ID: 950240451

View in Genome Browser
Species Human (GRCh38)
Location 3:11365318-11365340
Sequence CATGCAGGGTCACCAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950240448_950240451 11 Left 950240448 3:11365284-11365306 CCTTTATAGGCAGGCATGAGAAA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 950240451 3:11365318-11365340 CATGCAGGGTCACCAAAAAGTGG 0: 1
1: 0
2: 0
3: 13
4: 167
950240444_950240451 24 Left 950240444 3:11365271-11365293 CCCAAATAGAAAACCTTTATAGG 0: 1
1: 0
2: 2
3: 17
4: 244
Right 950240451 3:11365318-11365340 CATGCAGGGTCACCAAAAAGTGG 0: 1
1: 0
2: 0
3: 13
4: 167
950240446_950240451 23 Left 950240446 3:11365272-11365294 CCAAATAGAAAACCTTTATAGGC 0: 1
1: 0
2: 1
3: 16
4: 131
Right 950240451 3:11365318-11365340 CATGCAGGGTCACCAAAAAGTGG 0: 1
1: 0
2: 0
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950240451 Original CRISPR CATGCAGGGTCACCAAAAAG TGG Intronic
901748581 1:11391505-11391527 AATGTAGGGTCACCAGAAATAGG - Intergenic
902162228 1:14540318-14540340 CTTGCAGGCTCACCTAAGAGAGG - Intergenic
906853002 1:49272200-49272222 AATCCTGGGTCTCCAAAAAGAGG - Intronic
909732480 1:78912021-78912043 ACTGCAGGGTGACCAAAAAGAGG + Intronic
911317867 1:96376564-96376586 CATGCAGGTTGACAGAAAAGTGG - Intergenic
912142628 1:106749820-106749842 CAGGCAGAGCCACCAAAAAAAGG + Intergenic
912845807 1:113073660-113073682 CAGGCAGAGTGACCAAAAGGAGG + Intronic
913476089 1:119239471-119239493 CATCCAGGGTCACCACACATTGG + Intergenic
915630134 1:157147309-157147331 ATTGCAGGGACACCAAGAAGAGG + Intergenic
918633515 1:186747731-186747753 CCTGCAGGCTCACCACAATGTGG - Intergenic
920641391 1:207754729-207754751 CCTGCAGAGTCAACAAATAGGGG - Intronic
921528181 1:216244394-216244416 CCTGTAGGGTTACCAAAAATGGG - Intronic
924491893 1:244545984-244546006 TATGCAGCAGCACCAAAAAGTGG + Intronic
1063982114 10:11462769-11462791 AATTCAGGGTCACCAAAGAATGG - Exonic
1068147408 10:53088915-53088937 GATGCTGGGTCACCAAAGAATGG + Intergenic
1072425558 10:95327402-95327424 CATGCAGGGTCACCCACTTGAGG - Intronic
1075188136 10:120281910-120281932 CATGCAGGGGCACCAAACAAAGG - Intergenic
1075680707 10:124329166-124329188 CATGGAGGGTCACAGAAGAGAGG + Intergenic
1075681884 10:124339180-124339202 CATGCAAGGTGAGCAGAAAGTGG + Intergenic
1077446577 11:2594017-2594039 TATGCAGCATCAACAAAAAGAGG - Intronic
1078760643 11:14248679-14248701 CAGGCAGGCTCAGCAAAGAGAGG - Intronic
1079269975 11:18975147-18975169 CATGCAGGATCACAAAAATGAGG + Intergenic
1080531314 11:33179418-33179440 ATTGCAGAGTGACCAAAAAGAGG + Intergenic
1089376887 11:118000717-118000739 CATGGAGGGTCCCCTAAAGGTGG - Exonic
1089857130 11:121555913-121555935 CATGCAGAGTCAGTATAAAGAGG - Intronic
1099528025 12:83740010-83740032 CATGTAGGATTACTAAAAAGTGG - Intergenic
1101083389 12:101210599-101210621 CATGAAGGCTCATTAAAAAGCGG - Intergenic
1102951064 12:117031939-117031961 CACTCAGAGTCACCAAAAATTGG - Intergenic
1105089867 13:16268819-16268841 CATGCAGATTCTACAAAAAGAGG - Intergenic
1105133364 13:16981693-16981715 CTTGCAGATTCAACAAAAAGTGG - Intergenic
1108387343 13:49912056-49912078 CTTTCAGGGTCACCAAAACATGG - Intergenic
1108737686 13:53301880-53301902 CATGCAGAGTCACCATAAACAGG - Intergenic
1112611299 13:100957310-100957332 CAAGCAGGGACACCACAGAGAGG - Intergenic
1113275339 13:108722247-108722269 CATAAAGTGTCACCAGAAAGTGG + Intronic
1114380507 14:22198631-22198653 CTTGCAGGCTCACCACCAAGTGG - Intergenic
1116601354 14:46928593-46928615 CATGCTGAGTCACTAGAAAGTGG - Intronic
1119856537 14:77905188-77905210 TTTGCAGGGAGACCAAAAAGGGG + Intronic
1121280156 14:92692210-92692232 CAGGCAGGGTCCCCAAGAACTGG - Intergenic
1121467797 14:94127281-94127303 CAGGAATGGTCACCAAAATGTGG - Intergenic
1126927062 15:53601157-53601179 CATGCAGGGTTTCCACTAAGAGG - Intronic
1127732538 15:61814005-61814027 GATGCTGGGACACCAAAGAGTGG + Intergenic
1130011780 15:80157942-80157964 CATACAGGGCCACCTAAAGGGGG + Intronic
1130297823 15:82659658-82659680 CATCCAGGGTCAGCAGAACGAGG + Exonic
1132247939 15:100311621-100311643 CATGCAGCTCCACCAAACAGAGG - Intronic
1133831092 16:9324393-9324415 CATTCAGGGTCTACATAAAGAGG - Intergenic
1135144940 16:19953181-19953203 AATCCTGGGTCCCCAAAAAGAGG - Intergenic
1136554482 16:30999778-30999800 CATGAAGGTTCACCAGAAAAAGG - Intronic
1138798865 16:60001855-60001877 CATGCAGGCTCAACACAATGTGG - Intergenic
1140585198 16:76281871-76281893 CATGCAGGTTTACTAATAAGTGG - Intronic
1141014356 16:80434568-80434590 CATGCATAATCACCAAAAACTGG + Intergenic
1143886222 17:10067049-10067071 CCTGCAGTGTCAGCAAAGAGAGG - Intronic
1144413523 17:15023904-15023926 TATGCAGGGGCACCCAAAAGGGG - Intergenic
1145312510 17:21708293-21708315 CTGGCTGGGTCAGCAAAAAGGGG - Intergenic
1145689097 17:26715554-26715576 CATGCAGATTCTACAAAAAGAGG - Intergenic
1148806164 17:50265078-50265100 CAACCAGTGTCACCCAAAAGGGG + Intergenic
1149112039 17:53046035-53046057 AGTGCCGGGTCACCAAAGAGGGG - Intergenic
1149465668 17:56877088-56877110 CATGCAAGGTCACCATGATGCGG + Intergenic
1150773752 17:68062738-68062760 AATGATGGGTCACCAAAAAAGGG - Intergenic
1151332442 17:73418644-73418666 CATTAAGGGTCACTAAAATGTGG - Intronic
1151569995 17:74921364-74921386 CTTGCAGGGATACCAAAGAGGGG - Intronic
1155183857 18:23370988-23371010 TTTCCAAGGTCACCAAAAAGTGG + Intronic
1155917079 18:31567539-31567561 AATGCATAGACACCAAAAAGGGG + Intergenic
1157565990 18:48679790-48679812 CATGGAGGGGCATAAAAAAGGGG - Intronic
1161041343 19:2112196-2112218 CATACTGTGTCACCACAAAGGGG + Intronic
1163772491 19:19199276-19199298 TAGGCAGGGTGACCATAAAGGGG + Intronic
1164348496 19:27299705-27299727 CTTGCAGATTCAACAAAAAGTGG - Intergenic
1164362156 19:27525406-27525428 CATGCAGAGTCATCTAACAGAGG + Intergenic
1164560077 19:29285328-29285350 CATTCATAATCACCAAAAAGTGG + Intergenic
1164562386 19:29301189-29301211 CATGCTGGGCCACCAAGTAGAGG - Intergenic
1166697987 19:44865191-44865213 CAGGCAGGGCCACCACGAAGGGG - Intronic
925905010 2:8535096-8535118 CCTGCAGGGTCAGCAAAGACAGG + Intergenic
926409327 2:12585976-12585998 AATGCAAGGTCAGCAAACAGTGG + Intergenic
927195597 2:20544363-20544385 CCTGCAGAGCCACCAAAAACAGG + Intergenic
927304172 2:21551225-21551247 AAAGCAGGGTCAGCAAAAATAGG - Intergenic
927482709 2:23467095-23467117 CAGGCAGGGTCACCAAAGGCAGG - Intronic
928361164 2:30663407-30663429 CATGCAGGGGAAGCACAAAGTGG + Intergenic
929248363 2:39726760-39726782 CTAGCAGGGTGACCAAAAAATGG + Intergenic
933031921 2:77339080-77339102 GATACAGGGACTCCAAAAAGAGG + Intronic
933315662 2:80711399-80711421 AATGCAGGGTCACCATAGAGAGG - Intergenic
933612626 2:84453275-84453297 CATGAAGAGCCAACAAAAAGTGG + Intronic
934472184 2:94558061-94558083 CATGCAGATTCTACAAAAAGGGG + Intergenic
938533448 2:132217707-132217729 CATGCAGATTCTACAAAAAGGGG - Intronic
938533459 2:132217878-132217900 CATGCAGATTCTACAAAAAGAGG - Intronic
938533468 2:132218049-132218071 CATGCAGATTCTACAAAAAGAGG - Intronic
939117174 2:138073593-138073615 CATTCAGGGACACCAAAGAGAGG - Intergenic
939124769 2:138164915-138164937 AATGCTGGGTTACCAAAAAATGG - Intergenic
940137646 2:150457176-150457198 CATTCAGAATCACCAAACAGAGG + Intergenic
941877713 2:170451885-170451907 CATCCTGGATCCCCAAAAAGAGG + Intronic
944206050 2:197159842-197159864 AATCCAGGGTCACCAAATATTGG - Intronic
944783164 2:203040734-203040756 CATGATGGGTCACCAAAAGGTGG - Intronic
946878187 2:224151030-224151052 CATGAAAGGACACCAGAAAGTGG + Intergenic
1169123187 20:3109695-3109717 CCTTCAGGGTCATCCAAAAGTGG - Exonic
1169650573 20:7862212-7862234 AAGGCAGGGTCACCAAAGGGAGG + Intergenic
1171425338 20:25045287-25045309 GGTGCAGGGTCAGCAGAAAGAGG - Intronic
1171743772 20:28938863-28938885 CTTGCAGATTCAACAAAAAGAGG - Intergenic
1174105103 20:48156318-48156340 CATGCAGGTTAACCTGAAAGGGG - Intergenic
1176057012 20:63154392-63154414 CGTGCAGGGCCACCAAGAACAGG + Intergenic
1176320287 21:5310755-5310777 CATGCAGATTCTACAAAAAGAGG - Intergenic
1176477751 21:7242477-7242499 CATGCAGATTCTACAAAAAGAGG - Intergenic
1178294899 21:31401514-31401536 CAGGCAGGCTCTCCAAAAGGTGG - Intronic
1179328341 21:40373245-40373267 CATGCATGATCTCCAGAAAGAGG + Intronic
1180396725 22:12353814-12353836 CTTGCAGATTCAACAAAAAGAGG + Intergenic
1180396927 22:12357742-12357764 CTTGCAGATTCAACAAAAAGAGG + Intergenic
1180402787 22:12506389-12506411 CTTGCAGATTCAACAAAAAGAGG - Intergenic
1180402989 22:12510315-12510337 CTTGCAGATTCAACAAAAAGAGG - Intergenic
950240451 3:11365318-11365340 CATGCAGGGTCACCAAAAAGTGG + Intronic
951679591 3:25280933-25280955 CAAGCAGGGTCACAAAAAGAAGG + Intronic
952599448 3:35061932-35061954 CATGCAGTGTCATTTAAAAGGGG - Intergenic
953118774 3:40018733-40018755 AATCCAGGGACTCCAAAAAGAGG + Intronic
953139816 3:40218191-40218213 CATTCATGATCACCAAAAACTGG + Intronic
954379446 3:50211895-50211917 AATGCTGGGTCTCAAAAAAGAGG - Intronic
955342363 3:58134968-58134990 CATGAAAATTCACCAAAAAGTGG - Intronic
956004725 3:64766216-64766238 CAAGCTGGGTCACCAGAAACTGG + Intergenic
956128113 3:66030007-66030029 CATGCAGGGAAACCTAAAATTGG + Intronic
958207049 3:90414586-90414608 CTTGCAGGTTCTACAAAAAGAGG + Intergenic
958207591 3:90423310-90423332 CATGCAGATTCTACAAAAAGAGG + Intergenic
958210915 3:90474014-90474036 CTTGCAGATTCCCCAAAAAGAGG + Intergenic
958218215 3:90622014-90622036 CTTGCAGAGTCTACAAAAAGAGG + Intergenic
960664855 3:120098837-120098859 CATGCAGGTTTACTAAAGAGAGG - Intergenic
961588893 3:127960077-127960099 CCTGCAGGGTCACCTCAAGGTGG - Intronic
963903109 3:150751529-150751551 CAAACAGTGTCACCAAACAGTGG + Intronic
964040660 3:152257470-152257492 CATGATGGGTCACCAATGAGAGG - Intronic
965346161 3:167553392-167553414 GATGTAGAGTCACCTAAAAGTGG - Intronic
975168336 4:71203543-71203565 CATGCATGCTAACAAAAAAGAGG - Intronic
978467661 4:109026642-109026664 CATGCACAGTTACTAAAAAGAGG - Intronic
979530338 4:121764085-121764107 CATGGAGGGCCAGCTAAAAGAGG - Intronic
981806667 4:148724096-148724118 CAAGCAGGTTCATAAAAAAGAGG + Intergenic
985543728 5:498987-499009 GATGCAGGGTCACCAAGGAGAGG - Intronic
988038469 5:25858239-25858261 GCTGCAGGGTGACCAAACAGAGG + Intergenic
989194694 5:38705215-38705237 CAAACAAGGTCATCAAAAAGTGG + Intergenic
989927474 5:49898735-49898757 CATGCAGATTCTACAAAAAGAGG - Intergenic
989929530 5:49929387-49929409 CTTGCAGATTCTCCAAAAAGAGG - Intergenic
990559819 5:56972794-56972816 TATTCATAGTCACCAAAAAGTGG + Intergenic
994374341 5:99002196-99002218 GATGGAGGCTCACCATAAAGAGG + Intergenic
994456959 5:100022184-100022206 CATGCTGGTTGACCAAAAACAGG + Intergenic
996539804 5:124618080-124618102 CAGGCAGGGACAACAAAAAATGG + Intergenic
998500282 5:142626727-142626749 GCTGCAGGGTCACCTAAAGGAGG - Intronic
1000108916 5:158088457-158088479 CTTGCAGGAACACAAAAAAGGGG - Intergenic
1003220301 6:4155231-4155253 CATGCAGGGGCAGAAAACAGAGG + Intergenic
1004765691 6:18723608-18723630 CATCCTGGATCCCCAAAAAGAGG - Intergenic
1009468483 6:64002609-64002631 GCTGCAGGGTGACCAAACAGGGG + Intronic
1012367922 6:98464854-98464876 TATTCAGGATCACCAGAAAGGGG + Intergenic
1015835358 6:137414821-137414843 CATGCAGCGTTCCCAACAAGTGG - Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024690294 7:51793745-51793767 CATGCACACACACCAAAAAGAGG - Intergenic
1025309637 7:57915360-57915382 CATGCAGATTCCACAAAAAGAGG + Intergenic
1025310055 7:57923938-57923960 CTTGCAGAGTCTACAAAAAGAGG - Intergenic
1025310094 7:57924620-57924642 CTTGCAGATTCTCCAAAAAGAGG - Intergenic
1027600633 7:80236001-80236023 AAAGCAGGGTCAACGAAAAGGGG + Intergenic
1027674293 7:81140892-81140914 CATGCAGGAACACCAAATTGAGG + Intergenic
1029180016 7:98693601-98693623 CAGGCAGGGGCATCAACAAGGGG + Intergenic
1030775310 7:113527696-113527718 CATGCAGGTTCACAGAAGAGTGG - Intergenic
1031792973 7:126133748-126133770 CTGGCAAGGTCACCAAAAAAAGG + Intergenic
1032011941 7:128352508-128352530 CCTCCAGGGTCAGGAAAAAGAGG + Exonic
1032367464 7:131313918-131313940 AATCCTGGGTCCCCAAAAAGAGG + Intronic
1033738883 7:144252577-144252599 CATTCAGGGTAAGGAAAAAGGGG + Intergenic
1033744164 7:144298377-144298399 CATTCAGGGTAAGGAAAAAGGGG - Intergenic
1036748158 8:11424654-11424676 CAGGCAGGGTCAGCAGAGAGTGG + Intronic
1040128099 8:43761741-43761763 CTTGCAGGTTCTCCAAAAAGCGG - Intergenic
1040320774 8:46298174-46298196 CTTGCAGAGTCTACAAAAAGAGG + Intergenic
1043113331 8:76216047-76216069 TATTCAGGGTCAGAAAAAAGTGG + Intergenic
1048527811 8:135219977-135219999 CAAGGACTGTCACCAAAAAGGGG - Intergenic
1050115660 9:2260815-2260837 CATGCAGGGTGACTCAGAAGGGG - Intergenic
1050627705 9:7523004-7523026 CATAAAGGGTGACCAAAAAGGGG - Intergenic
1052361430 9:27564788-27564810 CATTGAGGGTCACCCACAAGAGG + Intronic
1052922862 9:33986262-33986284 CAGGCAGGGTCTCAAAAAAAGGG + Intronic
1053055570 9:34991454-34991476 AATGCAGGGACACCAAAAGGAGG + Intronic
1053687699 9:40554826-40554848 CTTGCAGATTCAGCAAAAAGAGG - Intergenic
1054276056 9:63071758-63071780 CTTGCAGATTCAGCAAAAAGAGG + Intergenic
1054398777 9:64693171-64693193 CTTGCAGATTCAGCAAAAAGAGG - Intergenic
1056197503 9:84242324-84242346 CATGCAGCGGGACCAAAAAGTGG + Intergenic
1058392463 9:104511409-104511431 CATGAAGAGTCTCCAAAAAAAGG + Intergenic
1203420821 Un_KI270448v1:1822-1844 CTTGCAGAGTCCACAAAAAGAGG - Intergenic
1203686068 Un_KI270757v1:61748-61770 CTTGCAGATTCAACAAAAAGAGG + Intergenic
1186659704 X:11657260-11657282 AAGGCAGGGTGACCAAGAAGGGG + Intronic
1189812640 X:44794786-44794808 CATGCTGGGGGACAAAAAAGGGG - Intergenic
1191570102 X:62602905-62602927 CATGCAGATTCTGCAAAAAGAGG - Intergenic
1191570158 X:62603929-62603951 CATGCAGATTCTGCAAAAAGAGG - Intergenic
1191771141 X:64759892-64759914 CAAGCAACTTCACCAAAAAGTGG - Intergenic
1194558352 X:95389770-95389792 CATGCAGGGGGAACAATAAGTGG + Intergenic
1197198015 X:123722755-123722777 CATGCAGTGTAACCCAAAAAGGG + Intronic