATTACAAGGG - Intergenic
918518375 1:185387254-185387276 CCAAGTAGCTGGGATTACAAGGG + Intergenic
919292723 1:195653810-195653832 CCCAGTAGCTGGGATTACAGGGG + Intergenic
919638453 1:200026444-200026466 CCCAGTAGCTGGGATTACAGGGG - Intergenic
920328413 1:205185471-205185493 CCCAGTAGCTGGGACTACAAGGG + Intronic
921462548 1:215445535-215445557 TCCTCCTGCTGGGATTTCAGAGG + Intergenic
922184412 1:223261188-223261210 CTCTGCTGCTGGGATTTCTCAGG + Intronic
923346937 1:233063109-233063131 CCGAGTAGCTGGGATTACAAGGG - Intronic
923451027 1:234117464-234117486 CCAAGTAGCTGGGATTACAAGGG - Intronic
924136313 1:240970851-240970873 CTGTGTAGCTGGGATTACAAGGG - Intronic
924258829 1:242209297-242209319 CCCTGCAGCCAGGAATTCTAGGG + Intronic
924285030 1:242477122-242477144 CCCAGTAGCTGGGATTACAGGGG - Intronic
924851659 1:247837314-247837336 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1064113434 10:12557774-12557796 TCCAGCAGCTGGGATTCAAATGG - Intronic
1064211922 10:13366914-13366936 CCAAGCAGCTGGGATTACAGGGG + Intergenic
1064285747 10:13989963-13989985 CTCAGCAGCTTGGATTCCAAGGG + Intronic
1064559507 10:16582303-16582325 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1064568721 10:16670888-16670910 CCCAGTAGCTGGGATTACAGGGG + Intronic
1064896926 10:20247399-20247421 CCCTGCAGCTTTGATTTCCTGGG - Intronic
1065723635 10:28649841-28649863 CCCAGCAGCTGGGACTACAGGGG - Intergenic
1066153625 10:32651182-32651204 CCCTGCAACTAGGATCTCAGAGG + Intronic
1066364940 10:34767828-34767850 CCAAGTAGCTGGGATTACAAGGG - Intronic
1066632244 10:37468812-37468834 CCCTGCAGCTAAGATGTGAAGGG - Intergenic
1066679462 10:37923054-37923076 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1068072078 10:52207682-52207704 TCCTGCAGCTGAGATTCCAGGGG + Intronic
1069457666 10:68565877-68565899 CCCTGCAGTTGGGTTTTTCAGGG + Intronic
1069951145 10:72019024-72019046 CCGAGCAGCTGGGATTACAGGGG - Intergenic
1070076694 10:73143292-73143314 CCGAGCAGCTGGGATTACAGGGG + Intronic
1070267521 10:74918615-74918637 CCAAGTAGCTGGGATTACAAGGG - Intronic
1070797120 10:79223329-79223351 CCAGGCGGCTGGCATTTCAAGGG - Intronic
1070843261 10:79502741-79502763 CCCTGAAGCAGGGACTTCCAGGG - Intergenic
1070989872 10:80722093-80722115 CTCTGCAGCTGGGGTTTCAAGGG - Intergenic
1071499758 10:86194952-86194974 CCCAGCACCTGGGACTGCAAAGG + Intronic
1071619602 10:87107286-87107308 CCCAGTAGCTGGGATTACAAGGG - Intronic
1072050265 10:91697517-91697539 CCGAGCATCTGGGATGTCAAAGG - Intergenic
1072625194 10:97106836-97106858 CCCTTGAGCTGGCATTTCCAGGG - Intronic
1072714602 10:97742005-97742027 CCTAGCAGCTGGGATTACAGGGG - Intronic
1073408190 10:103317134-103317156 CCAAGTAGCTGGGATTACAAGGG + Intronic
1073440259 10:103548446-103548468 CCGAGCAGCTGGGATTACAGGGG + Intronic
1074129116 10:110557606-110557628 CCCAGTAGCTGGGATTACAGGGG + Intergenic
1077197729 11:1289634-1289656 ACCAGCAGGTGGGATTTCCAGGG - Intronic
1077197741 11:1289699-1289721 ACCAGCAGGTGGGATTTCCAGGG - Intronic
1077197757 11:1289772-1289794 ACCAGCAGGTGGGATTTCCAGGG - Intronic
1077197773 11:1289843-1289865 ACCAGCAGGTGGGATTTCCAGGG - Intronic
1077197788 11:1289913-1289935 ACCAGCAGGTGGGATTTCCAGGG - Intronic
1077256984 11:1589900-1589922 CCCAGCAGCTGGGATGACAAAGG + Intergenic
1077841739 11:5982798-5982820 CCCTGCAGCTAGGATTCCAGAGG + Intergenic
1079277405 11:19054681-19054703 GCGTGTAGCTGGGATTTTAAGGG + Exonic
1079754239 11:24235347-24235369 CCCTGCAGCTAGGATCCCAGAGG + Intergenic
1080028614 11:27637657-27637679 ACCTCCATCTGGGAATTCAATGG + Intergenic
1080281226 11:30559206-30559228 CCCTGCAGCTGGGTGTTTTAGGG - Intronic
1080427016 11:32164747-32164769 CGCTGCAGCTTAGGTTTCAATGG - Intergenic
1080495217 11:32811011-32811033 CCATGTAGCTGGGATTATAAGGG - Intergenic
1081428895 11:42954595-42954617 TCCTGCAGCTGGAACTTCAGTGG - Intergenic
1082693906 11:56336865-56336887 GCCTGTAGCTAGGATTTCAGAGG - Intergenic
1083013714 11:59429034-59429056 CCCTGGAGATGTGATGTCAAAGG - Intergenic
1083257795 11:61507397-61507419 CCCTGCAGTGGGGATGGCAATGG + Intergenic
1085268984 11:75258717-75258739 CCCTGCAGCAGGAATTTAATTGG - Intergenic
1085784191 11:79437340-79437362 CTCTGCAGTTGGGCTTTCAGCGG - Intronic
1086401270 11:86462866-86462888 CCCTGGAGCTGGGTCTTTAAGGG + Intronic
1087204316 11:95378028-95378050 CCTAGTAGCTGGGATTACAAGGG - Intergenic
1087635799 11:100699646-100699668 CCAAGCAGCTGGGATTACAGAGG + Intronic
1088422915 11:109668622-109668644 GCCTGAAGATGGGGTTTCAAAGG - Intergenic
1089125100 11:116171361-116171383 TCCTGCGGCTGGGACTGCAACGG - Intergenic
1089286332 11:117410171-117410193 CCCTGCAGCCAGGAGTTCTATGG + Intronic
1090072074 11:123552398-123552420 CCCAGTAGCTGGGATTACAGGGG + Intronic
1090750663 11:129743894-129743916 CTCTGCAGCTGGGGTCTCCATGG + Intergenic
1092881007 12:12887941-12887963 TCCTGCAGCCGGGAATTCCAAGG + Intergenic
1093270446 12:17053842-17053864 CCATGTAGCTGGGATTACAGGGG + Intergenic
1094571269 12:31643546-31643568 CCATGTAGCTGGGATTACAGGGG + Intergenic
1094650963 12:32375402-32375424 CCGAGTAGCTGGGATTACAAGGG - Intronic
1095140298 12:38654387-38654409 CCGAGTAGCTGGGATTACAAGGG - Intronic
1095514755 12:42993568-42993590 CCGAGCAGCTGGATTTTCAACGG + Intergenic
1095921973 12:47540720-47540742 GCATGCAGTTGGGAGTTCAATGG - Intergenic
1097083429 12:56449903-56449925 CCCAGTAGCTGGGATTACAGGGG - Exonic
1097571578 12:61339900-61339922 CCCAGTAGCTGGGATTACAGGGG + Intergenic
1098581020 12:72099037-72099059 CCGAGCAGCTGGGATTACAGGGG - Intronic
1101275713 12:103198655-103198677 CCCTGCAGCTAGGATTCCTGAGG + Intergenic
1101582637 12:106056506-106056528 CCAAGCAGCTGGGATTACACGGG - Intergenic
1101852576 12:108415927-108415949 CCGAGTAGCTGGGATTACAAAGG - Intergenic
1102621572 12:114200068-114200090 CCCTGAATCTGGGGTTTTAATGG - Intergenic
1102662144 12:114538566-114538588 CCATGCTGCTGGGATTACATGGG - Intergenic
1103134494 12:118496124-118496146 CCATGTAGCTGGGATTACATGGG + Intergenic
1103477317 12:121228267-121228289 CCGTGTAGCTGGGATTACACAGG - Intronic
1103962473 12:124617644-124617666 CCCTGCAGCTGGCCTTTCCTGGG + Intergenic
1104610769 12:130225958-130225980 TCCTGAAGCTGGAATTTTAAAGG - Intergenic
1104671203 12:130681818-130681840 CCAAGCAGCTGGGATTACAGGGG + Intronic
1104896050 12:132164166-132164188 CCCTGCTGGTGGGATGTCAATGG - Intergenic
1105380589 13:19883880-19883902 CCGCGTAGCTGGGATTACAAGGG + Intergenic
1106776360 13:33014092-33014114 CCCAGTAGCTGGGATTATAAGGG - Intergenic
1107230472 13:38104065-38104087 CCCTTCAGCTAGGATTCCAGAGG - Intergenic
1108620892 13:52182902-52182924 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1108978805 13:56483747-56483769 TCCTGCAGCTAGGATCCCAAAGG + Intergenic
1109424358 13:62151743-62151765 CCCTGAAGCTGCCATTTCAGAGG - Intergenic
1109596021 13:64554691-64554713 CCAAGTAGCTGGGATTTCAGGGG + Intergenic
1109651681 13:65336212-65336234 CCCTGCAGCTAGGATCTCAAAGG - Intergenic
1109764626 13:66878350-66878372 CCGAGCAGCTGGGATTACAGGGG + Intronic
1109809505 13:67493431-67493453 CCCTCCAGCTGGGACTACAGAGG - Intergenic
1110364980 13:74672675-74672697 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1110967172 13:81713841-81713863 CCCTGCAGCTAGAATCCCAAAGG + Intergenic
1111008016 13:82275582-82275604 TCCTGCAGCTAGGATTCCAGAGG - Intergenic
1111853172 13:93602462-93602484 CCCTGGAGCTGGACTTTCTAGGG - Intronic
1112001799 13:95217606-95217628 CCCAGTAGCTGGGATTGCAGGGG - Intronic
1113395357 13:109942496-109942518 CCAAGTAGCTGGGATTACAAGGG - Intergenic
1113496659 13:110735729-110735751 CCCTGTAGGTGGGATTACAGGGG + Intergenic
1113647284 13:112007611-112007633 CCCTGGAACTGGCTTTTCAAAGG - Intergenic
1114017757 14:18446965-18446987 CACTGCTGCTGGGATCTGAATGG - Intergenic
1114040949 14:18677892-18677914 CCGAGTAGCTGGGATTACAAGGG + Intergenic
1117014728 14:51507218-51507240 CCCTGCAGCTGCTATGACAATGG - Intronic
1117705082 14:58457391-58457413 CTGAGCAGCTGGGATTACAAGGG + Intronic
1118198126 14:63647304-63647326 CCAAGTAGCTGGGATTACAAGGG - Intergenic
1118582444 14:67315797-67315819 CCGAGCAGCTGGGATTACAGGGG - Intronic
1118646658 14:67846977-67846999 TCCTGCTGCTAGGATTTCAGAGG + Intronic
1118662458 14:68029001-68029023 CCCTGTAGCTAGGATTCCAGAGG + Intronic
1118757584 14:68856026-68856048 CCAAGTAGCTGGGATTACAATGG - Intergenic
1118788627 14:69068024-69068046 TCCTGCAGTTAGCATTTCAAAGG - Intronic
1118832198 14:69444627-69444649 CCCTAGAAGTGGGATTTCAAAGG - Intronic
1119250905 14:73152915-73152937 CCAGGTAGCTGGGATTACAAGGG - Intronic
1119510281 14:75205943-75205965 CCAAGCAGCTGGGATTACAGGGG - Intergenic
1119540859 14:75437474-75437496 TGGTGGAGCTGGGATTTCAATGG - Intronic
1120367997 14:83594700-83594722 CCGGGTAGCTGGGATTACAAGGG - Intergenic
1121312909 14:92944778-92944800 AGCTGGAGCTGGGATTTCATGGG - Intronic
1122070105 14:99200645-99200667 CCCTGGAGCTGGCATTTGCAGGG - Intronic
1122946935 14:105015788-105015810 CCGAGTAGCTGGGATTACAAGGG + Intronic
1124196727 15:27638142-27638164 CCCAGTAGCTGGGATTTCAGAGG - Intergenic
1124471160 15:29987287-29987309 CCAGGCAGCTTGGATTTTAATGG + Intergenic
1124631456 15:31339900-31339922 CCCTTCACCTTGGATTTCACTGG + Intronic
1125665474 15:41426965-41426987 CCAAGCAGCTGGGATTACAGGGG + Intronic
1126586844 15:50297336-50297358 CCCAGTAGCTGGGATTACAGGGG + Intronic
1126770700 15:52053197-52053219 CCGAGTAGCTGGGATTACAAAGG + Intronic
1127251119 15:57239398-57239420 CCAAGCAGCTGGGATTACATAGG - Intronic
1127361078 15:58245699-58245721 CCCTGCAGCTGAGATATCGGGGG + Intronic
1127583704 15:60361695-60361717 ACATGCAGCAGGGAATTCAAGGG - Intronic
1128543587 15:68553060-68553082 CCCTGCAGCTGGGACTAGCAGGG + Intergenic
1129123943 15:73421893-73421915 CCGAGTAGCTGGGATTACAAGGG - Intergenic
1129572262 15:76700398-76700420 TCCTGCAGCTAGGATTCCAGAGG + Intronic
1129596387 15:76967572-76967594 CCCTGGTGGTGGGATTTCAGAGG + Intergenic
1130162741 15:81417879-81417901 CCCAGTAGCTGAGATTACAAGGG - Intergenic
1130175063 15:81559674-81559696 TCCTGCAGCTAGGATTTCAAAGG + Intergenic
1130524589 15:84693581-84693603 CCAAGTAGCTGGGATTACAATGG + Intronic
1130682653 15:86010183-86010205 CCCTGCTGCTCGGATCTCTAGGG + Intergenic
1131640142 15:94283503-94283525 TCCTGCAGCTGGGATCTCAAAGG + Intronic
1131657443 15:94476364-94476386 CCCTGCTGCTGGGATTGTAATGG + Intronic
1131800524 15:96064509-96064531 CCCTGCAGCTGGGAGCAAAAGGG + Intergenic
1132898493 16:2240165-2240187 CCCTGAAAGTGGGATTTCAGTGG - Intronic
1133225996 16:4340660-4340682 CCCAGCAGCTGGGACTTCGAAGG - Intronic
1133249793 16:4473798-4473820 CCGAGTAGCTGGGATTACAAGGG - Intronic
1133975680 16:10598466-10598488 CGCTGGAGCTGAGATTTCAGTGG + Intergenic
1134103808 16:11471115-11471137 CGATCCAGCTGGGATTTCAGAGG + Intronic
1135507099 16:23048489-23048511 TCCTGCAGGTGTGCTTTCAATGG - Intergenic
1135542954 16:23346351-23346373 CCAGGTAGCTGGGATTACAAGGG + Intronic
1136235615 16:28911821-28911843 CCCAGTAGCTGGGATTACAGGGG - Intronic
1137656648 16:50164926-50164948 CCAAGTAGCTGGGACTTCAAGGG - Intronic
1138584873 16:57963051-57963073 CCCTGCGGCTGGGACTGCGATGG + Exonic
1139106705 16:63835278-63835300 TCCTACAGCTAGGATTTCAGAGG - Intergenic
1139806875 16:69573995-69574017 CCAAGTAGCTGGGATTACAAGGG + Intronic
1140434516 16:74935101-74935123 CTCAGTAGCTGGGATTACAAGGG - Intronic
1140796010 16:78438926-78438948 CCCTGCAGCGGGTTATTCAAGGG - Intronic
1141381544 16:83581691-83581713 CCTAGCAGCTGGGACTACAAGGG - Intronic
1141798603 16:86291772-86291794 CCCTGGAGCAAGGATTTCACAGG - Intergenic
1142206869 16:88787214-88787236 CCCTGCAGATGGACTTGCAAAGG + Intergenic
1142671109 17:1487793-1487815 CCGAGCAGCTGGGATTACACAGG - Intronic
1142736249 17:1901793-1901815 CCGGGCAGCTGGGATTACAGGGG - Intergenic
1142769837 17:2088645-2088667 CCCTGCTGCTTGGATTGCAAAGG - Intronic
1143092386 17:4456649-4456671 CCCAGCAGCTGGGATTATAGGGG + Intronic
1147124371 17:38356007-38356029 CCCAGTAGCTGGGATTACAGGGG + Intronic
1147832670 17:43307837-43307859 CCTTGCAGCTGATATTTCACAGG - Intergenic
1147906226 17:43824898-43824920 CCAAGCAGCTGGGATTACAGGGG + Intronic
1149230625 17:54530402-54530424 CCCTCCACCTGGCATCTCAAAGG - Intergenic
1149907451 17:60539098-60539120 CCAAGCAGCTGGGATTACAGGGG - Intergenic
1150210810 17:63440510-63440532 CCATGCAGTTGGCATTTCACTGG - Intronic
1150653118 17:67022727-67022749 CCATGCAGCCGAGATTTCTACGG + Intronic
1151042074 17:70874170-70874192 CCAAGCAGCTGGGATTACAGAGG - Intergenic
1151771095 17:76162251-76162273 CCCTTCAGCTGAGATTTGAGAGG - Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152081137 17:78187824-78187846 CCCAGTAGCTGGGATTACAGAGG - Intronic
1152099139 17:78290959-78290981 CCCTGCAGCAGGGAGATTAAGGG - Intergenic
1152726667 17:81950360-81950382 CCCTGCAGCTGTGACTTCCCAGG + Intergenic
1153765719 18:8372971-8372993 CTGTGCAGCTGGGAATTCAGGGG - Intronic
1154500430 18:14993434-14993456 CCAAGCAGCTGGGATTACAGGGG + Intergenic
1154503621 18:15010190-15010212 CCAAGCAGCTGGGATTACAGGGG + Intergenic
1154998490 18:21664122-21664144 CCTGGCAGCAGGGGTTTCAATGG - Exonic
1155133691 18:22965662-22965684 GTCTGCTGCTGGGATGTCAAAGG + Intronic
1156516571 18:37685423-37685445 CCCTGCAGGTGTGAGTGCAATGG + Intergenic
1158034403 18:53007365-53007387 CCATGGAGCTGGCATTTCAAAGG - Intronic
1158979053 18:62740846-62740868 CACAGTAGCTGGGATTACAAAGG - Intronic
1159274197 18:66194100-66194122 TCCTGCAGCTAGGATTCCAGAGG + Intergenic
1161274481 19:3408010-3408032 CCCAGTAGCTGGGAATTCCAGGG + Intronic
1161288574 19:3480767-3480789 CCCTGCAGCAGGGATCACAAAGG - Intergenic
1161642266 19:5431775-5431797 CCAAGCAGCTGGGATTACAGGGG + Intergenic
1162004040 19:7765802-7765824 TCCTGCAGCTTGGATTTCTCTGG - Exonic
1162004051 19:7765871-7765893 TCCTGCAGCTTGGATTTCTCTGG - Exonic
1162004062 19:7765940-7765962 TCCTGCAGCTTGGATTTCTCTGG - Exonic
1162004073 19:7766009-7766031 TCCTGCAGCTTGGATTTCTCTGG - Exonic
1162004082 19:7766078-7766100 TCCTGCAGCTTGGATTTCTCTGG - Exonic
1162598133 19:11645166-11645188 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1162890692 19:13731019-13731041 CCGAGTAGCTGGGACTTCAAGGG - Intergenic
1163369737 19:16895285-16895307 CCCAGAAGCTGGGATTACAGGGG - Intronic
1163460445 19:17434241-17434263 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1164792180 19:30996623-30996645 CTCTGCAGGTGGGCTTTCCATGG - Intergenic
1165454244 19:35901467-35901489 CCCTGGAGCTGGCATTCCAGTGG + Intronic
1165472135 19:36009828-36009850 AGCTGCAGCTGGGATCTCAAAGG + Intronic
1165587142 19:36928038-36928060 CCAAGCAGCTGGGATTACAGGGG + Intronic
1165817946 19:38654434-38654456 CCCAGTAGCTGGGATTACAGGGG - Intronic
1165821360 19:38678400-38678422 TCCTGCAGCTGGGTTTACTATGG + Intronic
1165853299 19:38864112-38864134 CCCAGTAGCTGGGATTACAAGGG + Intergenic
1165898143 19:39155603-39155625 CACTGGAGGTGGGATTTGAAGGG + Intronic
1166447331 19:42869438-42869460 CTCTGCAGCTTCCATTTCAAAGG + Intronic
1166633081 19:44425144-44425166 CCCAGCTGCTAGGATTTCAGTGG - Intronic
1166929734 19:46295124-46295146 CCGAGTAGCTGGGATTACAAGGG + Intergenic
1167009762 19:46799616-46799638 CCGAGTAGCTGGGATTTCAGGGG - Intergenic
1167179345 19:47890399-47890421 CTGAGCAGCTGGGATTACAAAGG + Intergenic
926161361 2:10492153-10492175 CTCAGTAGCTGGGATTACAAGGG - Intergenic
927072218 2:19542652-19542674 CCAGGCAGCTGGGACATCAAGGG + Intergenic
927566813 2:24120679-24120701 CCAAGTAGCTGGGATTACAAGGG + Intronic
929206345 2:39298838-39298860 CCCAGTAGCTGGGACTACAAGGG - Intronic
929263028 2:39887447-39887469 GCCTGCATCTAGGATTTCATGGG - Intergenic
929601591 2:43207925-43207947 CCCTGCAGCTGACATTTTAGTGG + Intergenic
932347766 2:71006908-71006930 CCCTGCAGCTGGCAGTGCAGGGG + Intergenic
932821013 2:74900711-74900733 CATTGCAGATGGGATCTCAAAGG - Intergenic
936047428 2:109198257-109198279 CACTGCAGCTGTGATCTCACAGG - Intronic
937243685 2:120478472-120478494 CCCAGTAGCTGGGATTACAGGGG - Intergenic
938056624 2:128220311-128220333 CCTTGCAGCTGGGACTTTATAGG - Intergenic
938499630 2:131823781-131823803 CCAAGCAGCTGGGATTACAGGGG + Intergenic
938502794 2:131840325-131840347 CCAAGCAGCTGGGATTACAGGGG + Intergenic
940007658 2:149022796-149022818 CCAAGTAGCTGGGATTACAAGGG - Intronic
940458487 2:153932751-153932773 CCCAGTAGCTGGGATTACAGGGG + Intronic
940647675 2:156408612-156408634 CCCTGTAGCTGGGACTACAGAGG - Intergenic
941522010 2:166557185-166557207 CCGAGTAGCTGGGATTACAAGGG - Intergenic
942568353 2:177288709-177288731 CCCAGTAGCTGGGATTACAGGGG + Intronic
944915072 2:204351400-204351422 CCCAGTAGCTGGGATTACAGGGG - Intergenic
945430216 2:209755163-209755185 TCCTGCAGCTGGGATTCTAGAGG - Intergenic
945525912 2:210887905-210887927 TCCTGCAGCTAGGATTTCAGAGG - Intergenic
946844080 2:223843801-223843823 CCAAGTAGCTGGGATTACAAAGG + Intergenic
949008272 2:241663105-241663127 CCGAGCAGCTGGGATTACGAGGG - Intronic
1169044279 20:2523804-2523826 CCCAGTAGCTGGGATTACAGGGG + Intronic
1169634016 20:7666882-7666904 CCCAGTAGCTGGGATTACAGGGG + Intergenic
1169969968 20:11259396-11259418 CCCAGTAGCTGGGATTACAGGGG + Intergenic
1171536738 20:25899062-25899084 GCCTGCAGGTGGGGTTTCACTGG - Intergenic
1172000769 20:31774863-31774885 CCAAGTAGCTGGGATTACAAGGG + Intronic
1172849905 20:37954106-37954128 CCGAGTAGCTGGGATTTCAGGGG - Intergenic
1173043849 20:39490958-39490980 TCCTGGAGCTGACATTTCAATGG + Intergenic
1173712634 20:45174265-45174287 CCCTACCACTGTGATTTCAAGGG + Intergenic
1174724681 20:52849106-52849128 CCAAGTAGCTGGGATTTCAGGGG - Intergenic
1175221098 20:57416899-57416921 ACCTGCAGCTGGGGTCTCCATGG + Intergenic
1177507895 21:22041156-22041178 TCCTGCAGCTGGAATTCCAGAGG + Intergenic
1178318846 21:31589545-31589567 CCGAGTAGCTGGGATTACAAGGG - Intergenic
1178930012 21:36809862-36809884 CCCAGTAGCTGGGACTACAAGGG + Intronic
1180442262 22:15377834-15377856 CACTGCTGCTGGGATCTGAATGG - Intergenic
1180557341 22:16588504-16588526 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1180899630 22:19360996-19361018 CCCAGCAGCTGGAATCCCAAGGG + Intronic
1181266111 22:21631965-21631987 CCGAGCAGCTGGGATTACAGGGG - Intergenic
1182209384 22:28661732-28661754 CCAAGTAGCTGGGATTACAAGGG + Intronic
1182210301 22:28671063-28671085 CACTGCAGCTGCGATTTCCCAGG + Intronic
1182545771 22:31075553-31075575 CCAAGTAGCTGGGATTACAAGGG - Intronic
1182627025 22:31654948-31654970 CCCAGTAGCTGGGATTACAGGGG - Intronic
1182658977 22:31911741-31911763 CCCAGTAGCTGGGACTACAAGGG + Intergenic
1182828625 22:33286412-33286434 CCCTGCCCCAGGGATTCCAAGGG - Intronic
1183100290 22:35579611-35579633 CCCTGCAGATGGGAACTCAGAGG + Intergenic
1183381116 22:37491044-37491066 CCCTGCATCTGAGAGTCCAAGGG + Exonic
1184095052 22:42311882-42311904 CCCAGAAGCTGGGACTTGAAAGG + Intronic
1184662969 22:45973990-45974012 CCCAGGAGCTGGGATTTTCAGGG - Intronic
1185012957 22:48326117-48326139 CCGTGTAGCTGGGACTACAATGG - Intergenic
1185259262 22:49852898-49852920 GCCTGCAGCCGGGTTTTCTATGG - Intergenic
950118608 3:10467358-10467380 CCCTGGAGCGGGGCTCTCAAGGG - Intronic
950240401 3:11364842-11364864 CCCTGCAGCTGGGATTTCAATGG + Intronic
950566501 3:13772632-13772654 CCCTGCAGCAGGGATACCCAGGG - Intergenic
950849038 3:16044287-16044309 TCCTGCAGCTAGGATTCCAGAGG + Intergenic
951880719 3:27478877-27478899 CCCAGTAGCTGGGATTACAGGGG - Intronic
952137509 3:30439844-30439866 CCAAGTAGCTGGGATTTCAGGGG - Intergenic
953045535 3:39291180-39291202 CCAAGTAGCTGGGATTACAAGGG + Intergenic
954017100 3:47703051-47703073 CCCAGTAGCTGGGATTACAAGGG + Intronic
954318128 3:49812374-49812396 CCCTGCACCTGGAATTGGAATGG + Intronic
954746852 3:52792269-52792291 CCCAGAAGCTGTGATTTCAGGGG + Intergenic
954804229 3:53206578-53206600 CCATGTAGCTGGGATTACAGGGG + Intergenic
954823118 3:53348316-53348338 CCCAGTAGCTGGGATTACATGGG + Intergenic
955777777 3:62451782-62451804 CCTTGCAGCAGAAATTTCAAAGG - Intronic
955969039 3:64418786-64418808 CACTGCTGCTGGAATTTCACAGG + Intronic
956075259 3:65498124-65498146 CCTGGCAGATGGCATTTCAAAGG + Intronic
956469048 3:69545968-69545990 CCCAGCAGCTGGGATTACAGGGG + Intergenic
956678478 3:71755696-71755718 CCCTGCAGCCGGCAATTCAGAGG - Exonic
957075424 3:75599135-75599157 CTGTGCAGCTGGGAATCCAACGG + Intergenic
957459406 3:80497466-80497488 GCCTGAAGCTGGGGTTTCACTGG + Intergenic
958095141 3:88934693-88934715 CCCAGTAGCTGGGATTACAGGGG + Intergenic
958460017 3:94383078-94383100 TCCTGCAGCTAGGATTCCAGAGG - Intergenic
958776111 3:98484503-98484525 CCAAGTAGCTGGGATTACAAGGG + Intergenic
959338748 3:105100320-105100342 CCCTGCAGCAGTGTTTTGAATGG - Intergenic
960168395 3:114429965-114429987 CCCTGCTGATTGGATATCAAGGG + Intronic
961377117 3:126474766-126474788 CCCTGCCGCAGGGATTCCGATGG - Intronic
962229647 3:133651310-133651332 CCAAGCAGCTGGGATTACAGGGG + Intronic
962456968 3:135573638-135573660 CCCAGCTGCAGGGAGTTCAAGGG + Intergenic
962797548 3:138862215-138862237 CCCAGCAGCTGGGACTACAGAGG + Intergenic
963031482 3:140982498-140982520 CCCAGTAGCTGGGATTACAGGGG - Intergenic
963051908 3:141150015-141150037 CCCTGCAGCTGGGATGACCATGG + Intergenic
963131931 3:141866161-141866183 CCCAGTAGCTGGGATTACAGGGG + Intergenic
963796627 3:149637349-149637371 CCCAGTAGCTGGGATTACAGGGG + Intronic
964116345 3:153139903-153139925 CCCAGTAGCTGGGATTACAGGGG - Intergenic
964328673 3:155575904-155575926 CCCCGTAGCTGGGATTACAGGGG + Intronic
965167969 3:165221247-165221269 GCCTGCAGCTAGGATTACAGGGG - Intergenic
966428712 3:179808946-179808968 CCGAGCAGCTGGGACTACAAGGG - Intronic
967411334 3:189169288-189169310 CCATGTAGCTGGGATTACAGGGG + Intronic
968017479 3:195351241-195351263 CCAAGCAGCTGGGATTACAGGGG + Intronic
969477200 4:7428435-7428457 TCCTGCAGCTCGCATTCCAAGGG + Intronic
969478378 4:7434037-7434059 CCCTGGAGCTGGGGTTGCCAAGG - Exonic
971072832 4:23114057-23114079 TCCTGCAGCTTGCATTTCAGAGG + Intergenic
971247774 4:24945745-24945767 CCAAGTAGCTGGGATTACAAGGG + Intronic
974023424 4:56711521-56711543 CCTTGAAGGTGGGGTTTCAATGG - Intergenic
975814654 4:78205275-78205297 CACTGCAGCTTGGAGTTCATAGG + Intronic
976757955 4:88518314-88518336 CCCAGTAGCTGGGATTACAGGGG - Intergenic
977304700 4:95308625-95308647 CCAAGCAGCTGGGATTACAGGGG - Intronic
979200929 4:117977456-117977478 TCCTGCAGCTAGGATTCCAGAGG - Intergenic
979377783 4:119967453-119967475 CCCAGTAGCTGGGATTACAGGGG - Intergenic
980009392 4:127579409-127579431 CCCTGCAGCTAGGATGCCAGAGG - Intergenic
980322340 4:131294120-131294142 TCCTGCAGCTAGGATTCCAGAGG + Intergenic
980950902 4:139375345-139375367 CACTGGAGCTGGGCTTTTAATGG + Intronic
981748490 4:148072456-148072478 ACCTGCTGCTGCGATTTTAAAGG + Exonic
982226232 4:153170014-153170036 GCCTGCAGCTGGGATGTGGATGG + Intronic
982670473 4:158314215-158314237 GCCTGCAGCTAGGATCTCAGAGG + Intergenic
982930990 4:161407542-161407564 CCCTGCAGCTAGGATTCCAGAGG - Intronic
983129582 4:164000041-164000063 CTTTGCAGCATGGATTTCAAGGG - Intronic
983340207 4:166451062-166451084 CACAGCAGCTGTGATTTCAGGGG + Intergenic
984459674 4:180017902-180017924 CCCAGAAGCTGGGATTACAGAGG + Intergenic
984808712 4:183775150-183775172 CCAAGCAGCTGGGATTACAGGGG + Intergenic
985009845 4:185570839-185570861 CCATGCAGCGGGGAGTTCACAGG + Intergenic
985345818 4:189002661-189002683 CCCTGGAGGTGGGCTCTCAAGGG + Intergenic
986900539 5:12426953-12426975 CCAAGTAGCTGGGATTACAAGGG + Intergenic
987420948 5:17719440-17719462 CCCAGCAGCTGGGACTACAGGGG + Intergenic
990134729 5:52631463-52631485 TCCTGCAGCTAGGATTCCAGAGG + Intergenic
990946985 5:61260092-61260114 CCCTGTAGGTGGGATTTAAAAGG - Intergenic
990954568 5:61330516-61330538 CCTTGCAGCCTGGATTTAAAGGG - Intergenic
991364755 5:65856720-65856742 CCAAGCAGCTGGGATTACAGGGG + Intronic
991728871 5:69563073-69563095 CCCAGTAGCTGGGATTACAGGGG + Intronic
991805300 5:70418222-70418244 CCCAGTAGCTGGGATTACAGGGG + Intergenic
991866084 5:71064800-71064822 CCCAGTAGCTGGGATTACAGGGG - Intronic
992900313 5:81288508-81288530 CCGAGTAGCTGGGATTACAAGGG + Intergenic
994507373 5:100659174-100659196 CCCTGGAGTTGGCATCTCAAGGG - Intergenic
994600519 5:101897198-101897220 TCTAGCAGCAGGGATTTCAAAGG + Intergenic
994603977 5:101943260-101943282 CACTGCAGCTAGGATTCCAAAGG + Intergenic
995922276 5:117328613-117328635 CCATCCCGCTGGGATTTCATAGG - Intergenic
997206969 5:132055892-132055914 CCCTGCAGCAGGGAATAGAAAGG + Intergenic
998034310 5:138901281-138901303 CCAAGCAGCTGGGATTACAGGGG + Intronic
998472383 5:142393132-142393154 CCCTGCAGTTAGGACTTCAGGGG + Intergenic
1000628075 5:163562324-163562346 CCCAGCAGCTGGGCTGACAAGGG - Intergenic
1001534896 5:172491353-172491375 CCCTGCTTCTGGGGTTCCAAGGG + Intergenic
1002282800 5:178142767-178142789 CCCTGAAGCTGGGATGTACAAGG + Intronic
1002316297 5:178346357-178346379 CCCAGTAGCTGGGATTTCAGGGG + Intronic
1002770443 6:286209-286231 CCCAGTAGCTGGGATTACAAGGG - Intergenic
1003630292 6:7780421-7780443 CCGAGCAGCTGGGATTACAGGGG - Intronic
1003785233 6:9478397-9478419 CCCTACTGCTGAGATTTCACTGG - Intergenic
1005028336 6:21485520-21485542 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1005039473 6:21588235-21588257 CGCTGCAGCTGCGCTCTCAATGG + Intergenic
1005872150 6:29982604-29982626 CCCAGTAGCTGGGATTACAGGGG + Intergenic
1006649393 6:35538311-35538333 CCAAGTAGCTGGGATTCCAAGGG - Intergenic
1007035465 6:38668866-38668888 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1007577801 6:42937466-42937488 CCAAGCAGCTGGGACTACAAAGG - Intronic
1007798409 6:44370218-44370240 CCCTCCTGCTGGGATTCAAAAGG - Intronic
1008208651 6:48694136-48694158 CCCTGCAGCTAGGATACCAGAGG - Intergenic
1008330665 6:50240775-50240797 GCCTGAAGGTGGGATTTCACTGG + Intergenic
1010232124 6:73544250-73544272 CCAAGTAGCTGGGATTACAAGGG - Intergenic
1010258298 6:73785967-73785989 CCGAGTAGCTGGGATTACAAGGG + Intronic
1010435270 6:75822221-75822243 CCCAGTAGCTGGGATTACAGGGG + Intronic
1012101143 6:95086318-95086340 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1012221686 6:96657303-96657325 CCCTGTAGCTAGGATTCCAGAGG - Intergenic
1012887437 6:104861274-104861296 CCGAGTAGCTGGGATTTCAGAGG - Intergenic
1013812764 6:114063387-114063409 CCTAGCAGCTGGGATTACAGGGG - Intronic
1014370124 6:120596019-120596041 CCCTTCAGCTGTGCTTTTAAAGG + Intergenic
1014630093 6:123778270-123778292 CACTGCATCTGGGGTTTCACTGG + Intergenic
1015396946 6:132745339-132745361 CCCAGTAGCTGGGATTACAGGGG + Intronic
1015724544 6:136287012-136287034 CCCAGTAGCTGGGATTACATGGG - Intronic
1016577417 6:145584630-145584652 TCCTGCAGCTAGGATTCCATAGG + Intronic
1018008847 6:159649260-159649282 GCCTACAGCTTGGACTTCAAGGG - Intergenic
1018221171 6:161581100-161581122 CCCAGTAGCTGGGATTACAAGGG - Intronic
1018259104 6:161951794-161951816 CCGAGCAGCTGGGATTACAGGGG - Intronic
1018270122 6:162068546-162068568 CCTTGCAGCTGTCATTACAAGGG + Intronic
1018726207 6:166615115-166615137 ACATCCTGCTGGGATTTCAATGG - Intronic
1019927589 7:4203435-4203457 GCCTGCAACTGGCATTTAAAGGG - Intronic
1019991928 7:4697948-4697970 CCGAGTAGCTGGGATTACAAGGG + Intronic
1020736119 7:11950762-11950784 TCCTCCTGCTGGGATTCCAAAGG + Intergenic
1022112322 7:27239404-27239426 GCCTGCAGCGGGCCTTTCAACGG - Intergenic
1023598258 7:41855039-41855061 TCCTGCTGCTGAGATTTCGAAGG + Intergenic
1023818395 7:43966963-43966985 CCAAGTAGCTGGGATTTCAGGGG + Intergenic
1024707782 7:51979806-51979828 CCAAGCAGCTGGGATTACAGGGG - Intergenic
1025144494 7:56492525-56492547 CCCTACTGCTGGGTTTTCAGTGG + Intergenic
1025260098 7:57413003-57413025 CCCTACTGCTGGGATTTCAGTGG + Intergenic
1025264195 7:57441732-57441754 CCCAGTAGCTGGGATTACAGAGG - Intergenic
1025288211 7:57685769-57685791 GCCTGCAGGTGGGGTTTCACTGG - Intergenic
1025871174 7:65435546-65435568 CCAAGCAGCTGGGATTACATGGG - Intergenic
1026009669 7:66627393-66627415 TCCTGCAGCTGGGAGTGCGATGG + Intergenic
1026275593 7:68872942-68872964 CCCTGGACCTGGGACTTTAAGGG + Intergenic
1027461372 7:78458168-78458190 CCGAGCAGCTGGGATTACAGGGG - Intronic
1027710825 7:81599469-81599491 CCCAGTAGCTGGGATTACACAGG + Intergenic
1028601336 7:92603798-92603820 CCAAGTAGCTGGGATTTCAGGGG - Intergenic
1029743023 7:102501795-102501817 CCAAGTAGCTGGGATTTCAGGGG + Intronic
1029761013 7:102600956-102600978 CCAAGTAGCTGGGATTTCAGGGG + Intronic
1030867120 7:114713147-114713169 CCCAGTAGCTGGGATTACAGGGG + Intergenic
1031744160 7:125472383-125472405 CCCAGTAGCTGGGACTGCAAGGG - Intergenic
1031798771 7:126214639-126214661 CCAAGTAGCTGGGATTACAAGGG - Intergenic
1032113702 7:129099167-129099189 GCCTGCAGTTGGGATCCCAATGG - Intergenic
1032176826 7:129636534-129636556 CACTGCACCTGGCTTTTCAATGG + Intronic
1034452972 7:151147613-151147635 CCTTGCATCTGGAATATCAAAGG + Intergenic
1034562894 7:151893187-151893209 ACCTGCTGCGGGAATTTCAACGG - Intergenic
1035206323 7:157295997-157296019 CCCTGCAGCTGGGGCTGGAACGG + Intergenic
1035206337 7:157296041-157296063 CCCTGCAGCTGGGGCTGGAACGG + Intergenic
1036540738 8:9706486-9706508 CCCAGTAGCTGGGATTACAGGGG + Intronic
1037069301 8:14623738-14623760 CCCTGCAGTTGAGATGTCACCGG + Intronic
1037945730 8:22988283-22988305 CCATGTAGCTGGGATTACAGGGG + Intronic
1038131592 8:24738190-24738212 CCGAGTAGCTGGGATTACAAGGG - Intergenic
1038375815 8:27039176-27039198 CCATAAAACTGGGATTTCAAAGG - Intergenic
1038505923 8:28085046-28085068 CCCTGAAGCTGAGGGTTCAAGGG - Intergenic
1038859959 8:31376028-31376050 TCCTGCAGCTAGGATTCCAGAGG + Intergenic
1038986770 8:32819974-32819996 CCCAGCAGCTGGGACTACAGGGG + Intergenic
1039264334 8:35808599-35808621 TCCTCCTGCTGGGATTTCAGAGG - Intergenic
1040475080 8:47768891-47768913 CCAAGTAGCTGGGATTTCACAGG - Intergenic
1040560659 8:48520792-48520814 CTCAGCAGCTTTGATTTCAATGG - Intergenic
1041086304 8:54259543-54259565 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1041241015 8:55849103-55849125 CCCAGTAGCTGGGATTACAGGGG + Intergenic
1041509589 8:58641045-58641067 CCAAGTAGCTGGGATTACAAGGG + Intronic
1042054646 8:64751003-64751025 CCCTGCAGCAGGAAATTCATGGG - Intronic
1042447816 8:68908707-68908729 CCCTGTAGATGGAATTTTAAAGG - Intergenic
1043702856 8:83312870-83312892 GCCTGAAGGTGGGGTTTCAACGG + Intergenic
1043967480 8:86495315-86495337 TCCTGCAGCTAGGATCTCTAAGG - Intronic
1044224178 8:89701028-89701050 TCCTGCAGCTAGGATTCCAGAGG + Intergenic
1044260470 8:90114042-90114064 CTCTGCTTCTGGGACTTCAATGG + Intergenic
1045429956 8:102104532-102104554 CCCTGCACTTGGGATTTCCTAGG + Intronic
1045476272 8:102555498-102555520 CCCTGGTGTGGGGATTTCAAGGG - Intronic
1046338060 8:112815595-112815617 CACTGTAGCAGGCATTTCAAAGG - Intronic
1046420704 8:113980087-113980109 GCCTGCAGCTAGAATATCAAAGG - Intergenic
1046626816 8:116584168-116584190 CCCTTCAGCTGGGAGTGGAAAGG - Intergenic
1046839056 8:118837432-118837454 CCTTGCAGCTAGGATTTCCTGGG + Intergenic
1047340531 8:123976382-123976404 CCCAGTAGCTGGGATTACAGGGG - Intronic
1047724447 8:127671812-127671834 CCAAGTAGCTGGGATTACAAGGG - Intergenic
1049420141 8:142512855-142512877 CCCTGCTGCTGGAATTTCAGGGG - Intronic
1050864476 9:10480350-10480372 CCCTCCAGCTAGGATTATAAGGG + Intronic
1051346700 9:16157531-16157553 CACTACAGCTGGGATTTTATAGG - Intergenic
1051640883 9:19223561-19223583 CCAAGTAGCTGGGATTACAAGGG - Intergenic
1051996178 9:23220257-23220279 CCTTGGAGGTGGGATTTCACTGG + Intergenic
1052256723 9:26465847-26465869 CCCAGTAGCTGGGATTACAAGGG + Intergenic
1052774681 9:32721639-32721661 CCCTGCAGCTGAGATCTGTATGG - Intergenic
1055039992 9:71859347-71859369 CCAAGCAGCTGGGATTACAGAGG + Intergenic
1055045068 9:71915304-71915326 CCAAGTAGCTGGGATTTCAGGGG + Intronic
1056566812 9:87779987-87780009 CCGAGTAGCTGGGATTACAAAGG - Intergenic
1057895685 9:98906911-98906933 CCCGGCAGCTGGGCCTCCAAGGG - Intergenic
1059393797 9:114017802-114017824 CCCTGCTGTTGGGATACCAAGGG + Intronic
1060945280 9:127566818-127566840 CCTTCCAGCAGAGATTTCAAAGG + Intronic
1061022498 9:128025370-128025392 CCCTGCAGCTGGGTTTAGAATGG - Intergenic
1061354209 9:130091819-130091841 CCAAGTAGCTGGGATTACAAGGG + Intronic
1061495615 9:130972774-130972796 CCCATCTGCTGAGATTTCAAAGG - Intergenic
1061509186 9:131050038-131050060 CCCTGCAGCCAGGAAGTCAAAGG + Intronic
1187340812 X:18419968-18419990 CCCAGTAGCTGGGATTACAGGGG + Intergenic
1187391528 X:18889496-18889518 CCCTGCAGCTGGCATAGCCAAGG - Intergenic
1189040544 X:37538002-37538024 TCCTCCTGCTGAGATTTCAAAGG + Intronic
1189990701 X:46591498-46591520 CCCAGTAGCTGGGATTACAGGGG + Intronic
1190791772 X:53707219-53707241 CCATGTAGCTGGGACTACAAAGG - Intergenic
1190801160 X:53790116-53790138 CCAAGTAGCTGGGATTTCACAGG - Intergenic
1191595286 X:62936731-62936753 CCTTGCAGGTGGGATTTCACTGG + Intergenic
1193472588 X:81925532-81925554 CCCTGAAGCTAGGATTCCAGAGG - Intergenic
1193577232 X:83214494-83214516 CCCTGCAGCTAGGATTCAATAGG - Intergenic
1193891402 X:87050328-87050350 TCCTGCAGCTAGGATTTAAGAGG + Intergenic
1193916451 X:87370554-87370576 CCCTGCAGCTAGTATTTCAGAGG - Intergenic
1194039655 X:88924311-88924333 CCAAGCAGCTGGGATTACAGGGG - Intergenic
1195023250 X:100850207-100850229 CCCTGCTGCTCGGATATGAATGG + Exonic
1195151164 X:102071761-102071783 TCCTGCAGCTGGGATTCCAGAGG - Intergenic
1195172955 X:102286592-102286614 TCCTGCAGCTTGGATTCCAGAGG + Intergenic
1195185911 X:102400503-102400525 TCCTGCAGCTTGGATTCCAGAGG - Intronic
1196755313 X:119152254-119152276 CCCTGCTTCTGGAATTTCACTGG + Intergenic
1197014306 X:121605079-121605101 TCCTGAAGCTGGGATTTCAGAGG + Intergenic
1197177462 X:123500800-123500822 TCCTGCAGCTAAGATTCCAATGG + Intergenic
1197393653 X:125898717-125898739 CCCTGCAGCTGGGATTCCAGAGG + Intergenic
1197965955 X:132061899-132061921 CCCCGCAGCTGGGGTTGTAAAGG + Intergenic
1197986290 X:132269521-132269543 CCCAGTAGCTGGGATTACAGGGG - Intergenic
1198399221 X:136252970-136252992 CCGAGCAGCTGGGATTACAGGGG - Intronic
1198586664 X:138129079-138129101 CCCTGCAGCTAGGATCCCAGAGG + Intergenic
1198910042 X:141603082-141603104 CCCTGGAGATGGGAGTTCCAAGG + Intronic
1199408088 X:147485900-147485922 TCCTGCAGCTAGGATTCCAGAGG + Intergenic
1199461954 X:148094464-148094486 CCCTGCAGCTAGGATCCCAGAGG + Intergenic
1200278417 X:154756188-154756210 CCGAGTAGCTGGGATTACAAGGG - Intergenic
1201237664 Y:11927015-11927037 CCAAGTAGCTGGGATTACAAGGG + Intergenic
1201341431 Y:12938204-12938226 CCTAGTAGCTGGGATTACAAGGG - Intergenic
1201579172 Y:15493179-15493201 CCAAGCAGCTGGGATTACAGGGG + Intergenic